Method for targeting interference protein translation by using circular RNA (Ribonucleic Acid)

Abstract

The invention relates to the field of molecular biology, in particular to a method for targeting interference protein translation by circular RNA (circRNA). According to the invention, translation inhibition of a target gene is realized by constructing and recombining circRNA based on a circRNA mRNA brake model. The recombinant circRNA has an internal ribosome entry site (IRES) and a reverse complementary sequence of a target gene mRNA at the same time, ribosome and the target gene mRNA can be combined in cells at the same time, and a brake is similar to the movement of mRNA on the ribosome, so that translation inhibition of the target gene is caused. The technology provided by the invention is expected to be applied to the fields of functionalization, drug target screening, cell signal transduction pathway analysis, disease treatment and the like, and realizes an inhibition effect on translation of a plurality of target proteins.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, in particular to a method for targeted intervention in protein translation process by using circular RNA. BACKGROUND

[0002] At present, the interference of genes mainly focuses on the pre-translation stage, such as Cas-CRISPR technology or small interfering RNA, the former can achieve gene knockout at the pre-transcription level, and the latter can achieve target RNA knockdown at the post-transcription and pre-translation stage. At present, both technologies are widely used in molecular biology. However, there are few reports on gene interference technology based on protein translation principle.

[0003] Circular RNA (circRNA) is a new endogenous non-coding RNA discovered in recent years, which is formed by reverse splicing of mRNA precursor transcript and has a closed loop structure. Compared with linear mRNA, the unique loop structure of circRNA makes it more stable.

[0004] Based on the complexity of tumor occurrence and development, most tumors do not rely on a single signal pathway to maintain growth and survival, and there is often cross and compensation between signal pathways. Therefore, in the process of drug research and development, researchers have proposed a new concept - multi-target tyrosine kinase inhibition strategy, that is, to achieve the dual functions of synergistic treatment and overcoming drug resistance by inhibiting multiple signal pathways or multiple molecules downstream of a signal pathway. For example, the first-line targeted drugs for liver cancer, lenvatinib and sorafenib, and the second-line targeted drug regorafenib are all multi-kinase target drugs. However, the clinical efficacy is far from the expected value of the medical and patient parties. SUMMARY

[0005] The purpose of the present application is to supplement the existing gene interference technology and provide a new method for multi-target interference.

[0006] In the study of circRNA mechanism, it is confirmed that circ-MALAT1 can form a new ternary complex with ribosomes and tumor suppressor gene PAX5 mRNA, hinder the movement of the latter on the ribosomes, and ultimately inhibit the translation of PAX5 mRNA. We call this circRNA mechanism model "mRNA brake (mRNA brake)". This model provides a new means for inhibiting the translation of a single or multiple protein molecules. The schematic diagram of the mRNA brake mechanism is shown in Figure 1 .

[0007] The technical problem to be solved by the present application is to provide a gene interference means, which induces the translation silencing of a single or multiple genes by using the circRNA "mRNA brake" mechanism model.

[0008] The present application is realized by the following technical scheme: the present application designs a sequence which is reverse complementary to a target molecule, clones it into a modified circRNA, which should have an internal ribosome entry site (IRES). The recombinant circRNA is transfected into the target cells, and the protein is extracted after 48-72h of culture, and the expression of the target gene is detected by Western Blot.

[0009] In order to achieve the above-mentioned purpose, the present application provides a method for targeting protein translation by using circRNA, which is realized by designing a sequence which is reverse complementary to a target molecule, cloning and recombining it into a modified circRNA, which has an IRES, and transfecting the recombinant circRNA into the target cells, so as to inhibit the expression of the target gene; the nucleotide sequence of the modified circRNA is shown in SEQ ID No. 1:

[0010] SEQ ID No. 1:

[0011] GTTGAAAGGATTGTTGACAAAAGGAAAAATAAAAAAGGGAAGACAGAGTATTTGGTTCGGTGGAAAGGCTATGACAGCGAGGACGACACTTGGGAGCCGGAACAGCACCTCGTGAACTGTGAGGAATACATCCACGACTTCAACAGACGCCACACGGAGAAGCAGAAGGAGAGCACATTGACCAAGCCAGCTGTTTGCTGCCAGCCAGAAGTTCAGGAAGAACACAGCTCCATCTCTCTCCAGCCGGAAGAACATGGACCTAGCGAAGTCAGGTATCAAGATCCTCGTGCCTAAAAGCCCCGTTAAGAGCAGGACCGCAGTGGACGGCTTTCAGAGCGAGAGCCCTGAGAAACTGGACCCCGTCGAGCAGGGTCAGGAGGACACAGTGGCACCCGAAGTGGCAGCGGAAAAGCCGGTCGGAGCTTTATTGGGCCCCGGTGCCGAGAGGGCCAGGATGGGGAGCAGGCCCAGGATACACCCACTAGTGCCTCAGGTGCCCGGCCCTGTGACTGCAGCCATGGCCACAGGCTTAGCTGTTAACGGGAAAG.

[0012] Further, the method for targeting protein translation by using circRNA comprises the following steps:

[0013] (a) obtaining a circRNA gene sequence containing IRES by gene cloning method, the nucleotide sequence of which is shown as SEQ ID No. 1;

[0014] (b) obtaining the coding region sequence of the target gene from NCBI data, selecting 21 continuous bases with better specificity as the target sequence, and multiple sequences can be concatenated, and adding the homologous arm sequence shown as SEQ ID No. 2 to the 3' end to obtain the reverse amplification primer of the target sequence;

[0015] SEQ ID No. 2: TGGTCAATGTGCTCTCCT;

[0016] (c) obtaining the reverse complementary sequence of the target sequence, adding the homologous arm sequence shown as SEQ ID No. 3 to the 3' end to obtain the forward amplification primer of the target sequence;

[0017] SEQ ID No. 3: AGCCAGCTGTTTGCTGCC;

[0018] (d) synthesizing the forward and reverse amplification primers of SEQ ID No. 1, the nucleotide sequences of which are shown as SEQ ID No. 4 and SEQ ID No. 5, respectively;

[0019] SEQ ID No. 4:

[0020] ATCTGTTCAATTAACGAATTCTGAAATATGCTATCTTACAGGTTGAAA GGATTGTTGAC;

[0021] SEQ ID No. 5:

[0022] ATCATCCCAAATTAGTGGATCCTCAAGAAAAAATATATTCACCTTTCC CGTTAACAGCTA;

[0023] (e) using PCR technology, taking SEQ ID No. 1 as the template, and using SEQ ID No. 4 and the reverse amplification primer of the target sequence to amplify fragment 1, and using SEQ ID No. 5 and the forward amplification primer of the target sequence to amplify fragment 2;

[0024] (f) treating pLCDH-ciR (a commercialized vector of Jiesai Biotechnology) with restriction endonuclease EcoR1 and BamH1 to obtain a linearized vector; the map of pLCDH-ciR is shown as Figure 2 ;

[0025] (g) the fragment 1, the fragment 2 and the linearized vector are connected together by homologous recombination to obtain a recombinant plasmid;

[0026] (h) 12-24 hours in advance, the cells to be transfected are plated into 6-well culture plates, the recombinant plasmid is transfected into the cells by using a liposome transfection technique, and the cells are cultured for 48-72 hours;

[0027] (i) the transfected cells are collected, and the protein supernatant is lysed and collected;

[0028] (j) the expression of the target protein is detected by using Western Blot.

[0029] In an embodiment of the present application, the protein is TAZ and / or ERK protein.

[0030] In an embodiment of the present application, in step h, the cells are liver cancer cell line Huh7.

[0031] Further, when the protein is TAZ protein, the reverse amplification primer sequence of the target sequence in step e is shown in SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12 or SEQ ID No. 13; and the forward amplification primer sequence of the target sequence is shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16 or SEQ ID No. 17.

[0032] Further, when the protein is ERK protein, the reverse amplification primer sequence of the target sequence in step e is shown in SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24 or SEQ ID No. 25; and the forward amplification primer sequence of the target sequence is shown in SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28 or SEQ ID No. 29.

[0033] Further, when the protein is TAZ and ERK protein, the reverse amplification primer sequence of the target sequence in step e is shown in SEQ ID No. 30; and the forward amplification primer sequence of the target sequence is shown in SEQ ID No. 31.

[0034] The present application has the following advantages:

[0035] 1. The present application provides a new method of multi-target interference, which supplements the existing gene interference technology. The present application is based on the circRNA mRNA brake model, and the translation inhibition of target genes is realized by constructing a recombinant circRNA. The recombinant circRNA has an internal ribosome entry site (IRES) and a target gene mRNA reverse complementary sequence, which can bind ribosomes and target gene mRNA in cells at the same time, similar to a brake to hinder the movement of mRNA on the ribosome, resulting in translation inhibition of the target gene. The technology of the present application is expected to be applied to the fields including functional studies, drug target screening, cell signaling pathway analysis, disease treatment, etc., to realize the inhibition of translation of multiple target proteins.

[0036] 2. The present application relates to gene cloning, cell culture and transfection, target protein detection, etc. Due to its high sequence specificity and effective interference, it can specifically silence specific genes, thereby realizing gene function loss or reducing gene expression, and is a specific post-transcriptional gene silencing technology, which can be used as a powerful research tool for functional genomics. BRIEF DESCRIPTION OF DRAWINGS

[0037] Figure 1 .mRNA brake mechanism schematic diagram;

[0038] Figure 2 .pLCDH-ciR map;

[0039] Figure 3 .TAZ protein expression;

[0040] Figure 4 .ERK protein expression;

[0041] Figure 5 .TAZ and ERK protein expression. DETAILED DESCRIPTION

[0042] The specific embodiments provided by the present application will be described in detail below in combination with examples.

[0043] Example 1: TAZ single gene intervention

[0044] 1. Design TAZ target sequence

[0045] Based on the website:

[0046] https: / / www.sigmaaldrich.cn / CN / zh / semi-configurators / shrna?activeLink=pro ductSearchand NCBI BLAST, four target sequences with high specificity for the coding region of TAZ were selected, named site 1, site 2, site 3, site 4, and their sequences are shown in SEQ ID No. 6-SEQ ID No. 9, respectively.

[0047] SEQ ID No. 6: CCAAGTACATGAACCACCTGA;

[0048] SEQ ID No. 7: CTGTGGCATGTCGGAATGAAT;

[0049] SEQ ID No. 8: AGTGAACATGAGTTCCGAATT;

[0050] SEQ ID No. 9: CGGACTTCATTCAAGAGGAAT.

[0051] 2. Synthesis of recombinant plasmid

[0052] Using PCR technology, the modified circRNA with IRES (the sequence is shown in SEQ ID No. 1) as a template, SEQ ID No. 4 and four reverse amplification primers (the sequences are shown in SEQ ID No. 10-SEQ ID No. 13) of the four target sequences were used to amplify fragment 1 of the four target points, and SEQ ID No. 5 and four forward amplification primers (the sequences are shown in SEQ ID No. 14-SEQ ID No. 17) of the four target sequences were used to amplify fragment 2 of the four target points. The fragments 1, fragments 2 and the pLCDH-ciR linearized vector treated by restriction enzymes EcoR1 and BamH1 were recovered and purified by DNA electrophoresis. The fragments 1, fragments 2 and linearized vectors of each target point were synthesized into recombinant plasmids by homologous recombination technology. For example, SEQ ID No. 4 and SEQ ID No. 10 were used to amplify fragment 1 of site 1, SEQ ID No. 5 and SEQ ID No. 14 were used to amplify fragment 2 of site 1, and the two fragments and the linearized vector were used to synthesize the recombinant plasmid for site 1 by homologous recombination technology. By analogy. The four recombinant plasmids were confirmed to be correct by Sanger sequencing.

[0053] SEQ ID No. 10:

[0054] CCAAGTACATGAACCACCTGATGGTCAATGTGCTCTCCT;

[0055] SEQ ID No. 11:

[0056] CTGTGGCATGTCGGAATGAATTGGTCAATGTGCTCTCCT;

[0057] SEQ ID No. 12:

[0058] AGTGAACATGAGTTCCGAATTTGGTCAATGTGCTCTCCT;

[0059] SEQ ID No. 13:

[0060] CGGACTTCATTCAAGAGGAATTGGTCAATGTGCTCTCCT;

[0061] SEQ ID No. 14:

[0062] TCAGGTGGTTCATGTACTTGGAGCCAGCTGTTTGCTGCC;

[0063] SEQ ID No. 15:

[0064] ATTCATTCCGACATGCCACAGAGCCAGCTGTTTGCTGCC;

[0065] SEQ ID No. 16:

[0066] AATTCGGAACTCATGTTCACTAGCCAGCTGTTTGCTGCC;

[0067] SEQ ID No. 17:

[0068] ATTCCTCTTGAATGAAGTCCGAGCCAGCTGTTTGCTGCC.

[0069] 3. Cell transfection

[0070] Hepatoma cells Huh7 were plated in 6-well plates at an appropriate density, and the next day, the four recombinant plasmids (site 1, site 2, site 3, site 4) and pLCDH-ciR blank plasmid (pLCDH) with target sequences were respectively transfected into Huh7, and cultured at 37°C with 5% CO2 for 48-72h.

[0071] 4. TAZ expression analysis

[0072] The transfected cells were collected for total protein extraction, and the expression of TAZ protein was detected by western blot. The experimental results are shown in Figure 3

[0073] The above results show that the recombinant plasmid for sites 2, 3, and 4 can effectively inhibit the expression of TAZ protein.

[0074] Example 2: ERK single gene intervention

[0075] 1. Design of ERK target sequence

[0076] As in Example 1, four target sequences with high specificity for the ERK coding region were selected, named site 1, site 2, site 3, and site 4, and their sequences are shown in SEQ ID No. 18-SEQ ID No. 21, respectively.

[0077] SEQ ID No. 18: CCTGAATTGTATCATCAACAT;

[0078] SEQ ID No. 19: CGACCTTAAGATTTGTGATTT;

[0079] SEQ ID No. 20: CTATACCAAGTCCATCGACAT;

[0080] SEQ ID No. 21: GCAGCTGAGCAATGACCATAT.

[0081] 2. Synthesis of recombinant plasmid

[0082] Using PCR technology, the modified circRNA with IRES (sequence shown in SEQ ID No. 1) as a template, SEQ ID No. 4 and four reverse amplification primers (sequences shown in SEQ ID No. 22-SEQ ID No. 25) for the four target sequences were used to amplify fragment 1 of the four target points, and SEQ ID No. 5 and four forward amplification primers (sequences shown in SEQ ID No. 26-SEQ ID No. 29) for the four target sequences. The fragment 1, fragment 2 and linearized vector of each target point were synthesized into recombinant plasmids by homologous recombination technology. Sanger sequencing confirmed that the four recombinant plasmids were correct in sequence.

[0083] SEQ ID No. 22:

[0084] CCTGAATTGTATCATCAACATTGGTCAATGTGCTCTCCT;

[0085] ​SEQ ID No. 23:

[0086] CGACCTTAAGATTTGTGATTTTGGTCAATGTGCTCTCCT;

[0087] SEQ ID No. 24:

[0088] CTATACCAAGTCCATCGACATTGGTCAATGTGCTCTCCT;

[0089] SEQ ID No. 25:

[0090] GCAGCTGAGCAATGACCATATTGGTCAATGTGCTCTCCT;

[0091] SEQ ID No. 26:

[0092] ATGTTGATGATACAATTCAGGAGCCAGCTGTTTGCTGCC;

[0093] SEQ ID No. 27:

[0094] AAATCACAAATCTTAAGGTCGAGCCAGCTGTTTGCTGCC;

[0095] SEQ ID No. 28:

[0096] ATGTCGATGGACTTGGTATAGAGCCAGCTGTTTGCTGCC;

[0097] SEQ ID No. 29:

[0098] ATATGGTCATTGCTCAGCTGC AGCCAGCTGTTTGCTGCC.

[0099] 3. Cell transfection

[0100] The same as Example 1.

[0101] 4. ERK expression analysis

[0102] The transfected cells were collected for total protein extraction, and the expression of ERK protein was detected by western blot technology, and the experimental results are shown in Figure 4 .

[0103] The above results show that the recombinant plasmid for sites 1, 2, and 3 can effectively inhibit the expression of ERK protein.

[0104] Example 3: Two gene intervention

[0105] 1. Selection of target sequence

[0106] Based on the results of Example 1 and Example 2 above, TAZ target 2 (sequence as shown in SEQ ID No. 7) and ERK target 2 (sequence as shown in SEQ ID No. 19) were selected as the object of subsequent study.

[0107] 2. Synthesis of recombinant plasmid

[0108] Using PCR technology, the modified circRNA with IRES (sequence as shown in SEQ ID No. 1) as the template, SEQ ID No. 4 and the reverse amplification primer of the tandem target sequence (sequence as shown in SEQ ID No. 30) were used to amplify fragment 1, and SEQ ID No. 5 and the forward amplification primer of the tandem target sequence (sequence as shown in SEQ ID No. 31). Fragment 1, fragment 2 and linearized vector were used to synthesize recombinant plasmid by homologous recombination technology. The sequence of the recombinant plasmid was confirmed by Sanger sequencing.

[0109] SEQ ID No. 30:

[0110] CGACCTTAAGATTTGTGATTTCTGTGGCATGTCGGAATGAATTGGTCA ATGTGCTCTCCT;

[0111] SEQ ID No. 31:

[0112] ATTCATTCCGACATGCCACAGAAATCACAAATCTTAAGGTCGAGCCA GCTGTTTGCTGCC.

[0113] 3. Cell transfection

[0114] Hepatocellular carcinoma Huh7 cells of appropriate density were plated in a 6-well plate. The next day, the recombinant plasmid with target sequence (TAZ & ERK_2sites), the modified plasmid without target sequence (ciR template) and the pLCDH-ciR empty plasmid (pLCDH) were transfected into Huh7 cells, respectively, and cultured at 37°C with 5% CO2 for 48-72h.

[0115] 4. Analysis of target gene expression

[0116] The transfected cells were collected for total protein extraction, and the expression of TAZ and ERK proteins was detected by western blot technology. The experimental results are shown in Figure 5

[0117] ​​​​​​​​​​​​​​​​​​​​​​​​​​​The above results show that the recombinant plasmid for TAZ and ERK site 2 can simultaneously inhibit the protein expression of TAZ and ERK.

[0118] The above has carried out the specific description to the preferable embodiment of the application, but the application is not limited to the described embodiment, the skilled person in the art can also make various equivalent modifications or replacements without departing from the spirit of the application, and these equivalent modifications or replacements are all included in the range defined by the claims of the application.

Claims

1. A method for targeted interference with protein translation using circRNA, characterized in that, The application relates to a method for inhibiting the expression of a target gene, which comprises the following steps: (1) obtaining a circRNA gene sequence containing an internal ribosome entry site by a gene cloning method; (2) obtaining a coding region sequence of the target gene from NCBI data, selecting 21 continuous bases as a target sequence, and adding a homologous arm sequence to the 3' end of the target sequence to obtain a reverse amplification primer of the target sequence; (3) obtaining a reverse complementary sequence of the target sequence, adding a homologous arm sequence to the 3' end of the reverse complementary sequence to obtain a forward amplification primer of the target sequence; (4) synthesizing the forward and reverse amplification primers of the circRNA gene sequence, wherein the nucleotide sequences of the forward and reverse amplification primers are shown as SEQ ID No. 4 and SEQ ID No. 5 respectively; (5) using the circRNA gene sequence as a template, the reverse amplification primer of the target sequence and the forward amplification primer of the target sequence as primers to amplify a fragment 1 and a fragment 2; (6) treating a pLCDH-ciR with restriction endonucleases EcoR1 and BamH1 to obtain a linearized vector; (7) connecting the fragment 1, the fragment 2 and the linearized vector by homologous recombination to obtain a recombinant plasmid; (8) 12-24 hours in advance, placing cells to be transfected into a 6-hole culture plate, and using a liposome transfection technology to transfer the recombinant plasmid into the cells, and continuing to culture for 48-72 hours; (9) collecting the transfected cells obtained in the step (8), lysing and collecting the protein supernatant; and (10) using a Western Blot to detect the expression of a target protein.

2. The method for targeting protein translation by circRNA according to claim 1, characterized in that, The method comprises the following steps: (a) obtaining a circRNA gene sequence containing an internal ribosome entry site by a gene cloning method, wherein the nucleotide sequence of the circRNA gene sequence is shown as SEQ ID No. 1; (b) obtaining a coding region sequence of a target gene from NCBI data, selecting 21 continuous bases as a target sequence, and adding a homologous arm sequence to the 3' end of the target sequence to obtain a reverse amplification primer of the target sequence, wherein a plurality of sequences can be connected in series; (c) obtaining a reverse complementary sequence of the target sequence, adding a homologous arm sequence to the 3' end of the reverse complementary sequence to obtain a forward amplification primer of the target sequence; (d) synthesizing forward and reverse amplification primers of SEQ ID No. 1, wherein the nucleotide sequences of the forward and reverse amplification primers are shown as SEQ ID No. 4 and SEQ ID No. 5 respectively; (e) using a PCR technology, taking SEQ ID No. 1 as a template, and taking the reverse amplification primer of the target sequence and the forward amplification primer of the target sequence as primers to amplify a fragment 1 and a fragment 2; (f) treating a pLCDH-ciR with restriction endonucleases EcoR1 and BamH1 to obtain a linearized vector; (g) connecting the fragment 1, the fragment 2 and the linearized vector by homologous recombination to obtain a recombinant plasmid; (h) 12-24 hours in advance, placing cells to be transfected into a 6-hole culture plate, and using a liposome transfection technology to transfer the recombinant plasmid into the cells, and continuing to culture for 48-72 hours; (i) collecting the transfected cells obtained in the step h, lysing and collecting the protein supernatant; and (j) using a Western Blot to detect the expression of a target protein.

3. The method for targeting protein translation using circRNA according to claim 2, wherein: The protein is a TAZ and / or ERK protein.

4. The method for targeting protein translation using circRNA according to claim 2, wherein, In the step h, the cells are a liver cancer cell line Huh7.

5. The method for targeting protein translation using circRNA according to claim 3, wherein, When the protein is a TAZ protein, the sequence of the reverse amplification primer of the target sequence in the step e is shown as SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12 or SEQ ID No. 13; and the sequence of the forward amplification primer of the target sequence is shown as SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16 or SEQ ID No.

17.

6. The method for targeting protein translation using circRNA according to claim 3, characterized in that When the protein is ERK protein, the reverse amplification primer sequence of the target sequence in step e is as shown in SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24 or SEQ ID No. 25; and the forward amplification primer sequence of the target sequence is as shown in SEQ ID No. 26, SEQ ID No. 27, SEQ ID No. 28 or SEQ ID No.

29.

7. The method for targeting protein translation using circRNA according to claim 3, wherein, When the protein is TAZ and ERK protein, the reverse amplification primer sequence of the target sequence in step e is as shown in SEQ ID No. 30; and the forward amplification primer sequence of the target sequence is as shown in SEQ ID No. 31.

Images