Candida tropicalis YDY-2 and application thereof in degradation of n-hexadecane

Abstract

The invention discloses candida tropicalis YDY-2 and application of the candida tropicalis YDY-2 in degradation of n-hexadecane. The candida tropicalis YDY-2 is named as candida tropicalis YDY-2 and is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC M 20251288; the candida tropicalis YDY-2 provided by the invention has the capability of degrading n-hexadecane under the condition that the pH (Potential of Hydrogen) is 7.0 to 9.0, and can grow at 29 to 31 DEG C. The candida tropicalis YDY-2 provided by the invention has relatively strong environmental adaptability and n-hexadecane degradation capability, and provides a basis for bioremediation of petroleum polluted environment and application of a microbial enhanced treatment technology.

Description

Technical Field

[0001] This invention relates to the field of microbiology, specifically to a highly efficient novel hexadecane-degrading bacterium—Candida tropicalis YDY-2—and its applications. Background Technology

[0002] With the rapid development of the global petroleum industry, a large amount of petroleum hydrocarbon pollutants continuously enter the soil and aquatic environment, posing a serious threat to ecosystems and human health. Petroleum is a complex multi-component system, mainly composed of double-chain hydrocarbons such as alkanes and cycloalkanes, aromatic compounds (benzene, toluene, ethylbenzene, xylene), polycyclic aromatic compounds (naphthalene, phenanthrene, anthracene, benzo(a)pyrene), resins, asphaltenes, and small amounts of oxygen-, sulfur-, and nitrogen-containing compounds. Due to the high hydrophobicity and chemical stability of petroleum hydrocarbons, they are difficult to remove effectively from the environment through non-biological pathways such as hydrolysis or photolysis, resulting in their long-term persistence in contaminated sites. Pollutants can cause various toxicological health problems to humans and animals, including hematologic toxicity, carcinogenicity, genotoxicity, mutagenicity, teratogenicity, cytotoxicity, neurotoxicity, immunotoxicity, nephrotoxicity, hepatotoxicity, cardiotoxicity, and ophthalmic toxicity, causing plant growth retardation, root necrosis, and decreased resistance to pests and diseases.

[0003] In petroleum hydrocarbon components, alkanes account for 50–95% of the total content. Among them, n-hexadecane (C 16 H 34 Alkylene is a major component of alkanes, and is characterized by its low water solubility (its solubility in water at 15°C is 5.21 × 10⁻⁶). -5 Petroleum pollutants (mg / L) are non-volatile and found in highly polluted oilfields, making them a representative target for petroleum pollution research. Compared with physicochemical methods, biological treatment methods have outstanding advantages such as superior performance, low cost, simple operation, and most importantly, environmental friendliness with no secondary pollution. They can degrade petroleum pollutants into non-toxic carbon dioxide and water through biological metabolism.

[0004] Numerous microorganisms possess the ability to degrade petroleum hydrocarbons. Among the reported fungi are those belonging to the genera *Aspergillus* sp., *Penicillium* sp., *Ctropicalis* sp., *Saccharomyces* sp., *Candida* sp., *Monilia* sp., *Pseudozyma* sp., and *Rhodotorrula* sp. However, research on fungal degradation of n-hexadecane is limited both domestically and internationally. Therefore, identifying fungi capable of degrading n-hexadecane has become one of the technical challenges in this field. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a strain of Candida tropicalis YDY-2 and its application in the degradation of n-hexadecane.

[0006] The technical solution adopted in this invention is as follows:

[0007] (a) A strain of tropical Candida YDY-2.

[0008] The *Candida tropicalis* YDY-2 is named *Candida tropicalis* YDY-2 and is deposited at the China Center for Type Culture Collection (CCTCC) on June 6, 2025, with accession number CCTCC M 20251288. The deposit address is: Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, China, 430072, China.

[0009] The nucleotide sequence of the 16S rDNA of the tropical Candida YDY-2 is shown in SEQ ID NO: 1.

[0010] The characteristics of the tropical Candida YDY-2 are: yellow, round, opaque colonies with relatively neat edges and a relatively smooth surface. Under a scanning electron microscope, the colony is observed to be elliptical in shape.

[0011] The described *Candida tropicalis* strain YDY-2 is an aerobic bacterium that can reproduce under pure culture conditions using n-hexadecane as the sole carbon source, producing intermediate products such as aldol acids, and ultimately generating CO2 and H2O. Within a pH range of 7.0–9.0, with an initial n-hexadecane content ranging from 0.1% to 2.0% (v / v), this bacterium demonstrates the ability to degrade n-hexadecane, exhibiting strong environmental adaptability.

[0012] (ii) A microbial preparation.

[0013] The active ingredient in the microbial preparation includes Candida tropicalis YDY-2.

[0014] (III) A method for preparing a microbial preparation.

[0015] The preparation method specifically involves culturing Candida tropicalis YDY-2 in PDB medium to obtain the microbial preparation.

[0016] The microbial preparations include, but are not limited to, bacterial solutions, bacterial agents, and biological fillers.

[0017] The PDB culture medium comprises deionized water and the following components at the following concentrations: potato extract powder 4.0 g / L and glucose 20.0 g / L.

[0018] (iv) The application of a tropical Candida YDY-2, the above-mentioned microbial preparation, or a microbial preparation obtained by the above-mentioned preparation method in the degradation of n-hexadecane.

[0019] Specifically, the degradation of n-hexadecane refers to microbial degradation.

[0020] Optionally, the n-hexadecane is present in wastewater and / or contaminated soil.

[0021] Preferably, the n-hexadecane is present in wastewater.

[0022] (v) A method for degrading n-hexadecane using Candida tropicalis YDY-2, a microbial preparation containing Candida tropicalis YDY-2, or a microbial preparation obtained by the above preparation method.

[0023] Preferably, hexadecane is degraded under conditions of pH 7.0–9.0 and temperature 29–31°C.

[0024] Most preferably, hexadecane is degraded under conditions of pH 8.0 and temperature 30°C.

[0025] Furthermore, the method further includes: inoculating the tropical Candida YDY-2 or the microbial preparation into wastewater containing n-hexadecane to be degraded, wherein the concentration of n-hexadecane is 0.1% to 2% (v / v).

[0026] Preferably, the concentration of n-hexadecane is 0.5% (v / v).

[0027] Preferably, OD is used during inoculation. 600 The bacterial suspension has a volume ratio of 0.8–1.5, and the inoculum size is 0.5%–10%.

[0028] The beneficial effects of this invention are as follows:

[0029] 1. The tropical Candida YDY-2 provided by this invention can reproduce under pure culture conditions using n-hexadecane as the sole carbon source, and produce intermediate products such as aldol acids, and finally generate CO2 and H2O.

[0030] 2. The tropical Candida YDY-2 provided by this invention was inoculated into BH medium with 0.5% (v / v) n-hexadecane as the sole carbon source. Under the conditions of pH 8.0 and 30℃, the degradation of n-hexadecane was carried out for 15 days, and the removal rate of n-hexadecane could reach 95.79%. Attached Figure Description

[0031] Figure 1 Streak plate diagram of Candida tropicalis YDY-2 provided by the present invention;

[0032] Figure 2A biological scanning electron microscope image of Candida tropicalis YDY-2 provided by the present invention;

[0033] Figure 3 Phylogenetic tree diagram of Candida tropicalis YDY-2 provided by the present invention;

[0034] Figure 4 The growth curve of Candida tropicalis YDY-2 in PDB medium provided by the present invention;

[0035] Figure 5 Comparison of the degradation performance of n-hexadecane by Candida tropicalis YDY-2 at different pH levels;

[0036] Figure 6 Comparison of degradation performance of Candida tropicalis YDY-2 under different initial n-hexadecane concentrations;

[0037] Figure 7 Comparison of the degradation performance of n-hexadecane by Candida tropicalis YDY-2 at different inoculum amounts. Detailed Implementation

[0038] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0039] This invention provides a strain of Candida tropicalis YDY-2. The strain, named Candida tropicalis YDY-2, is deposited at the China Center for Type Culture Collection (CCTCC) on June 6, 2025, with accession number CCTCC M 20251288. The address is: Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, China, 430072, China.

[0040] The nucleotide sequence of the 16S rDNA of Candida tropicalis YDY-2 is shown in SEQ ID NO: 1.

[0041] The characteristics of Candida tropicalis YDY-2 are: yellow, round, opaque colonies with relatively neat edges and a smooth surface. Under a scanning electron microscope, the colony appears to be oval.

[0042] The *Candida tropicalis* strain YDY-2 is an aerobic bacterium that can reproduce under pure culture conditions using n-hexadecane as the sole carbon source, producing intermediate products such as aldol acids, and ultimately generating CO2 and H2O. Within a pH range of 7.0–9.0 and an initial inoculum of 0.1%–1.0% (v / v) of n-hexadecane, this bacterium demonstrates the ability to degrade n-hexadecane, exhibiting strong environmental adaptability.

[0043] The present invention also provides a microbial preparation. The active ingredient of the microbial preparation comprises Candida tropicalis YDY-2.

[0044] This invention also provides a method for preparing a microbial preparation. The specific preparation method involves culturing *Candida tropicalis* YDY-2 in PDB medium to obtain the microbial preparation.

[0045] Furthermore, microbial preparations include, but are not limited to, bacterial solutions, bacterial agents, and biological fillers.

[0046] Preferably, the PDB culture medium comprises deionized water and components with the following concentrations: 4.0 g / L potato extract powder and 20.0 g / L glucose.

[0047] The present invention also provides the application of Candida tropicalis YDY-2, the above-mentioned microbial preparation, or the microbial preparation obtained by the above preparation method in the degradation of n-hexadecane.

[0048] Specifically, the degradation of n-hexadecane refers to microbial degradation.

[0049] Optionally, n-hexadecane is present in wastewater and / or contaminated soil.

[0050] Preferably, n-hexadecane is present in the wastewater.

[0051] The present invention also provides a method for degrading n-hexadecane using Candida tropicalis YDY-2, a microbial preparation containing Candida tropicalis YDY-2, or a microbial preparation obtained by the above preparation method.

[0052] Specifically, Candida tropicalis YDY-2 or a microbial preparation containing it is used to degrade n-hexadecane in wastewater and / or contaminated soil under conditions of pH 7.0–9.0 and temperature 29–31°C.

[0053] Most preferably, hexadecane is degraded under conditions of pH 8.0 and temperature 30°C.

[0054] Furthermore, the method also includes the following steps: inoculating Candida tropicalis YDY-2 or a microbial preparation into wastewater containing n-hexadecane to be degraded, wherein the concentration of n-hexadecane is 0.1% to 2% (v / v), preferably 0.5% (v / v).

[0055] Preferably, OD is used during inoculation. 600 The bacterial suspension has a volume ratio of 0.8–1.5, and the inoculum size is 0.5%–10%.

[0056] More preferably, the volumetric inoculum amount is 1.5% to 10%.

[0057] Most preferably, the volumetric inoculum amount is 5%.

[0058] Specific embodiments of the present invention are as follows:

[0059] The culture medium formulation used in this embodiment of the invention is as follows:

[0060] PDB medium (g / L): 4.0 g / L potato extract powder, 20.0 g / L glucose, autoclaved at 121℃ for 20 min.

[0061] Inorganic salt culture medium (g / L): Na2HPO4·12H2O 5.0, KH2PO4 1.0, NH4Cl 1.0, MgSO4·7H2O 0.2, CaCl2 0.05, trace elements 1mL, n-hexadecane 1% (v / v), autoclaved at 121℃ for 20min.

[0062] Trace elements (g / L): FeSO4·7H2O 0.05, H3BO3 0.014, MnSO4·4H2O 0.10, Na2MoO4·2H2O 0.02, CoCl2·6H2O 0.02, folic acid 0.00089, D-pantothenic acid (vitamin B5) 0.0035, vitamin B2 0.0023, niacin 0.0023, biotin (vitamin H) 0.0023.

[0063] Bushnell-Haas (BH) medium (g / L): MgSO4·7H2O 0.2, CaCl2 0.02, KH2PO4 1.0, K2HPO4 1.0, (NH4)2SO4 1.0, FeCl3 0.05, n-hexadecane 1% (v / v), autoclaved at 121℃ for 20 min.

[0064] Example 1

[0065] 1. Isolation and purification of Candida tropicalis YDY-2

[0066] Activated sludge was collected from the production wastewater of an oil refinery in Changzhou, Jiangsu Province, China. After settling for 24 hours, 5 mL of the supernatant was inoculated into 100 mL of inorganic salt medium with n-hexadecane as the sole carbon source. After culturing at 30°C and 160 rpm for 7 days with shaking, 5 mL of the suspension was inoculated into 100 mL of fresh inorganic salt medium and cultured at 30°C and 160 rpm for 7 days with shaking. This process was repeated 3–5 times. A certain amount of the bacterial suspension was then serially diluted to obtain bacterial suspensions of different concentrations. The obtained bacterial suspensions were purified by repeated streak plating on inorganic salt solid selective medium (e.g., ...). Figure 1 As shown in the figure, a single colony, namely the hexadecane-degrading strain, was obtained and denoted as strain YDY-2.

[0067] 2. Identification of strain YDY-2

[0068] Based on 16S rRNA sequence analysis and identification, strain YDY-2 was identified as *Candida tropicalis*. The specific steps are as follows:

[0069] DNA from strain YDY-2 was extracted and purified using the Gentra Puregene Handbook (Qiagen) kit (Zhejiang Tianke Biotechnology Co., Ltd.) and stored at 4℃. The purified DNA was then amplified by PCR using universal primers ITS1 and ITS4 for fungi. The primer sequences are as follows:

[0070] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO: 2;

[0071] ITS4: 5'-TCCTCCGCTTATTGATATGC-3', SEQ ID NO: 3.

[0072] The PCR reaction system (25 μL) consisted of: 1 μL template DNA, 1 μL each of primers ITS1 and ITS4, 12.5 μL Phanta MaxMaster Mix (including PCR buffer, Taq DNA polymerase, and dNTPs), and 9.5 μL sterile deionized water.

[0073] The PCR reaction program was set as follows: pre-denaturation at 95℃ for 1 min; followed by denaturation at 95℃ for 10 s, annealing at 50℃ for 30 s, extension at 72℃ for 30 s, for 30 cycles; then extension at 72℃ for 4 min; and finally hold at 4℃ for 10 min. The PCR products were sequenced (Zhejiang Tianke), and the sequencing results are shown in SEQ ID NO: 1.

[0074] The 16S rDNA sequence of strain YDY-2 was uploaded to GenBank for homology comparison, revealing that it belongs to the genus Candida, with the highest homology (99.78%) with Candida tropicalis. Figure 2 This is a bioelectron micrograph of the strain. Figure 3 This is a phylogenetic tree diagram of this strain.

[0075] To further confirm the reliability of the identification results, strain YDY-2 was ultimately determined to belong to Candida tropicalis after strain identification. Therefore, strain YDY-2 was named Candida tropicalis YDY-2 and deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC M20251288, deposit date: June 6, 2025, address: Wuhan University, Wuhan, China, postal code: 430072.

[0076] Example 2

[0077] The preparation method of Candida tropicalis YDY-2 bacterial suspension is as follows: the screened degrading strain is inoculated into a 250mL glass bottle containing 100mL LDB medium, and cultured with shaking at 30℃ and 160rpm until the logarithmic growth phase, and the OD of the bacterial suspension is obtained. 600 The value ranged from 0.8 to 1.5. The growth curve of *Candida tropicalis* YDY-2 in PDB medium is shown below. Figure 4 As shown.

[0078] The preparation method of Candida tropicalis YDY-2 seed culture is as follows: Centrifuge the bacterial culture cultured to the logarithmic growth phase at 8000 rpm for 10 min, remove the supernatant, and collect the bacterial cells. Wash the bacterial cells with an appropriate amount of phosphate buffer, centrifuge at 8000 rpm for 10 min, and remove the supernatant. Repeat the above operation 2-3 times. Finally, add an appropriate amount of phosphate buffer to resuspend the bacterial cells to OD0.05. 600 A bacterial suspension with a value of 1.0 was used as the seed culture.

[0079] Example 3

[0080] This embodiment tested the hexadecane degradation performance of Candida tropicalis YDY-2.

[0081] 1. Investigate the degradation performance of the strain under different pH conditions.

[0082] Experiments were conducted on the degradation of n-hexadecane by Candida tropicalis YDY-2 under different initial pH conditions. It was found that pH=8.0 was the optimal pH, at which the degradation rate was the highest. The specific implementation steps are as follows:

[0083] Seven different pH values ​​were selected: 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0. The pH of the BH medium was adjusted using 1 mol / L HCl and 1 mol / L NaOH. After high-temperature sterilization, 1% (v / v) of n-hexadecane was added to obtain BH mediums with different pH values ​​using n-hexadecane as the sole carbon source.

[0084] The seed culture was inoculated at a volume of 1% (v / v) into BH medium with different pH values ​​and hexadecane as the sole carbon source, with each experiment repeated three times. After culturing with shaking at 160 rpm for 15 days, samples were taken, and the concentration of residual hexadecane in the strain was determined by gas chromatography-mass spectrometry.

[0085] The degradation rate of n-hexadecane by strain YDY-2 after 15 days of culture under different pH conditions is as follows: Figure 5 As shown. By Figure 5 It was found that the optimal pH range for the growth of strain YDY-2 was 8.0–9.0. The highest degradation rate (39.79%) was observed at pH 8.0. When the pH exceeded 8.0, the degradation rate of n-hexadecane decreased, reaching 28.56% (pH 9) and 14.45% (pH 10). Therefore, subsequent experiments used a pH of 8.0 for the culture of the strain.

[0086] Furthermore, when the pH value was in the range of 4.0 to 10.0, the pH value of strain YDY-2 decreased after the culture was completed, indicating that acidic products were generated during the degradation of n-hexadecane by strain YDY-2.

[0087] 2. Investigate the degradation performance of the strain under different initial n-hexadecane concentrations.

[0088] Five different initial concentrations of n-hexadecane were selected: 0.1%, 0.5%, 1%, 2%, and 5% (v / v). The pH of the BH medium was adjusted to 8.0, and after autoclaving, n-hexadecane was added. This resulted in BH media with n-hexadecane as the sole carbon source, at initial concentrations of 0.1%, 0.5%, 1%, 2%, and 5% (v / v).

[0089] Seed culture was inoculated at a volume of 1% (v / v) into BH medium with n-hexadecane as the sole carbon source. Each experiment was repeated three times. After inoculation, the culture system was incubated at 30℃ and 160 rpm with shaking for 15 days, and the concentration of residual n-hexadecane was measured. The degradation rate of n-hexadecane by the strain under different initial n-hexadecane concentrations is shown in the figure below. Figure 6 As shown.

[0090] Depend on Figure 6It was found that after 15 days of cultivation, the degradation rate of n-hexadecane in strain YDY-2 gradually decreased with increasing initial concentration from 0.1% to 5% (v / v). Specifically, the degradation rate reached 80.63% at an initial concentration of 0.5%, but plummeted to 11.34% at an initial concentration of 5%. This indicates that an initial concentration of n-hexadecane exceeding the threshold significantly inhibited the metabolic activity of the strain, possibly due to the toxic side effects of high initial concentrations of n-hexadecane, which disrupted cellular physiological functions. Based on this, subsequent experiments selected 0.5% (v / v) n-hexadecane as the optimized concentration parameter.

[0091] 3. Investigate the degradation performance of the bacterial strains under different inoculum amounts.

[0092] The pH of BH medium was adjusted to 8.0, and after high-temperature sterilization, an appropriate amount of n-hexadecane was added to bring the initial concentration of n-hexadecane to 0.5% (v / v). Seed culture was added to BH medium with n-hexadecane as the sole carbon source at inoculum levels of 0.5%, 1%, 1.5%, 2%, 5%, and 10%, respectively. An uninoculated degrading bacteria control group was used. Each experiment was repeated three times. After inoculation, the culture system was incubated at 30℃ and 160 rpm with shaking for 15 days, and the remaining concentration of n-hexadecane was measured.

[0093] The degradation rate of n-hexadecane under different bacterial inoculum amounts is as follows: Figure 7 As shown. It can be seen from... Figure 7 It was observed that the degradation rate of n-hexadecane, measured after 15 days, initially increased with increasing inoculum size, reaching its highest level of 95.97% at an inoculum size of 5%. However, when the inoculum size reached 10%, the degradation rate decreased to 94.00%, possibly due to substrate competition between strains and the influence of oxygen content in the culture medium, leading to a slight decrease in the strains' growth and degradation capabilities. Overall, however, each inoculum size gradient resulted in a high degradation rate of n-hexadecane.

[0094] In summary, by adjusting the BH medium with hexadecane as the sole carbon source to 8.0, the initial concentration of hexadecane to 0.5% (v / v), and the culture temperature to 30℃, this strain achieved a removal rate of 95.79% after 15 days.

[0095] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any person skilled in the art can make changes or modifications to the above-described technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

[0096] The amino acid and nucleotide sequences involved in this invention are as follows:

[0097] SEQ ID NO.1;

[0098] Name: 16S rDNA sequence

[0099] Sequence type: DNA

[0100] Source: Candida tropicalis YDY-2 (genomic DNA)

[0101] CCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACAT TGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA

[0102] SEQ ID NO: 2

[0103] Name: Primer ITS1

[0104] Sequence type: DNA (other DNA)

[0105] Source: synthetic construct

[0106] TCCGTAGGTGAACCTGCGG

[0107] SEQ ID NO: 3

[0108] Name: Primer ITS4

[0109] Sequence type: DNA (other DNA)

[0110] Source: synthetic construct

[0111] TCCTCCGCTTATTGATATGC.

Claims

1. A strain of tropical Candida YDY-2, characterized by: The *Candida tropicalis* YDY-2 is named *Candida tropicalis* YDY-2 and is deposited at the China Center for Type Culture Collection (CCTCC) on June 6, 2025, with accession number CCTCC M 20251288.

2. The tropical Candida YDY-2 according to claim 1, characterized in that: The nucleotide sequence of the 16S rDNA of the tropical Candida YDY-2 is shown in SEQ ID NO:

1.

3. A microbial preparation, characterized in that: The active ingredient of the microbial preparation comprises Candida tropicalis YDY-2 as described in claim 1 or 2.

4. A method for preparing a microbial preparation as described in claim 3, characterized in that: The tropical Candida YDY-2 was cultured in PDB medium.

5. The preparation method according to claim 4, characterized in that: The PBD culture medium comprises deionized water and the following components at the following concentrations: potato extract powder 4.0 g / L and glucose 20.0 g / L.

6. The application of a *Candida tropicalis* YDY-2 as described in claim 1 or 2, a microbial preparation as described in claim 3, or a microbial preparation obtained by the preparation method as described in claim 4 or 5, characterized in that: Application in the degradation of n-hexadecane.

7. A method for degrading n-hexadecane using *Candida tropicalis* YDY-2 as described in claim 1 or 2, a microbial preparation as described in claim 3, or a microbial preparation obtained by the preparation method as described in claim 4 or 5, characterized in that: It degrades under conditions of pH 7.0–9.0 and temperature 29–31°C.

8. The method for degrading n-hexadecane according to claim 7, characterized in that: The tropical Candida YDY-2 or the microbial preparation is inoculated into wastewater containing n-hexadecane to be degraded, wherein the concentration of n-hexadecane is 0.1% to 2% (v / v).

9. The method for degrading n-hexadecane according to claim 7, characterized in that: OD during vaccination 600 The bacterial suspension has a volume ratio of 0.8–1.5, and the inoculum size is 0.5%–10%.

Images