Mutant strains and uses thereof
By knocking out the tsa2 gene in yeast strain NT64C to construct a mutant strain, and using its color changes to study protein folding states, this method solves the non-specificity problem in the construction of protein misfolding models in existing technologies, and achieves efficient and low-cost drug screening and model simulation.
Patent Information
- Application Number
- CN202511342832.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-19
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2045-09-19
AI Technical Summary
Existing methods for constructing protein misfolding models suffer from defects such as induction nonspecificity and cell-damaging effects, making it difficult to effectively simulate and study amyloid diseases.
By knocking out the tsa2 gene in a yeast strain, a mutant strain NT64C was constructed. The protein folding state was studied by observing the changes in red and white colony color under different environments. Antioxidants and metal ions were then used to screen for drugs.
It provides an efficient and low-cost model system that can simulate protein misfolding in yeast, simplifying the drug screening process, reducing cell damage, and improving research efficiency.
Smart Images
Figure CN120843311B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of bioengineering, in particular to a mutant strain and its application. BACKGROUND
[0002] Proteins must fold into the correct conformation to have the proper function, and misfolding will lead to diseases. In human nervous system, some proteins can misfold into a conformation with a high abundance of β-sheets, and form amyloid deposits, which further lead to amyloid diseases. These diseases include Alzheimer's disease (AD), Parkinson's disease and prion diseases (e.g. Creutzfeldt-Jakob disease in human and mad cow disease in bovine).
[0003] Some proteins in yeast can also misfold into β-sheets and form amyloid deposits. These proteins are prion proteins, such as Ure2 / [URE3], Sup35 / [PSI+] and Rnq1 / [RNQ / PIN+]. They can form amyloid fibrils in vitro and amyloid deposits in vivo, and make the strains have prion phenotypes. This provides us with an ideal eukaryotic model organism to study amyloid diseases. With the discovery of some prion proteins in yeast, yeast has been widely used to study protein misfolding and has accumulated a solid research foundation.
[0004] Ure2 is a regulator in the nitrogen metabolic pathway of yeast, which promotes the use of good nitrogen sources and inhibits the absorption of poor nitrogen sources. Sup35 is a subunit of translation termination factor, which forms a complex with Sup45, recognizes the stop codon and releases the peptide chain at the end of translation, and terminates protein translation. Biochemical and cell biological studies have found that the main reason for the formation and proliferation of [URE3] and [PSI+] is the misfolding of normal conformation Ure2 and Sup35, which aggregate to form amyloid proteins. Amyloid protein is a protein with a highly abundant β-sheet fibrous conformation. Amyloid protein also has the characteristics of yellow-green birefringence when stained with Congo red and strong protease resistance.
[0005] Eukaryotic microorganisms that exhibit single-cell morphology at some stage of their life cycle are called yeasts, which are a branch of fungi. These microorganisms are mainly divided into two categories: fermentative and oxidative yeasts. Fermentative yeasts, such as Saccharomyces cerevisiae, mainly produce ethanol (or other organic substances) and carbon dioxide through the fermentation of sugars. This type of yeast is widely used in the production of bread, steamed buns, and the brewing industry. In contrast, oxidative yeasts play a key role in the petroleum processing and wastewater treatment industries due to their strong oxidative effects, although their fermentation ability is weak or non-existent. Saccharomyces cerevisiae exhibits several significant advantages: first, the cultivation process is simple and the cost is low; second, it can grow in a variety of environments, which is beneficial for researchers and improves work efficiency; third, it is harmless to humans and the environment, and it has good adaptability to changes in temperature and humidity. These characteristics make it a valuable resource for scientific research and industrial applications.
[0006] According to the research of Wong CM et al., in Saccharomyces cerevisiae, the peroxidase tsa2 encoded by the tsa2 gene is a typical 2-Cys peroxidase with the ability to degrade hydrogen peroxide and organic peroxides, thus playing an important role in maintaining the redox balance of cells. Similar to tsa1, tsa2 also plays a key role in resisting oxidative stress and signal transduction, and can transform into a state with chaperone activity under high oxidative conditions, which is crucial for cell survival. In addition, although the baseline expression level of tsa2 is lower than that of tsa1, its expression response to oxidative stress is more intense, indicating its unique adaptability under specific environmental stress. These functional characteristics show the unique position and role of tsa2 in the cell defense system, especially its regulatory complexity and key role in oxidative stress response.
[0007] The main means of constructing the misfolding model currently has a fundamental defect: (1) chemical induction: reducing agents (such as DTT / TCEP) destroy disulfide bonds, indiscriminately reducing all disulfide-containing proteins (such as antibodies, proteases), leading to whole-cell redox imbalance, and misfolding in neurodegenerative diseases (such as PD, AD) does not depend on disulfide bond rupture. Denaturants (such as guanidine hydrochloride, urea) are used to destroy hydrogen bonds and hydrophobic forces to unfold proteins, which requires more than 4 M urea (there is no such high concentration environment in cells), and the aggregates induced are amorphous precipitates, not pathological amyloid fibers (such as alpha-syn fibers), and high-concentration urea destroys the cell membrane lipid bilayer, releasing intracellular enzymes (such as LDH) to interfere with toxicity assessment. Metal ions (such as Cu²⁺ / Al³⁺) are used to catalyze oxidative stress or directly bind to proteins to initiate misfolding, and Cu²⁺ also activates antioxidant pathways (such as SOD1), masking folding-specific phenotypes. (2) Physical induction: heat treatment (such as 42℃ incubation) is used to destroy protein stability by increasing temperature, triggering heat shock response (HSR), up-regulating HSP70 / 90 chaperones, and inhibiting misfolding in reverse, high temperature leading to RNA degradation, membrane fluidity changes, and confusion of folding-related toxicity. High-pressure treatment (such as 200 MPa) is used to destroy protein hydration layers and hydrogen bond networks by high pressure, which requires a special high-pressure chamber and is difficult to observe cell responses in real time. SUMMARY
[0008] Therefore, the present application provides a mutant strain and its application. The present application uses gene knockout technology to obtain a mutant strain that can promote protein misfolding, and uses this strain to efficiently obtain a protein misfolding model.
[0009] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0010] The present application provides a mutant strain, in which the tsa2 gene of the chassis strain is knocked out; the chassis strain is NT64C; the sequence of the tsa2 gene is shown in SEQ ID NO: 7.
[0011] In some embodiments of the present application, in the above-mentioned mutant strain, the sequence of SEQ ID NO: 7 is: ATGGTAGCAGAAGTTCAAAAACAAGCCCCACCATTTAAGAAAACCGCCGTAGTCGACGGTATCTTCGAGGAAATTTCACTGGAAAAGTATAAAGGTAAGTACGTTGTTCTAGCTTTTGTCCCATTGGCTTTTTCATTTGTCTGTCCAACTGAGATTGTTGCGTTTTCCGATGCCGCCAAGAAATTCGAAGATCAGGGCGCCCAAGTTTTATTTGCCTCCACCGACTCTGAATATTCCTTACTGGCATGGACCAACCTTCCCAGAAAAGACGGTGGATTAGGTCCAGTTAAAGTTCCTTTGCTTGCTGATAAGAATCATTCCTTATCCAGAGACTATGGCGTTTTGATTGAAAAAGAAGGTATAGCTTTAAGAGGTTTGTTCATAATCGACCCGAAGGGAATCATTAGACATATCACTATCAATGATTTATCTGTTGGCAGAAACGTCAATGAAGCTTTGAGATTAGTCGAAGGTTTCCAGTGGACTGACAAAAATGGTACAGTTTTGCCATGCAACTGGACCCCAGGAGCCGCCACCATCAAACCTGACGTTAAAGATTCCAAGGAGTATTTCAAAAATGCCAATAATTAA.
[0012] In some embodiments of the present application, in the above-mentioned mutant strain, the NT64C is derived from "Hsp40 Interacts Directly with the Native State of the Yeast Prion Protein Ure2 and Inhibits Formation of Amyloid-like Fibrils"
[0013] The present application also provides a method for constructing the above-mentioned mutant strain, which comprises knocking out the tsa2 gene of the chassis strain.
[0014] The present application also provides an application of the above-mentioned mutant strain in constructing a model for protein folding.
[0015] The present application also provides an application of the above-mentioned mutant strain in constructing a model for detecting protein misfolding.
[0016] The application also provides use of the mutant strain in preparation of a product for screening drugs, wherein the mutant strain is the mutant strain described above.
[0017] The drug is a drug for treating amyloidosis.
[0018] The application also provides use of the mutant strain described above in construction of a model for screening drugs for amyloidosis.
[0019] The application also provides use of the mutant strain described above in screening of a product for inhibiting and / or promoting protein misfolding.
[0020] In some embodiments of the application, in the use described above, when the product inhibits protein misfolding, the mutant strain appears red; and when the product promotes protein misfolding, the mutant strain appears white.
[0021] In some embodiments of the application, in the use described above, the product comprises one or more of an oxidizing agent, an antioxidant and a metal ion.
[0022] In some embodiments of the application, in the use described above, the metal ion comprises one or more of a manganese ion, a zinc ion, an iron ion and a copper ion.
[0023] In summary, the application has the following advantages in the aspects of in vitro research tools and drug screening platforms:
[0024] (1) Yeast is a eukaryote, and has highly conserved protein synthesis, folding, quality control (such as chaperones, ubiquitin-proteasome system, autophagy) and degradation pathways with higher eukaryotes (including humans). The basic molecular mechanisms leading to protein misfolding and aggregation (such as intermolecular beta-sheet formation) are evolutionarily conserved. Studying these processes in yeast can directly reveal the principles of similar events occurring in human cells.
[0025] (2) The yeast genome is the first eukaryotic genome to be sequenced, and is well annotated and informative. Overexpression, knockout, knock-in, point mutation and other operations of genes are very mature, fast, efficient and low-cost in yeast. High-throughput genetic screening can be performed using a large gene deletion library (such as a non-essential gene deletion library), overexpression library, conditional mutant library, etc. For example, genes that enhance or inhibit the toxicity of a misfolded protein can be screened to quickly discover key regulatory factors and potential drug targets of the pathogenic mechanism. CRISPR / Cas9 technology is also widely used in yeast.
[0026] (3) Single-cell eukaryotes, relatively simple structure, excluding the complexity of tissue specificity and intercellular communication in multicellular organisms, facilitating focusing on basic processes within the cell. Fast growth: short doubling time (about 90 minutes), can be cultured in large quantities in liquid or solid medium, greatly shortening the experimental period and improving research efficiency. Low culture cost: simple culture medium composition, low culture condition requirement. BRIEF DESCRIPTION OF DRAWINGS
[0027] In order to more clearly illustrate the technical solutions of the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below.
[0028] Figure 1 Figure 1 shows tsa2 transformant PCR detection agarose gel electrophoresis map; wherein: 1-3 are transformants, 4-6 are wild type, 1 primer is up-tsa2-F and leu2-R-intra, 2 primer is up-tsa2-F and down-tsa2-R, 3 primer is down-tsa2-R and intra-tsa2-F, 4 primer is up-tsa2-F and leu2-R-intra, 5 primer is up-tsa2-F and down-tsa2-R, 6 primer is down-tsa2-R and intra-tsa2-F;
[0029] Figure 2 Figure 2 shows tsa2 transformant sequence alignment;
[0030] Figure 3 Figure 3 shows tsa2 deletion mutant red bacteria short-term culture (96 h);
[0031] Figure 4 Figure 4 shows tsa2 deletion mutant white bacteria short-term culture (96 h);
[0032] Figure 5 Figure 5 shows tsa2 deletion mutant red bacteria long-term culture (384 h);
[0033] Figure 6 Figure 6 shows tsa2 deletion mutant white bacteria long-term culture (384 h);
[0034] Figure 7 Figure 7 shows the red bacteria colony map of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM astaxanthin (red bacteria 45, pink bacteria 0, white bacteria 18);
[0035] Figure 8 Figure 8 shows the red bacteria colony map of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM VC (red bacteria 33, pink bacteria 0, white bacteria 10);
[0036] Figure 9 Red colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM H2O2 (red 0, pink 141, white 8);
[0037] Figure 10 White colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM VC (white will turn red after growing);
[0038] Figure 11 White colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM H2O2 (white will not turn red after growing);
[0039] Figure 12 Red colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM MnCl2 (red 0, pink 139, white 49);
[0040] Figure 13 Red colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM ZnCl2 (red 0, pink 221, white 68);
[0041] Figure 14 Red colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM FeCl3 (red 205, pink 0, white 42);
[0042] Figure 15 Red colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM CuCl2 (red 186, pink 0, white 28);
[0043] Figure 16 White colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM MnCl2 (red 0, white 60);
[0044] Figure 17 White colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM ZnCl2 (red 0, white 59);
[0045] Figure 18 White colony plot of tsa2 S. cerevisiae NT64C mutant on YPD plate with 1 mM FeCl3 (red 0, white 83);
[0046] Figure 19Figure 1. White colony phenotype of tsa2 mutant strains on YPD plates with 1 mM CuCl2. Red colonies (0) and white colonies (71) of which 40 turned red after growth. DETAILED DESCRIPTION
[0047] The present application discloses a mutant strain and its application.
[0048] It should be understood that the expression "one or more of" includes individually each of the objects recited after the expression and various combinations of two or more of the recited objects, unless otherwise understood from the context and usage. The expression "and / or" in connection with three or more recited objects should be understood to have the same meaning, unless otherwise understood from the context.
[0049] The use of the expressions "including", "has", or "contains", including their grammatical conjugations, should generally be understood as open-ended and non-limiting, e.g., not excluding additional unrecited elements or steps, unless otherwise specifically stated or understood from the context.
[0050] It should be understood that the order of steps or order for performing certain actions is immaterial so long as the application remains operable. Moreover, two or more steps or actions can be conducted simultaneously.
[0051] The use of any and all examples, or exemplary language herein, e.g., "such as" or "including", is intended merely to better illustrate the application and does not indicate a limitation on the scope of the application unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the application.
[0052] Further, the numerical ranges and parameters setting forth the broadest scope of the application are approximations, and are only chosen to optimize the disclosure. Any numerical values, however, are deemed to be "approximations" merely because they are not exact. Consequently, unless indicated otherwise, it is intended that the application is operable over a wide range or range of values. Thus, all ranges disclosed herein are to be understood to be approximations based on the nature of the underlying parameters. It should be understood that all ranges are approximate, and "ranges" are used "approximately" when "ranging" from and / or to a value. It should be understood that all ranges given herein are approximate, and "ranges" are used "approximately" when "ranging" from and / or to a value. It should be understood that any numerical value, range or parameter given herein as comprising the application is intended to represent approximate values, and only indicates the approximate limits of the range or parameter. Unless otherwise stated, all ranges include endpoints.
[0053] The ADE2 gene of the yeast NT64C is placed downstream of the DAL5 promoter, and the active Ure2 can bind to the transcription factor Gln3 to inhibit the start of DAL5. Therefore, when Ure2 is in the normal conformation, the ADE2 gene cannot be expressed, resulting in the accumulation of red intermediates in the purine synthesis reaction chain, so that the colony appears red; when Ure2 is misfolded and aggregated, it cannot inhibit the start of DAL5, the ADE2 gene is expressed, and the colony appears white. The difference in the red and white colors of the colonies facilitates the differentiation of the protein folding state in the strain.
[0054] In the embodiments 1-6 of the present application, the raw materials and reagents used can be purchased from the market.
[0055] The present application will be further described below in conjunction with the embodiments:
[0056] Embodiment 1: Obtain the tsa2 gene deletion mutant of Saccharomyces cerevisiae
[0057] Gene knockout is an important molecular biology technology developed in the 1980s, and yeast gene knockout technology is an important means for studying yeast gene function and molecular breeding. By changing the sequence of the target gene, its original function is lost, so as to understand the role of the gene in the organism. The principle of gene knockout technology is used to construct an antioxidant gene deletion mutant of Saccharomyces cerevisiae.
[0058] In the present application, the lithium acetate transformation method is used to transform the Leu2 gene obtained by PCR amplification from the prs305 plasmid (purchased from ATCC) using tsa2-Leu2-F and tsa2-Leu2-R primers into Saccharomyces cerevisiae to replace the tsa2 gene in Saccharomyces cerevisiae. After the transformation is completed, the bacterial liquid is spread on a leucine-deficient medium plate, and the successful transformants detected by PCR are sent to GenScript Biotech (Shanghai) Co., Ltd. for sequencing. After sequencing, the gene sequence alignment is performed.
[0059] Table 1 Primers used for PCR
[0060]
[0061] Embodiment 2: Short-term and long-term culture of Saccharomyces cerevisiae tsa2 mutant
[0062] The Saccharomyces cerevisiae tsa2 mutant is diluted and spread on YPD solid medium to obtain red and white single colonies, and the single colonies are picked to YPD liquid medium and cultured to an OD 600When the concentration was 0.6, it was diluted and spread onto YPD solid medium. Short-term culture was performed at 30°C for 96 hours, and the number and ratio of red and white bacteria were counted. Long-term culture was performed at 30°C for 384 hours, and the ratio of red and white bacteria was counted every 96 hours. Both short-term and long-term cultures were performed in triplicate, with three replicates per experiment.
[0063] Table 2. Red colonies of tsa2 deletion mutant yeast (short-term culture)
[0064]
[0065] Table 3. White colonies of tsa2 deletion mutant yeast (short-term culture)
[0066]
[0067] Table 4. Red colonies of tsa2 deletion mutant yeast (long-term culture)
[0068]
[0069] Table 5. White colonies of tsa2 deletion mutant yeast (long-term culture)
[0070]
[0071] Example 3: Investigating the effects of antioxidants and oxidants on protein misfolding using tsa2-deleted mutant erythromycosis.
[0072] First, a stock solution of antioxidant astaxanthin, vitamin C, and oxidant H₂O₂ was prepared to a concentration of 1 mM and sterilized by filtration. Then, YPD solid culture medium was prepared and autoclaved. After sterilization, the astaxanthin, vitamin C, and H₂O₂ stock solutions were added to the YPD medium to a final concentration of 1 mM. Plates were then poured. OD₂ values were then measured. 600 The red yeast of the 0.6% tsa2 Saccharomyces cerevisiae NT64C mutant was diluted and plated onto the corresponding plates. After incubation at 30°C upside down for 96 hours, the color change of the colonies was observed.
[0073] Depend on Figures 7-9 As shown, Figure 7 The colony diagram of the red bacteria of the tsa2 Saccharomyces cerevisiae NT64C mutant on YPD plates, which contain astaxanthin, shows 45 red bacteria, 0 pink bacteria, and 18 white bacteria. Figure 8 The colony diagram of the red bacteria of the tsa2 Saccharomyces cerevisiae NT64C mutant on the YPD plate of VC is shown, with 33 red bacteria, 0 pink bacteria, and 10 white bacteria. Figure 9The image shows the colony composition of the NT64C mutant *Saccharomyces cerevisiae* tsa2 on a YPD plate treated with H2O2. There are 0 red colonies, 141 pink colonies, and 8 white colonies. After treatment with the antioxidants astaxanthin and vitamin C, only a small portion of the red colonies misfolded Ure2 protein, turning into white colonies. However, after treatment with the oxidant H2O2, all the red colonies turned into either pink or white colonies. This indicates that antioxidants inhibit the misfolding of the Ure2 protein, while oxidants promote it.
[0074] Example 4: Investigating the effects of antioxidants and oxidants on protein misfolding using tsa2 deletion mutant white bacteria.
[0075] First, a stock solution of antioxidant VC and oxidant H2O2 was prepared to a concentration of 1 mM and sterilized by filtration. Then, YPD solid culture medium was prepared and autoclaved. After sterilization, the VC and H2O2 stock solutions were added to the YPD medium to a final concentration of 1 mM. Plates were then poured. The OD values were then measured. 600 The white colony of the 0.6% tsa2 Saccharomyces cerevisiae NT64C mutant was diluted and plated onto the corresponding plates. After incubation at 30°C upside down for 96 hours, the color change of the colonies was observed.
[0076] Depend on Figures 10-11 As shown, Figure 10 A colony diagram of white fungi of the tsa2 Saccharomyces cerevisiae NT64C mutant on a YPD plate with VC; Figure 11 This is a colony diagram of the NT64C mutant *Saccharomyces cerevisiae* tsa2 on a YPD plate containing H2O2. As shown in the figure, the colonies treated with antioxidants turn red after growth, while those treated with oxidants do not. This indicates that the antioxidant vitamin C promotes correct protein folding in the colonies with misfolded Ure2 proteins.
[0077] Example 5: Investigating the effect of metal ions on protein misfolding using tsa2 deletion mutant erythromycosis.
[0078] First, a stock solution of MnCl2, ZnCl2, FeCl3, and CuCl2 was prepared to a concentration of 1 mM and sterilized by filtration. Then, YPD solid medium was prepared and autoclaved. After sterilization, the stock solutions of MnCl2, ZnCl2, FeCl3, and CuCl2 were added to the YPD medium to a final concentration of 1 mM. Plates were then poured. The OD values were then measured. 600 The red yeast of the 0.6% tsa2 Saccharomyces cerevisiae NT64C mutant was diluted and plated onto the corresponding plates. After incubation at 30°C upside down for 96 hours, the color change of the colonies was observed.
[0079] Depend on Figures 12-15 As shown,Figure 12 The colony diagram of the red yeast strain NT64C of Saccharomyces cerevisiae tsa2 on a YPD plate with MnCl2 is shown, with 0 red yeasts, 139 pink yeasts, and 49 white yeasts. Figure 13 The colony diagram of the red yeast strain NT64C of Saccharomyces cerevisiae tsa2 on a YPD plate containing ZnCl2 is shown, with 0 red yeasts, 221 pink yeasts, and 68 white yeasts. Figure 14 The colony diagram of the red yeast strain of Saccharomyces cerevisiae NT64C on a FeCl3 YPD plate shows 205 red yeast cells, 0 pink yeast cells, and 42 white yeast cells. Figure 15 The image shows the colony count of the NT64C mutant *Saccharomyces cerevisiae* tsa2 on a CuCl2 YPD plate, with 186 red colonies, 0 pink colonies, and 28 white colonies. The image indicates that treatment with manganese and zinc ions promotes misfolding of the Ure2 protein in the red colony, while iron and copper ions do not.
[0080] Example 6: Investigating the effect of metal ions on protein misfolding using tsa2 deletion mutant white bacteria
[0081] First, a stock solution of MnCl2, ZnCl2, FeCl3, and CuCl2 was prepared to a concentration of 1 mM and sterilized by filtration. Then, YPD solid medium was prepared and autoclaved. After sterilization, the stock solutions of MnCl2, ZnCl2, FeCl3, and CuCl2 were added to the YPD medium to a final concentration of 1 mM. Plates were then poured. The OD values were then measured. 600 The white colony of the 0.6% tsa2 Saccharomyces cerevisiae NT64C mutant was diluted and plated onto the corresponding plates. After incubation at 30°C upside down for 96 hours, the color change of the colonies was observed.
[0082] Depend on Figures 16-19 As shown, Figure 16 The colony diagram of white colonies of the tsa2 Saccharomyces cerevisiae NT64C mutant on a YPD plate with MnCl2 is shown, with 0 red colonies and 60 white colonies. Figure 17 The colony diagram of white colonies of the tsa2 Saccharomyces cerevisiae NT64C mutant on a ZnCl2 YPD plate shows 0 red colonies and 59 white colonies. Figure 18 The colony diagram of white bacteria of the tsa2 Saccharomyces cerevisiae NT64C mutant on a FeCl3 YPD plate, with 0 red bacteria and 83 white bacteria; Figure 19The figure of the white colonies of tsa2 mutant of Saccharomyces cerevisiae NT64C on YPD plate with CuCl2, in which 0 red colonies and 71 white colonies. From the figure, it can be seen that the colony color does not change after the white colonies are treated with manganese ions, zinc ions and iron ions, while 40 white colonies will turn red after the white colonies are treated with copper ions, which indicates that manganese ions, zinc ions and iron ions do not promote the correct folding of Ure2 protein after the incorrect folding, while copper ions promote the correct folding of Ure2 protein after the incorrect folding.
[0083] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.
Claims
1. Application of mutant strain in constructing a model for detecting protein misfolding, wherein the mutant strain knocks out the tsa2 gene of a chassis strain; the chassis strain is NT64C; the sequence of the tsa2 gene is shown in SEQ ID NO:7; the protein is yeast prion protein Ure2.
2. The use of the mutant strain described in claim 1 in screening products that inhibit and / or promote protein misfolding.
3. The application as described in claim 2, characterized in that, When the product inhibits protein misfolding, the mutant strain appears red; when the product promotes protein misfolding, the mutant strain appears white.