Gene for regulating fish growth, application and regulating method thereof

Abstract

This invention belongs to the field of aquaculture biological growth technology, specifically relating to a gene that regulates fish growth, its application, and a method for regulation. The gene regulating grass carp growth is a myogenesis inhibitor gene belonging to the myogenesis regulator (MRF) family. mdfi Its base sequence is shown in SEQ ID NO:1. A method for promoting the proliferation of fish muscle cells and inhibiting the proliferation of grass carp muscle cells. mdfi Gene expression levels or protein activity. This invention is the first to systematically elucidate... mdfi The inhibitory effect of genes on grass carp muscle growth, through the establishment of mdfi Gene knockout technology can effectively promote the growth of grass carp individuals, providing new technical means and gene targets for grass carp genetic breeding.

Description

Technical Field

[0001] This invention belongs to the field of aquaculture biological growth technology, specifically relating to a gene that regulates fish growth, its application, and a regulation method. Background Technology

[0002] grass carp( Ctenopharyngodon idella Fish protein is one of the core germplasm resources for freshwater aquaculture in my country, and its yield is directly related to the supply of aquatic protein and economic benefits. In order to meet the growing market demand for high-quality fish protein, genetic improvement of the key trait of muscle growth has become an urgent goal for the industry's development.

[0003] Muscle growth is a core physiological process shared by multiple species, and related research has been extensively conducted in various groups such as mammals, birds, and fish. Currently, a series of key factors directly involved in the regulation of muscle growth have been reported, including the insulin-like growth factor (IGF) family, myostatin (MSTN), and myogenic regulatory factors (MRFs) family. These factors collectively constitute a complex regulatory network for muscle growth through different pathways, such as promoting myocyte proliferation and differentiation, inhibiting excessive growth, or regulating myocyte fate. However, the upstream genes of MRFs... mdfi Research on (MyoD family inhibitors) is limited, and their function varies significantly across different species. Interference at the in vivo level in mice has been reported. mdfi It can promote muscle hypertrophy; and overexpression in porcine muscle cells mdfi This manifests as promoting skeletal muscle satellite cell proliferation and inhibiting differentiation, showing significant species differences in function compared to mouse experiments. Therefore, it is impossible to determine the effect of this on skeletal muscle satellite cells based on known mammalian observations. mdfi Gene research speculates mdfi The function of genes in fish.

[0004] Fish, as aquatic vertebrates, exhibit both common vertebrate characteristics and unique features due to their adaptation to the aquatic environment, leading to a later start in related research compared to mammals. Early studies focused primarily on the cloning and expression profiling of muscle growth-related genes. Recent research has gradually shifted towards functional validation of specific genes. For example, it is clear that the IGF family promotes myocyte proliferation and differentiation in grass carp, and the mechanism by which MSTN, as a negative regulator, inhibits muscle growth in grass carp has been validated. The MRF family, as core transcription factors directly regulating myocyte differentiation and myofiber formation, is known to include members such as myod, myf5, myog, and mrf4. However, some members of this family exhibit functional redundancy or differentiation. Based on current research, it is still impossible to definitively determine which members truly participate in muscle growth regulation. Furthermore, the regulatory network of muscle growth and development is complex and intricate, and current research has not yet systematically revealed its key inhibitory factors and overall pathways of action. Summary of the Invention

[0005] The application aims to provide a gene for regulating fish growth and application and a regulating method.

[0006] To achieve the above-mentioned purpose, the technical scheme adopted by the application is as follows:

[0007] A gene for regulating fish growth, the gene for regulating growth of grass carp is a gene in grass carp myogenesis regulatory factors (MRFs). mdfi The base sequence is shown in SEQ ID NO: 1.

[0008] SEQ ID NO: 1:

[0009] atgtccaaggaggaccacagccacagtgccaacccgcccgaacattcagatggagcccaacccgacagccggcccctggaaactctcaccgacccatgcccagtagggaatgaaaccggtgagcagacagcacagaattcaaacactccacccatggaaaagacaggagacgtggagaatggcaacaacaacaacagcctgtcccaaccagacctcactagcactcctggcaaaagcataatatatcaacctcaggcacggtctacacccatacaccccacgctagctagctcgaccgaatcggcagcgctgctgaggagagacagcaagccacacagcaacggggtcagaaacggaactttttcacgagccgtctcgtcgtcgtcctcatcttcatcctcagcccataaaaaccccaagaagctgcagtcgaacccatccatcaacagtcagagcagcaagaggagcaaaggtagctccaaatccaacagctcccagatccccacagaggctcaggatgattgctgtgtccactgcatcctagcctgtctgttctgtgagttcctcacactgtgcaacatcgtgctggactgcgccacttgtggctcctgcgcatcagacgactcgtgcttctgctgctgctgcgcttcagaggaatgtggcgactgcgacctgccctgtgacatggactgcggcatcatcgacgcatgctgcgagtctgcagactgtctggagatctgcatggaatgctgcggcctttgcttttcctcctga.

[0010] The application of the gene for regulating the growth of fish, the grass carp mdfi The application of the gene in regulating the muscle growth of grass carp.

[0011] The application of the gene for regulating the growth of fish, the grass carp mdfi The application of the inhibition expression of the gene in promoting the proliferation of muscle cells of grass carp.

[0012] The application of the gene for regulating the growth of fish, the grass carp mdfi The application of the gene or the protein coded by the gene as a target point for promoting the muscle growth.

[0013] A method for promoting proliferation of muscle cells in fish, inhibiting expression level of a gene or protein activity in muscle cells of grass carp. mdfi

[0014] Introducing a gene inhibitor or knocking out a gene into muscle cells of grass carp. mdfi mdfi

[0015] The inhibitor is one of siRNA, shRNA or sgRNA targeting the gene. mdfi

[0016] The siRNA has a sense strand (5'→3') of UCGUCGUCGUCCUCAUCUU (SEQ ID NO:2) and an antisense strand (5'→3') of AAGAUGAGGACGACGACGA (SEQ ID NO:3).

[0017] The sgRNA is mG*mC*mA*CGAUGUUGCACAGUGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU (SEQ ID NO:4).

[0018] The knockout is based on a CRISPR-Cas9 system to knockout the gene of grass carp.

[0019] The knockout is based on a CRISPR-Cas9 system to knockout the gene of grass carp. mdfi

[0020] The knockout grass carp of the gene is applied to breed a new strain of grass carp with faster growth speed. mdfi

[0021] The present application firstly determines the expression pattern and functional application of the gene of myod family inhibitor as a key upstream inhibitor of MRFs in grass carp; that is, the function of the gene of grass carp in negatively regulating muscle growth is firstly discovered. mdfi The experiment shows that overexpression of the gene of grass carp can significantly inhibit proliferation of muscle cells and synthesis of myod protein; on the contrary, knocking down the gene by using RNA interference technology can significantly promote proliferation of muscle cells and synthesis of myod protein. mdfi The application of knocking out the gene of grass carp by using CRISPR-Cas9 gene editing technology to promote growth of grass carp. mdfi mdfi BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The present application firstly determines the expression pattern and functional application of the gene of myod family inhibitor as a key upstream inhibitor of MRFs in grass carp; that is, the function of the gene of grass carp in negatively regulating muscle growth is firstly discovered. mdfi ​​​​​​​​Gene in vitro amplification gel map.

[0023] Figure 2 For grass carp mdfi Gene of mdfi -N1 vector structure schematic diagram.

[0024] Figure 3 For mdfi Expression profile in each tissue of three-month-old and one-year-old grass carp.

[0025] Figure 4 For overexpression mdfi Effect on grass carp muscle cell proliferation (EdU detection).

[0026] Figure 5 For overexpression mdfi Effect on myod protein expression (immunofluorescence).

[0027] Figure 6 For verification of siRNA interference mdfi Expression efficiency.

[0028] Figure 7 For interference mdfi Effect on grass carp muscle cell proliferation (EdU detection).

[0029] Figure 8 For interference mdfi Effect on myod protein expression (immunofluorescence).

[0030] Figure 9 For mdfi Knockout grass carp and control grass carp sequencing comparison peak map.

[0031] Figure 10 For two-month-old mdfi Comparison chart of knockout grass carp and control grass carp. DETAILED DESCRIPTION

[0032] The technical solutions of the present application are further described in detail in combination with the following specific examples. The specific experimental conditions not mentioned in the implementation scheme are carried out according to the conventional conditions or the conditions recommended in the manufacturer's instructions.

[0033] Example 1

[0034] In this example, the myod gene was cloned from the muscle tissue of grass carp. mdfiGene full-length CDS, connected to PEGFP-N1 vector. The dorsal muscle tissue of three-month-old healthy grass carp was used as the material, and the total RNA was extracted by TRIzol method. After removing genomic DNA contamination by DNase I digestion, cDNA template was obtained by reverse transcription using HiScript Ⅲ RT Supermix for qPCR (Novozyme). According to the grass carp mdfi Gene reference sequence (GenBank accession number: XM_051913475.1), design specific primers: mdfi -F: 5'- ctaGCTAGCatgtccaaggaggac-3' (containing Nhe I restriction site); mdfi -R: 5'- gcGTCGACtcaggaggaaaagca-3' (containing Sal I restriction site).

[0035] PCR reaction used high-fidelity enzyme 2 × Phanta Max Master Mix (Dye Plus), and the amplification program was as follows: 98℃ pre-denaturation for 3 min; 95℃ for 10 s, 60℃ for 30 s, 72℃ for 1 min, a total of 35 cycles; 72℃ extension for 10 min. The amplified products were verified by agarose gel electrophoresis, and then purified using a gel recovery kit. Figure 1

[0036] The purified PCR products and pEGFP-N1 vector were digested with Nhe I and Sal I respectively, and T4 DNA ligase was used for 16℃ connection overnight. The ligation product was transformed into DH5α competent cells, and positive clones were selected for colony PCR identification using vector universal primers. After sequencing verification of the positive recombinant plasmid, a large amount of extraction was performed using an endotoxin-free plasmid large extraction kit, and the recombinant expression vector mdfi -N1 was obtained. As shown in Figure 2 The finally constructed vector contains mdfi the complete CDS region (blue marked part, 774 bp).

[0037] Example 2

[0038] This example used three-month-old grass carp and one-year-old grass carp, each with three biological replicates (n = 3). After 5 days of temporary cultivation in a recirculating water system, multiple tissue samples were taken from each fish:

[0039] (1) The three-month-old group collected spleen, liver, intestine, muscle, gill, skin, eye, heart, brain tissue, respectively;

[0040] (2) The one-year-old group collected spleen, liver, intestine, muscle, gill, skin, eye, heart, fat tissue, respectively.

[0041] ​All the above tissue samples were immediately frozen in liquid nitrogen and transferred to -80℃ ultra-low temperature freezer for long-term storage.

[0042] Total RNA was extracted from tissues using TRIzol method (Novagen) and digested by DNase I to remove genomic DNA contamination. 1 μg of total RNA was used for reverse transcription, and the obtained cDNA was stored at -20℃ for later use.

[0043] The qPCR specific primers were designed as follows:

[0044] Reference gene β-actin:

[0045] β-actin-qR-F: 5'-GGCTGTGCTGTCCCTGTA-3' (SEQ ID NO: 5)

[0046] β-actin-qR-R: 5'-GGGCATAACCCTCGTAGAT-3' (SEQ ID NO: 6)

[0047] Target gene mdfi :

[0048] mdfi -qR-F: 5'-GACCCATGCCCAGTAGGGAA-3' (SEQ ID NO: 7)

[0049] mdfi -qR-R: 5'-GTGAGGTCTGGTTGGGACAG-3' (SEQ ID NO: 8).

[0050] One sample from each tissue was selected for qPCR primer verification. In the qPCR reaction using cDNA from nine tissues as templates, the melting curves of the two primers were both single peaks and the Tm values were both between 83℃ and 85℃. The qPCR reaction was performed using SYBR Green method, and each sample was set with three technical replicates. β-actin was used as the internal reference, gill tissue was used as the reference, and the relative expression was calculated using 2 -ΔΔCt The results are shown in Table 1. Figure 3 The expression level of the target gene in the muscle tissue of grass carp in each age group was in the middle range. mdfi Example 3

[0051] In this example, the EdU detection kit was used to detect the effect of overexpression on the proliferation ability of grass carp muscle cells. A commercialized grass carp muscle cell line (GCM) was used.

[0052] mdfi Ctenopharyngodon idella ​​Experiments were conducted using the Muscle Cell Line. Cells were cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FeBCO) and 1% triple antibodies (penicillin-streptomycin-amphotericidal), and cultured at 28°C with 5% CO2. When the cell density reached 70-80% confluence, overexpression was performed using the Lipo8000™ transfection reagent to transfect the cells obtained in Example 1. mdfi The -N1 overexpression vector and the empty pEGFP-N1 vector (N1) were transfected into the cultured cells described above, with three biological replicates. Six hours after transfection, the medium was replaced with complete medium for further culturing. Twenty-four hours after transfection, cell proliferation was analyzed using the Beyotime EdU assay kit. Cells were incubated with 50 μM EdU working solution for 4 hours, fixed with 4% paraformaldehyde, and then subjected to Click reaction (Alexa Fluor 488 labeling) and DAPI nuclear staining. Finally, five fields of view were randomly selected for cell counting using a fluorescence microscope. The experimental results are as follows: Figure 4 The results showed that, compared with the empty vector control group, mdfi The EdU positivity rate in the overexpression group was significantly reduced by approximately 50% (P<0.01), indicating that... mdfi Overexpression can significantly inhibit the proliferation of grass carp muscle cells.

[0053] Example 4

[0054] This embodiment uses immunofluorescence technology for detection. mdfi Effect of overexpression on myod protein expression in grass carp muscle cells. The experiment used grass carp muscle cell lines obtained by transfection with Lipofectamine 8000 as described in the above examples. mdfi The N1 overexpression plasmid and pEGFP-N1 vector (N1) were transfected into the cultured cells described above, and the experiment was performed in triplicate. After 24 hours, cells were fixed and permeabilized: fixed in 4% paraformaldehyde at room temperature for 15 minutes, permeabilized in 0.1% Triton X-100 for 10 minutes, and washed three times with PBS. Rabbit anti-myod polyclonal antibody (Tri-Engine, 1:200 dilution) was used as the primary antibody, and the cells were incubated overnight at 4°C; CoraLite® Plus 594-labeled goat anti-rabbit IgG (RGAR004, 1:200 dilution) was used as the secondary antibody, and the cells were incubated at room temperature in the dark for 1 hour. Cell nuclei were stained with DAPI (1 μg / mL) for 10 minutes. Images were acquired using a fluorescence microscope, such as... Figure 5 As shown, compared with the transfected empty vector group and the control group, overexpression mdfi The immunofluorescence signal intensity of myod decreased by approximately 54%, indicating that mdfi Overexpression inhibited the synthesis of myod protein.

[0055] Example 5

[0056] This embodiment uses small interfering RNA (siRNA) technology to knock down... mdfi Gene expression.

[0057] Targeted transfection using Zeta transfection reagent mdfi siRNA (si- mdfi The three siRNAs (si-nc) and negative control siRNAs were transfected into the cells to verify the knockdown efficiency. The sequences are shown in Table 1. The experimental method is the same as described in Example 3.

[0058] Table 1 siRNA sequences

[0059]

[0060] Verification of low efficiency can be achieved as follows Figure 6 The results showed that, compared to the group transfected with si-nc, only the group transfected with si-nc... mdfi -2 showed a significant knockdown effect. Subsequent knockdown experiments all involved transfection with si- mdfi -2.

[0061] Example 6

[0062] This embodiment uses small interfering RNA (siRNA) technology to knock down... mdfi Gene expression. Detection. mdfi The effect of knockdown on the proliferation capacity of grass carp muscle cells was investigated using the same experimental method as described in Example 3.

[0063] Experimental results are as follows Figure 7 The results showed that, compared with the control group, mdfi The EdU positivity rate in the interference group was significantly increased by approximately 36% (P<0.01), indicating inhibition. mdfi Gene expression can significantly promote the proliferation of grass carp muscle cells.

[0064] Example 7

[0065] This embodiment uses small interfering RNA (siRNA) technology to knock down... mdfi Gene expression was investigated to study its effect on myod protein in grass carp muscle cells. The target gene was expressed using Zeta transfection reagent. mdfi siRNA (si- mdfi The siRNA and negative control siRNA (si-nc) were transfected into the cells, and the experimental method was the same as described in Example 4.

[0066] like Figure 8 As shown, compared with the control group, the interference mdfi The immunofluorescence signal intensity of myod increased significantly by 103%, indicating inhibition. mdfi Expression can promote the synthesis of myod protein.

[0067] Example 8

[0068] Knockout of grass carp using CRISPR-Cas9 technology mdfi Genetic, specifically including: targeting grass carp mdfi Design specific sgRNAs from gene exons:

[0069] mG*mC*mA*CGAUGUUGCACAGUGUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGGCU*mU*mU*mU (SEQ ID NO: 17).

[0070] The obtained sgRNA was synthesized via in vitro transcription and mixed with Cas9 mRNA at a ratio of 1.2:1 (v / v). The mixture was then microinjected at a rate of 200 μL into grass carp fertilized eggs. After microinjection, 189 eggs emerged from the membrane, with 44 surviving, resulting in a survival rate of 23.2%. On the third day after fertilization, four samples were randomly collected. A special primer pair was designed:

[0071] mdfi -KO-F:5'-TGCAGTCGAACCCATCCATC-3' (SEQ ID NO:18)

[0072] mdfi -KO-R: 5'-CGACAACTAACCCTGCTCCT-3' (SEQ ID NO: 19).

[0073] like Figure 9 The F0 generation with missing fragments was obtained through PCR and sequencing verification, as shown.

[0074] like Figure 10 As shown, compared with the wild type, the 3-month-old mutant had a significantly increased body length of 39.2% (7.1 cm vs 5.1 cm) and a significantly increased weight of 97.1% (3.45 g vs 1.75 g). These results indicate that knockout... mdfi Genes can effectively promote the growth of grass carp's body length and weight, significantly improving its growth performance.

[0075] In conclusion, regarding grass carp... mdfi Gene suppression can promote muscle growth in grass carp, while simultaneously establishing... mdfi Gene knockout technology to knock out the gene in grass carp mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi mdfi Genes can effectively promote the growth of grass carp individuals. It is evident that this invention provides solid experimental evidence and a feasible technical path for cultivating new high-yield and fast-growing grass carp strains, and has important application value for fish genetic breeding.

Claims

1. A genetic inhibitor for regulating the growth of fish, characterized in that, mdfi The inhibitors are siRNAs targeting mdfi genes; ​ The siRNA has a sense strand 5'→3' of UCGUCGUCGUCCUCAUCUU and an antisense strand 5'→3' of AAGAUGAGGACGACGACGA.

2. A method of promoting proliferation of fish muscle cells, characterized in that, introducing into grass carp muscle cells mdfi gene inhibitors; The inhibitors are siRNAs targeting mdfi genes; The siRNA has a sense strand 5'→3' of UCGUCGUCGUCCUCAUCUU and an antisense strand 5'→3' of AAGAUGAGGACGACGACGA.

Images