MiRNA, miRNA simulant and application of miRNA simulant in prevention and control of spodoptera frugiperda

By promoting the expression of novel-miR-111 in fall armyworm, inhibiting its immune genes, and enhancing the proliferation of AcMNPV virus, the problem of limited insecticidal effect of baculoviruses was solved, and a highly effective control of fall armyworm was achieved.

CN120843513APending Publication Date: 2025-10-28SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510903796.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-01
Publication Date
2025-10-28

Smart Images

  • Figure CN120843513A_ABST
    Figure CN120843513A_ABST
Patent Text Reader

Abstract

The invention discloses miRNA (micro Ribonucleic Acid), a miRNA simulant and application of the miRNA simulant to prevention and control of spodoptera frugiperda. According to the invention, a miRNA, namely novel-miR-111, is found in spodoptera frugiperda, and a miRNA simulant capable of promoting the expression of the miRNA is used for feeding the spodoptera frugiperda, so that the expression of immune-related genes in the spodoptera frugiperda can be inhibited and the defense of the spodoptera frugiperda can be reduced by promoting the expression of the miRNA. In addition, by promoting the expression of the miRNA, the proliferation of the AcMNPV virus in the spodoptera frugiperda can be promoted, and the death rate of the spodoptera frugiperda infected by the AcMNPV virus is increased. Therefore, the invention provides the reagent for promoting the expression of the novel-miR-111 and the application of the AcMNPV virus in the aspect of preventing and treating the spodoptera frugiperda. The method is beneficial to prevention and control of the spodoptera frugiperda, and harm of the spodoptera frugiperda to agriculture
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pest control technology. More specifically, it relates to a miRNA, a miRNA mimic, and its application in controlling the fall armyworm. Background Technology

[0002] fall armyworm ( Spodoptera frugiperda Fall armyworm is one of the world's major agricultural pests, posing a serious threat to various crops such as rice, sugarcane, and corn. The larvae are the main stage of its damage, and the economic losses caused by larval activity are enormous, while the adults have a strong migratory ability.

[0003] Baculoviruses are a class of enveloped, double-stranded DNA viruses that specifically infect arthropods. They are harmless to non-target insects and humans, exhibiting good safety profiles and making them suitable for controlling agricultural and forestry pests. The alfalfa silver-striped moth nucleopolyhedrovirus (AcMNPV) is currently the most extensively studied and representative baculovirus species. AcMNPV employs a biphasic infection strategy, utilizing two distinct viral particles—budding viral particles (BV) and embedded viral particles (ODV)—to achieve intrahost transmission and environmental persistence. BV forms in the early stages of infection through plasma membrane budding, mediating intercellular diffusion; while ODV, in the later stages of infection, is encapsulated by the nuclear membrane and embedded in inclusion bodies formed by polyhedrosis proteins, resisting environmental degradation.

[0004] Baculoviruses such as AcMNPV have limited insecticidal effects, and single-agent virus treatments suffer from slow onset of action and low activity. Therefore, it is necessary to develop reagents and methods that can shorten their action time and improve their insecticidal efficacy. Summary of the Invention

[0005] This invention addresses the limitations of baculoviruses in their insecticidal effects, as well as the slow onset and low activity of single-agent viral agents. It provides a miRNA and its mimics, and also provides the application of the miRNA and its mimics in the control of fall armyworm.

[0006] The first objective of this invention is to provide a miRNA.

[0007] A second objective of this invention is to provide the miRNA mimicry.

[0008] A third object of the present invention is to provide an agent that promotes the expression of said miRNA for use in reducing the defense capabilities of fall armyworm or in the preparation of products for reducing the defense capabilities of fall armyworm.

[0009] A fourth object of the present invention is to provide an agent for promoting the expression of said miRNA for use in promoting the proliferation of Alfalfa Silver-striped Nocturia nucleopolyhedrovirus or in the preparation of products for promoting the proliferation of Alfalfa Silver-striped Nocturia nucleopolyhedrovirus.

[0010] A fifth object of the present invention is to provide a reagent for promoting the expression of said miRNA and the use of alfalfa silver-striped armyworm nucleopolyhedrovirus in the control of fall armyworm or in the preparation of products for the control of fall armyworm.

[0011] The sixth objective of this invention is to provide a formulation for controlling fall armyworm.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution: This invention discloses a miRNA, novel-miR-111, in the fall armyworm. Feeding fall armyworms with its mimic revealed that promoting the expression of novel-miR-111 inhibits the expression of immune-related genes in the fall armyworm, reducing its defense capabilities. Furthermore, promoting the expression of novel-miR-111 promotes the proliferation of AcMNPV virus in the fall armyworm, increasing the mortality rate of infected fall armyworms. Therefore, this invention seeks protection for the stated miRNA and its mimic, as well as its application in the control of fall armyworm.

[0013] Specifically, the nucleotide sequence of the miRNA (novel-miR-111) described in this invention is shown in SEQ ID NO.1.

[0014] For novel-miR-111, this invention provides a miRNA mimic that can promote its expression.

[0015] Specifically, the miRNA mimic includes a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown in SEQ ID NO.3, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.4.

[0016] This invention claims protection for the use of agents that promote the expression of said miRNA in reducing the defense capabilities of fall armyworm or in the preparation of products for reducing the defense capabilities of fall armyworm.

[0017] The present invention also claims protection for the use of reagents that promote the expression of said miRNA in promoting the proliferation of Alfalfa Silver-striped Nocturia nucleopolyhedrovirus or in the preparation of products for promoting the proliferation of Alfalfa Silver-striped Nocturia nucleopolyhedrovirus.

[0018] The present invention also claims protection for reagents that promote the expression of said miRNA and the use of alfalfa silver-striped armyworm nucleopolyhedrovirus in the control of fall armyworm or in the preparation of products for the control of fall armyworm.

[0019] Specifically, the reagent is one that can promote the expression of novel-miR-111 in fall armyworm.

[0020] Optionally, the reagent is a miRNA mimic of novel-miR-111.

[0021] Specifically, the miRNA mimic includes a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown in SEQ ID NO.3, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.4.

[0022] The present invention also provides a formulation for controlling fall armyworm, which contains a reagent that can promote the expression of said miRNA and alfalfa silver-striped armyworm nucleopolyhedrovirus.

[0023] Optionally, the formulation may also contain a attractant for the fall armyworm.

[0024] The present invention also provides a method for controlling fall armyworm, wherein the method involves inducing fall armyworm to feed on a preparation containing a reagent that can promote the expression of the miRNA and alfalfa silver-striped armyworm nucleopolyhedrovirus.

[0025] Optionally, the reagent is a miRNA mimic of novel-miR-111.

[0026] Specifically, the miRNA mimic includes a sense strand and an antisense strand, the nucleotide sequence of the sense strand is shown in SEQ ID NO.3, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.4.

[0027] In a specific embodiment of the present invention, the alfalfa silver-striped noctuid virus is an embedded viral particle (ODV) encapsulating a baculovirus inclusion body (OB), referred to as an AcMNPV polyhedron. Outside the host, the OB provides stability for the embedded ODV.

[0028] The present invention has the following beneficial effects: This invention discovered a miRNA, novel-miR-111, in the fall armyworm. Feeding fall armyworms with a miRNA mimic that promotes the expression of this miRNA revealed that promoting its expression inhibits the expression of immune-related genes in the fall armyworm, reducing its defense capabilities. Furthermore, promoting the expression of this miRNA promotes the proliferation of AcMNPV virus in the fall armyworm, increasing the mortality rate of fall armyworms infected with AcMNPV. Therefore, this invention provides a reagent for promoting the expression of novel-miR-111 and the application of AcMNPV virus in the control of fall armyworm. This invention is beneficial for the control of fall armyworm and reduces its harm to agriculture. Attached Figure Description

[0029] Figure 1 Survival curves of fall armyworm after feeding with AcMNPV polyhedrovirus suspensions of different concentrations.

[0030] Figure 2 Midgut tissue of fall armyworm larvae infected with AcMNPV at different time points. Cactus The relative expression levels of the gene and novel-miR-111; A in the figure represents the relative expression level of novel-miR-111; B represents... Cactus Relative gene expression levels; Control group (fed with 10% sucrose); AcMNPV group (fed with 10% sucrose diluted to a final concentration of 1×10⁻⁶). 7 OBs·mL -1 AcMNPV polyhedral suspensions; plotted values ​​are mean ± SEM (n=3), and data were analyzed using SPSS 22 with independent samples t-tests. Indicates significance level p ≤0.001; Indicates significance level p ≤0.05; ns indicates no significance.

[0031] Figure 3 For novel-miR-111 and Cactus The results of dual-fluorescence targeting validation of the gene; A in the figure represents the predicted fall armyworm novel-miR-111 in... Cactus The binding sequence of the gene's target site; B represents wild-type and mutant. Cactus PCR amplification results of the gene; C represents novel-miR-111 and Cactus The results of dual-fluorescence targeting validation of the gene; WT in the figure represents the experimental group with recombinant plasmids containing their respective miRNA target sites; Mutant represents the treatment group with recombinant plasmids that have mutated the target sites; the plotted values ​​are mean ± SEM (n = 3), and the data were analyzed using SPSS 22 with independent samples t-test. Indicates significance level p ≤0.01; ns indicates no significance.

[0032] Figure 4 After feeding the fall armyworm with novel-miR-111 mimic, Cactus Expression levels of antimicrobial peptide genes; plotted values ​​are mean ± SEM (n=3), and data were analyzed using SPSS 22 with independent samples t-test. Indicates significance level p ≤0.01; Indicates significance level p ≤0.05; ns indicates no significance.

[0033] Figure 5 After feeding the fall armyworm with the novel-miR-111 inhibitor, Cactus Expression levels of antimicrobial peptide genes; plotted values ​​are mean ± SEM (n=3), and data were analyzed using SPSS 22 with independent samples t-test. Indicates significance level p ≤0.0001; Indicates significance level p ≤0.01; Indicates significance level p ≤0.05; ns indicates no significance.

[0034] Figure 6 To observe the effect of novel-miR-111 on AcMNPV proliferation under a fluorescence microscope 6 h after transfection with novel-miR-111 and NC mimics and inhibitors 12 h later, respectively, the cells were infected with AcMNPV-EGFPBV. Figure A shows the effect of miRNA mimic and inhibitor treatment on AcMNPV proliferation observed under a fluorescence microscope; WT: wild-type cells, untreated with mimics; NC: negative control; Figure B shows the statistical results of the relative number of fluorescent cells (number of green fluorescent cells / total number of cells) in each group; the plotted values ​​are mean ± SEM (n=3), and the methods for analyzing significant differences were Least-Significant Difference (LSD) and Duncan multiple-range test; the same lowercase letters on the bar chart indicate that at the α = 0.05 level, the Duncan multiple-range test showed no significant difference.

[0035] Figure 7 To investigate the effect of novel-miR-111 on AcMNPV proliferation after 12 h of transfection with novel-miR-111 and NC mimic and inhibitor respectively, and 48 h of infection with AcMNPV-EGFPBV, the results were observed under a fluorescence microscope. Figure A shows the effect of miRNA mimic and inhibitor treatment on AcMNPV proliferation observed under a fluorescence microscope; Figure B shows the statistical results of the relative fluorescent cell counts in each group.

[0036] Figure 8To investigate the effect of novel-miR-111 on AcMNPV proliferation after 12 h of transfection with novel-miR-111 and NC mimic and inhibitor respectively, and 72 h of AcMNPV-EGFPBV infection, the results were observed under a fluorescence microscope. Figure A shows the effect of miRNA mimic and inhibitor treatment on AcMNPV proliferation observed under a fluorescence microscope; Figure B shows the statistical results of the relative fluorescent cell counts in each group.

[0037] Figure 9 After adding novel-miR-111 mimic and inhibitor for 12 hours, dilute with 10% sucrose to a final concentration of 1×10⁻⁶. 7 OBs·mL -1 Survival curves of fall armyworm fed AcMNPV polyhedron suspension; Figure A shows the survival curve of fall armyworms fed AcMNPV polyhedron suspension after being supplemented with novel-miR-111 miRNA mimic; Figure B shows the survival curve of fall armyworms fed AcMNPV polyhedron suspension after being supplemented with novel-miR-111 miRNA inhibitor; ns represents no significant level, * indicates significant level. p ≤0.05; ** indicates significance level p ≤0.01. Detailed Implementation

[0038] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0039] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0040] In its research on miRNAs of the fall armyworm, this invention focused on a miRNA named novel-miR-111, with the sequence UAGGCGUUCGGCGCUCUGAUUGGUGGGCU (SEQ IQ NO. 1). Its corresponding precursor sequence is UUGUUUGCGGUUAACGCGUAGCGCGUU CGGCGCUCUGAUUGGUGGGCUCCUUCGAACUGGCUAGUCAGAGCGCUACAUGCGCUCUCGUUUCGAUUACGUUUAACGUAAAGCAAA (SEQ IQ NO. 2). This invention investigated the target genes of novel-miR-111 and its targeted regulatory relationship with these genes. Furthermore, it explored its effects on AcMNPV virus proliferation.

[0041] The AcMNPV polyhedra and AcMNPV-EGFP BV used in the embodiments of this invention were provided and stored by the National Key Laboratory of Green Pesticides of South China Agricultural University.

[0042] Example 1: Determination of the bioactivity of AcMNPV against fall armyworm larvae 1. Rearing of Fall Armyworm Larvae Collect egg masses laid by female fall armyworms, disinfect them with 0.5% sodium hypochlorite solution for 3 minutes, rinse off the residual disinfectant with clean water, dry the surface of the egg masses with absorbent paper, and place them in an insect rearing box. After the insects hatch, feed them with feed until they reach the fourth instar. The rearing conditions are: temperature 25 ± 2℃, relative humidity 75~85%, and photoperiod L:D = (14:10)h.

[0043] 2. Propagation, extraction, and purification of AcMNPV polyhedra (1) Obtaining the crude extract of AcMNPV polyhedra Third-instar early larvae of the fall armyworm were selected and starved for 6 hours. AcMNPV polyhedromes were mixed evenly with feed and fed to the fall armyworm larvae. Dead fall armyworm larvae infected with AcMNPV polyhedromes were selected and ground into a homogenate with an appropriate amount of sterile ddH2O. The homogenate was filtered through three layers of gauze. The filtrate was centrifuged at 500 rpm for 10 min and the supernatant was collected. The supernatant was then centrifuged at 3000 rpm for 20 min and discarded. The precipitate was resuspended in sterile ddH2O. This step was repeated 3 times to obtain a crude extract of AcMNPV polyhedromes, which was stored at 4℃.

[0044] (2) Extraction and purification of AcMNPV polyhedra Purified viral polyhedromes can be obtained from the crude extract of AcMNPV polyhedromes by sucrose density gradient centrifugation. The specific steps are as follows: Prepare 30%, 50%, and 60% (w / w) sucrose solutions. Add the prepared sucrose solutions of different concentrations slowly from bottom to top in a centrifuge tube according to the density gradient, with higher concentration at the bottom and lower concentration at the top. Finally, add the crude extract of AcMNPV polyhedromes and centrifuge at 14,000 rpm for 40 min. After centrifugation, most of the viral polyhedromes are concentrated in the 50% sucrose density layer. Carefully aspirate the obtained density layer suspension, add an appropriate amount of sterile ddH2O, mix well, and centrifuge at 12,000 rpm for 10 min. Discard the supernatant. Resuspend the precipitate in sterile ddH2O and repeat this step 3 times to wash away residual sucrose. Examine the obtained solid under an optical microscope. The obtained pure polyhedromes are diluted with sterile ddH2O and counted using the hemocytometer method. Store at -20℃.

[0045] 3. Toxicity determination of AcMNPV against fall armyworm larvae Healthy first-day third instar larvae of the fall armyworm with consistent developmental stages were selected and subjected to a 6-hour starvation treatment in sterile 96-well plates. A 10% sucrose solution containing food blue pigment (the solution was dark blue) was prepared and used to dilute AcMNPV polyhedrosis, creating AcMNPV polyhedrosis virus suspensions at different concentrations (7 concentration gradients). After shaking and mixing the suspensions, each larva was individually fed 5 μL. A control group (MOCK) was also set up, fed only with an equal volume of the 10% sucrose solution containing food blue pigment. Approximately 10 minutes after feeding, individuals with blue intestines were selected and transferred to 12-well cell culture plates containing artificial feed for continued rearing (under the same conditions). Twelve larvae were treated with each concentration, with three replicates. Starting from the third day after treatment, the number of larval deaths was recorded daily, and the mortality rate was calculated until the larvae died or pupated. Larvae exhibiting typical symptoms of nucleopolyhedrovirus infection were considered virus-induced deaths. Data analysis and plotting were performed using Origin Pro software.

[0046] Survival curves of fall armyworm after feeding with AcMNPV polyhedrovirus suspension at different concentrations are shown below. Figure 1 As shown. Figure 1 It can be seen that as the concentration of AcMNPV increases, the survival rate of fall armyworm decreases.

[0047] 4. Bioactivity assay of AcMNPV against fall armyworm larvae Based on the toxicity assay results, SPSS software was used to calculate the toxicity regression equation, median lethal concentration (LC50), and its 95% confidence interval.

[0048] The bioactivity of AcMNPV against fall armyworm larvae is shown in Table 1. On day 9, the toxicity regression equation for AcMNPV was y = 36.386x - 165.29 (where x = lg (concentration), R² = 0.879). Also on day 9, the median lethal concentration (LC50) was 7.25 × 10⁻⁶. 5 OBs·mL -1 The concentration that is 90% lethal is 9.008 × 10⁻⁶. 6 OBs·mL -1 See also YUAN, Toufeeq, et al. (Toufeeq) et al ., 2019;Yuan et al Based on the relevant research findings of ., 2017, 9.0×10 was ultimately selected. 6 OBs·mL -1 This will be used as the standard experimental concentration for subsequent experiments.

[0049] Table 1. Bioactivity determination of AcMNPV against fall armyworm larvae

[0050] Example 2: Expression patterns of novel-miR-111 and its target genes at different time points after AcMNPV infection This invention involved feeding fall armyworm larvae with a 10% sucrose solution containing AcMNPV polyhedromes, collecting midgut tissues from larvae infected with AcMNPV at different time points, and extracting RNA. The expression patterns of novel-miR-111 and its target genes at different time points after AcMNPV infection were analyzed using RT-qPCR. The target genes of novel-miR-111 are... Cactus The gene (LOC118264955), using the fall armyworm U6 gene (LOC118276520) as an internal reference gene, was designed to detect novel-miR-111 and... Cactus The RT-qPCR primers for gene expression are shown in Table 2.

[0051] Table 2 novel-miR-111 and Cactus RT-qPCR primers for genes

[0052] The expression pattern analysis of novel-miR-111 and its target genes at different time points after AcMNPV infection is as follows: 1. AcMNPV polyhedrome infection of fall armyworm larvae Healthy first-day third instar larvae of the fall armyworm with consistent developmental stages were selected and subjected to a 6-hour starvation treatment in sterilized 48-well plates. A 10% sucrose solution containing food blue pigment was prepared, and the AcMNPV polyhedron suspension was diluted with this solution to a final concentration of 1×10⁻⁶. 7 OBs·mL -1 After being mixed using a vortex mixer, 5 μL of the solution was transferred to each larva in a 48-well plate and fed individually; the control group was fed an equal volume of a 10% sucrose solution stained with food blue. Individuals with blue midguts were selected using a stereomicroscope at 6 h, 48 h, and 72 h after the feeding treatment. Each treatment group contained 12 larvae, with 3 biological replicates.

[0053] 2. Collection of midgut tissue from fall armyworm larvae Individuals with blue midguts selected were dissected in a clean bench. All dissecting instruments were first soaked in 75% ethanol for 30 minutes and then sterilized with ultraviolet light for 30 minutes.

[0054] Under aseptic conditions, the larval body wall was longitudinally dissected, and the midgut tissue was completely dissected using micro-forceps. After collection, the tissue was quickly transferred to a pre-cooled 1.5 mL RNase-free centrifuge tube, 200 μL of VEZol Reagent lysis buffer was added, and the tube was flash-frozen in liquid nitrogen and then stored in an ultra-low temperature freezer at -80°C.

[0055] 3. RT-qPCR detection RNA was extracted from midgut tissues collected after AcMNPV infection at different time points, and RT-qPCR was performed using the primers shown in Table 2.

[0056] Midgut tissue of fall armyworm larvae infected with AcMNPV at different time points Cactus The relative expression levels of the gene and novel-miR-111 are as follows: Figure 2 As shown; Figure 2 In this context, A represents the relative expression level of novel-miR-111; Figure 2 B in the text is Cactus The relative expression level of genes. (By...) Figure 2 As shown in A, after AcMNPV infection of fall armyworm for 6 h and 48 h, the relative expression level of novel-miR-111 showed a highly significant downregulation trend, with the downregulation being particularly pronounced at 6 h; at 72 h, its expression level was not significantly different from the control group. Figure 2 From B, we can know that Cactus The relative expression levels of the gene in AcMNPV-infected fall armyworm increased significantly at 6 h and 48 h, with the most significant increase at 6 h; at 72 h, Cactus The gene expression level was not significantly different from the control group. In summary, novel-miR-111 and... Cactus Genes have a negative regulatory relationship.

[0057] Example 3 novel-miR-111 and Cactus Validation of dual-fluorescence targeting of genes 1. Analysis of the binding sites of novel-miR-111 and its target genes The target gene of novel-miR-111 described in this invention is Cactus The interaction sites between the miRNA and its target genes were predicted and analyzed using miRanda and RNAhybrid, with the following parameters: miRanda: total score ≥ 110, total energy ≤ -15 kcal / mol; RNAhybrid: p-value < 0.05, mfe ≤ -15 kcal / mol.

[0058] novel-miR-111 and Cactus Results of gene action site analysis as follows Figure 3 As shown in Figure A. As can be seen from the figure, novel-miR-111 and... Cactus The gene binding site is located at the 3' UTR of the mRNA.

[0059] 2. novel-miR-111 and Cactus Validation of dual-fluorescence targeting of genes To facilitate the study of the function of novel-miR-111, this invention designed a miRNA mimic that promotes the expression of novel-miR-111 and a miRNA inhibitor that inhibits its expression, the sequences of which are shown in Table 3. This invention also includes miRNA mimics and inhibitors as negative controls (NC), the sequences of which are also shown in Table 3. The sequences shown in Table 3 were synthesized by Gemma Genetics.

[0060] Table 3. Sequences of miRNA mimics and inhibitors of novel-miR-111

[0061] Note: According to the editing rules of WIPO Sequence software, nucleotide sequences must contain only the symbols listed in "WIPO ST.26 Annex I Part 1". The base "T" is "U" in RNA sequences. The sequences shown in the table are substantially the same as those in the sequence listing.

[0062] This invention constructs dual-fluorescent recombinant vectors containing the novel-miR-111 target site and those with the target site mutated, respectively, and combines them with the miRAN mimics and NC mimics of novel-miR-111 shown in Table 3 to achieve cellular-level control of novel-miR-111 and its target site. Cactus The targeted regulatory relationships of genes were examined.

[0063] (1) Construction of dual-fluorescent recombinant vector This invention addresses the novel-miR-111 in... Cactus Based on the gene's target binding sequence, PCR amplification primers for constructing the dual-fluorescent recombinant vector were designed, as shown in Table 4. The boxed portion of the upstream primer (-F) is... Xho I restriction site, the boxed portion in the downstream primer (-R) is Not I. Restriction site. The binding sequence of the target site was obtained by PCR amplification and a dual-fluorescent recombinant expression plasmid was constructed.

[0064] Table 4. PCR amplification primers required for constructing dual-fluorescent recombinant vectors

[0065] ① Double digestion of psi-CHECK-2 plasmid Use psi-CHECK-2 plasmid Not I and Xho I. Double enzyme digestion was performed, and the digestion results were detected by gel electrophoresis. The correctly detected bands were recovered from the gel using the FastPure Gel DNA Extraction Mini Kit. The obtained DNA fragments can be used directly for subsequent reactions or stored long-term at -20℃. The double enzyme digestion reaction system is shown in Table 5. The enzymes were digested at 37℃ for 1 h in a PCR instrument, followed by enzyme inactivation at 65℃ for 20 min.

[0066] Table 5. psi-CHECK-2 plasmid double enzyme digestion reaction system

[0067] ② PCR amplification and gel recovery of the target fragment Using cDNA obtained by reverse transcription of total RNA extracted from fall armyworm as a template, PCR amplification was performed using the primers shown in Table 4 to obtain wild-type and mutant strains. Cactus Gene (i.e., the target fragment). Among them, with... Cactus- 111-XhoI was used as the upstream primer. Cactus -111-R1 was used as the downstream primer to amplify the first part of the gene at the target site; Cactus -111-F1 was used as the upstream primer. Cactus -111-NotI was used as the downstream primer to amplify a partial fragment of the target gene; the gel-recovered products of the two fragments were mixed 1:1 and used as a template for amplification. Cactus -111-XhoI was used as the upstream primer. Cactus -111-NotI was used as the downstream primer to amplify the mutant. Cactus Gene.

[0068] The PCR amplification reaction system and procedure are shown in Tables 6 and 7, respectively.

[0069] Table 6 PCR amplification reaction system

[0070] Table 7 PCR Amplification Reaction Procedure

[0071] After PCR amplification, a 1% agarose gel was prepared, and the reaction products were analyzed by electrophoresis. Images were taken using a gel imaging system. Wild-type and mutant strains were also analyzed. Cactus The PCR amplification results of the gene are as follows Figure 3 As shown in B in the diagram. The target band was recovered and purified using a gel extraction kit, and the recovered gel product was used for subsequent experiments.

[0072] ③ Ligation and transformation of the target fragment and psi-CHECK-2 plasmid The recovered target fragment and psiCHECK-2 plasmid were respectively used... Xho I and Not I was subjected to double enzyme digestion. After the digestion products were recovered and purified, in vitro ligation reaction was performed using the TAKARA DNA Ligation Kit. The ligation system is shown in Table 8. Ligation was carried out overnight at 16°C. The target gene fragment was directionally cloned into the linearized vector by ligation of sticky ends.

[0073] Table 8 DNA Ligation Reaction System

[0074] E. coli ( E. coliDH5α competent cells were removed from the -80℃ ultra-low temperature freezer and thawed on ice. 100 μL of cell suspension was gently mixed with 10 μL of ligation product, incubated on ice for 30 min, then heat-shocked in a water bath at 42℃ for 45 s, and immediately cooled on ice for 3 min. In a clean bench, 800 μL of antibiotic-free LB medium preheated to 37℃ was added, and the cells were cultured at 37℃ on a shaker (200 r / min) for 1 h. 50 μL of bacterial suspension was evenly spread on LB agar plates containing Amp (100 μg / mL), and the suspension was spread evenly on the plate with a disposable sterile L-shaped spreader until there was no obvious flow of solution. The plates were sealed with sealing film and incubated upside down in a 37℃ incubator for 10–12 h until single colonies formed.

[0075] ④ Identification of dual-fluorescent recombinant expression plasmids In a clean bench, using sterile forceps, a white pipette tip was used to pick up a single colony from the surface of the culture dish and transfer it to a 1.5 mL sterile centrifuge tube containing 700 μL of LB liquid medium (containing 100 μg / mL Amp). The tube was then incubated at 37°C with shaking at 200 r / min for 8 hours. After the medium became turbid, bacterial PCR was performed to confirm successful ligation. Bacterial cultures showing bands were selected and mixed with LB liquid medium (containing 100 μg / mL Amp) at a ratio of 1:100 (v / v). The mixture was then transferred to a sterile 5 mL centrifuge tube and incubated at 37°C with 200 r / min for 5–6 hours. Once the bacterial culture in the medium became cloudy, it was sent to Qingke Company for sequencing identification. Through bacterial PCR and sequencing identification, the dual-fluorescent recombinant expression plasmids psi-CHECK2-Cactus and psi-CHECK2-Cactus-Mut were successfully constructed in this invention.

[0076] Select bacterial cultures with successfully ligated sequencing results. Mix them with LB liquid medium (containing 100 μg / mL Amp) at a ratio of 1:1000 (v / v), and incubate in sterile glass Erlenmeyer flasks at 37°C and 200 r / min for 10–14 h. Extract recombinant plasmids using the FastPure Plasmid Mini Kit, determine the plasmid concentration, and store at -20°C for later use. Prepare glycerol-containing bacteria by adding 50% glycerol to the correctly sequenced bacterial cultures at a 1:1 ratio and store at -80°C.

[0077] (2) Dual fluorescence targeting verification ①Cell transfection 24 hours before transfection, cells were seeded in 24-well plates. The complete culture medium was preheated to 37°C, and the seeding density was determined to be 2 × 10⁶ cells / well using a hemocytometer. 5Cells / well (total volume 500 μL), HEK 293T cells were evenly seeded into 24-well plates, and the transfection system was prepared according to Table 9.

[0078] Table 9 Preparation of Transfection Reagents

[0079] Plasmids, miRNA mimics, and transfection reagents were added to OPTI-MEM at the proportions shown in Table 9 and mixed. After vortexing, the mixture was incubated at room temperature for 5 min to form plasmid complexes, miRNA mimic complexes, and transfection reagent complexes, respectively. The plasmid complex was then vortexed with transfection reagent complex 3 (group 3), and the miRNA complex was vortexed with transfection reagent complex 4 (group 4). The mixtures were incubated at room temperature for 20 min. The final mixtures were added to 24-well plates, sealed along the edge of the plates with sealing film to prevent contamination, and gently mixed using the cross-hatching method. After incubation at 37°C and 5% CO2 for 6 h, the transfection medium was discarded, and the plates were gently washed twice with 100 μL of pre-warmed PBS. The medium was then replaced with 500 μL of fresh complete medium for further incubation.

[0080] ② Dual-luciferase activity assay To verify the performance of novel-miR-111 Cactus To address the gene targeting function, this invention constructed two different psi-CHECK2 recombinant vectors; one containing... Cactus The mRNA site sequence (WT) that binds to novel-miR-111, and another is the mutation target site. Cactus Gene sequence (mutant). The identified recombinant plasmids psi-CHECK2-Cactus (WT) and psi-CHECK2-Cactus-Mutation (mutant) were co-transfected into HEK293T cells with the miRNA miRNA mimic of novel-miR-111 and NC minic, respectively. The psiCHECK-2 vector was also transfected into HEK293T cells. One day before transfection, HEK293T cells were cultured at a density of 5 × 10⁶ cells / year. 5 Cells were seeded at a density of [insert density here] in 48-well plates and cultured overnight at 37°C in a 5% CO2 incubator using medium containing 10% fetal bovine serum. After 48 h of transfection, cells were washed with PBS, and residual liquid in each well was discarded as much as possible. The luciferase activity of each group was detected using a dual-luciferase reporter assay kit. The fluorescence values ​​of firefly luciferase (FLuc) and Renilla luciferase (RLuc) in each experimental group were measured using a Dual-Luciferase reporter assay system. The F / R ratio was taken as the relative activity value for detection. Cactus Gene expression status, experimental results as follows Figure 3As shown in Figure C, the recombinant plasmid containing the novel-miR-111 target gene site significantly downregulated luciferase activity, while the recombinant plasmid with the mutated target gene site showed no significant difference compared to the control group. These results indicate that novel-miR-111 can target… Cactus Genes and inhibit their transcriptional expression.

[0081] Example 4 novel-miR-111 Cactus and the effect of antimicrobial peptide gene expression To detect novel-miR-111 and its counterpart in fall armyworm Cactus Genes and antimicrobial peptide genes CecropinA , CecropinB , Gloverin and Defensin To investigate the regulatory relationship, this invention uses the fall armyworm U6 gene as an internal reference gene and designs corresponding RT-qPCR detection primers, as shown in Table 10.

[0082] Table 10 Cactus Primers for RT-qPCR detection of genes and antimicrobial peptide genes

[0083] Fall armyworm larvae of uniform size, first day of the third instar, were collected in 96-well plates and starved for 6 h. A 20 μmol / L concentration of novel-miR-111 mimic and NC mimic was diluted to 1 / 3 of its original concentration using DEPC water. 200 μL of the diluted solution was added to every 0.5 g of artificial feed and mixed thoroughly. After starvation, the larvae were transferred to 24-well plates, with one larva per well. The mimic-containing feed was dispensed into each well, and the feed was replaced with fresh novel-miR-111 and NC mimic every 8 h. Insects were sampled 6 h and 24 h after the start of feeding with the mimic-containing feed. Each treatment was repeated in triplicate, with 10 larvae per replicate. The collected insects were soaked and washed with 75% alcohol, then washed away with sterile PBS buffer to remove residual alcohol. The insects were fixed with insect needles, and then the abdomen was cut open with dissecting scissors. The midgut was then grasped with forceps and cut off with scissors. The midgut was placed in a 2 mL centrifuge tube containing 100 μL PBS and stored on ice for later use. Total RNA was extracted from the collected samples, reverse transcribed, and then detected by RT-qPCR.

[0084] After feeding the fall armyworm with novel-miR-111 mimic Cactus and the expression levels of antimicrobial peptide genes, such as Figure 4As shown. After the fall armyworm was fed the novel-miR-111 inhibitor, Cactus and the expression levels of antimicrobial peptide genes, such as Figure 5 As shown. Figure 4 and Figure 5 It can be seen that after adding the miRNA mimic of novel-miR-111, the target gene Cactus The strong suppression of gene expression indicates that the miRNA mimic of novel-miR-111 can downregulate the activity of target genes, leading to the disruption of the Toll signaling pathway. Conversely, the addition of the inhibitor of novel-miR-111 increased the activity of target genes, indicating that the suppression of novel-miR-111 expression leads to the increased expression of target genes, resulting in a strong activation of the Toll signaling pathway and a significant enhancement of the fall armyworm's immune defense capabilities.

[0085] Example 5: Effect of novel-miR-111 expression on AcMNPV proliferation Using FuGENE®HD Transfection Reagent, Sf9 cells were transfected with miRNA mimics and inhibitors of novel-miR-111 and NC, respectively. Twelve h after transfection, AcMNPV-EGFP BV with an MOI of 1.22 was added. A WT group (without transfection) was also included. Cells were incubated at 27°C. Cells were observed and photographed every 12 h using a fluorescence microscope, and the relative fluorescent cell count was recorded. The effect of novel-miR-111 expression on AcMNPV proliferation was observed. The results are as follows: Figures 6-8 As shown.

[0086] Depend on Figure 6 It was found that at 6 h after infection, the relative fluorescence count of cells transfected with the novel-miR-111 inhibitor (miR-111 inhibitor) was lower than that of the control group and the WT group, while there was no significant difference between the other treatment groups and the control group. Figure 7 It was found that at 48 h after infection, the relative fluorescence count of cells transfected with novel-miR-111 mimic (miR-111 mimic) was significantly higher than that of the control group. Figure 8It was found that at 72 h after infection, the relative fluorescence counts of cells transfected with both miR-111 mimic and miR-111 inhibitor were higher than those of the control group, with the relative fluorescence count of cells transfected with miR-111 mimic being significantly higher than that of the control and WT groups. These results indicate that treatment with the novel-miR-111 miRNA mimic accelerated the proliferation of AcMNPV and the infection rate of Sf9 cells to some extent.

[0087] Example 6: The synergistic effect of promoting novel-miR-111 expression on viral AcMNPV By detecting the expression levels of target genes in fall armyworm larvae fed with novel-miR-111 mimic and NC mimic, it was found that the expression levels of target genes in the treatment group began to decline after 6 h. Therefore, this invention infected the larvae with a virus 12 h after feeding with mimic and observed the effect of novel-miR-111 expression on the survival rate of fall armyworm larvae infected with AcMNPV.

[0088] First-day second-instar larvae of uniform size were selected from fall armyworm and placed in 96-well plates. The mimics of novel-miR-111 and NC were diluted to one-third of their original concentration using DEPC water (20 μmol / L). 200 μL of the diluted solution was added to every 0.5 g of artificial feed, and the mixture was stirred thoroughly and fed for 12 h. Larvae fed with miR-111 and NC mimics were then subjected to a 6-h fasting treatment in 96-well plates. A food coloring solution with a concentration of approximately 1 × 10⁻⁶ was prepared. 7 OBs·mL -1 Viral polyhedrome suspensions were prepared, with a 10% sucrose solution containing food coloring as a control. In 48-well plates after fasting, 20 μL of the prepared solution was pipetted into each well, and larvae with blue abdomens were transferred to new 48-well plates. Thirty fall armyworms were used in each experimental group, with each treatment repeated three times. Data were collected daily for 10 days, and cumulative mortality was recorded. Survival curves for fall armyworms were plotted using IBM SPSS Statistics 22 and GraphPad 8.0, and survival analysis was performed.

[0089] After 12 hours of supplementation with novel-miR-111 mimic and inhibitor respectively, the mixture was diluted with 10% sucrose to a final concentration of 1×10⁻⁶. 7 OBs·mL -1 Survival curves of fall armyworm fed AcMNPV polyhedron suspension as shown in the figure Figure 9 As shown; Figure 9In the figure, A represents the survival curve of fall armyworms fed with AcMNPV polyhedrome suspension after being fed with a miRNA mimic of novel-miR-111. Figure 9 B in the figure represents the survival curve of fall armyworms fed with AcMNPV polyhedrome suspension after being supplemented with miRNA inhibitors of novel-miR-111.

[0090] Depend on Figure 9 It is known that the miRNA mimic of novel-miR-111 can increase the mortality rate of fall armyworm infected with AcMNPV virus. Figure 9 In the A), and the inhibitor of novel-miR-111 can improve the survival rate of fall armyworm infected with AcMNPV virus ( Figure 9 (B in the text) indicates that the miRNA mimic of novel-miR-111 can enhance the insecticidal efficiency of the AcMNPV virus. These results suggest that the miRNA mimic of novel-miR-111 can be used in conjunction with the AcMNPV virus for the biological control of fall armyworm.

[0091] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A miRNA, characterized in that, The nucleotide sequence of the miRNA is shown in SEQ ID NO.

1.

2. The miRNA miRNA mimic of claim 1, characterized in that, It includes a sense strand and an antisense strand, the nucleotide sequence of which is shown in SEQ ID NO.3 and the nucleotide sequence of which is shown in SEQ ID NO.

4.

3. The use of the agent that promotes the expression of the miRNA of claim 1 in reducing the defense capabilities of the fall armyworm or in the preparation of products for reducing the defense capabilities of the fall armyworm.

4. The use of the reagent that promotes the expression of the miRNA of claim 1 in promoting the proliferation of Alfalfa Silver-striped Nocturia nucleopolyhedrovirus or in the preparation of products for promoting the proliferation of Alfalfa Silver-striped Nocturia nucleopolyhedrovirus.

5. The use of the reagent for promoting the expression of the miRNA of claim 1 and the alfalfa silver-striped armyworm nucleopolyhedrovirus in the control of fall armyworm or in the preparation of products for the control of fall armyworm.

6. The application according to any one of claims 3 to 5, characterized in that, The reagent is a miRNA mimetic of the miRNA described in claim 1.

7. The application according to claim 6, characterized in that, The miRNA mimic includes a sense strand and an antisense strand, the nucleotide sequence of which is shown in SEQ ID NO.3 and the nucleotide sequence of which is shown in SEQ ID NO.

4.

8. A formulation for controlling fall armyworm, characterized in that, It contains a reagent capable of promoting the expression of the miRNA of claim 1 and alfalfa silver-striped moth nucleopolyhedrovirus.

9. The formulation according to claim 8, characterized in that, It also contains attractants for the fall armyworm.

10. The formulation according to claim 8, characterized in that, The reagent is a miRNA mimetic of the miRNA described in claim 1.