SgRNA and RPA primer group for synchronously detecting four porcine-derived viruses, detection system and application
By combining RPA-CRISPR technology with a microfluidic chip system, the problems of high laboratory dependence and cross-interference in simultaneous detection of multiple viruses in porcine virus detection have been solved. This enables rapid and efficient detection of four porcine viruses, which is suitable for on-site pathogen screening and prevention and control decision support in multiple scenarios.
Patent Information
- Application Number
- CN202511374142.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-25
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-09-25
AI Technical Summary
Existing detection technologies for porcine viruses suffer from problems such as high laboratory dependence, severe cross-interference from simultaneous detection of multiple viruses, and insufficient sensitivity, making it difficult to meet the needs of rapid on-site screening, especially in resource-scarce areas where their application is limited.
By employing RPA-CRISPR technology combined with a microfluidic chip system, a specific sgRNA and RPA primer set was designed to enable the simultaneous detection of four porcine viruses, including porcine acute diarrhea syndrome coronavirus, porcine rotavirus, porcine transmissible gastroenteritis virus, and porcine epidemic diarrhea virus, through a centrifugal microfluidic chip.
It enables rapid testing that completes "sample in - result out" within 28 minutes, improving on-site screening efficiency. It has high specificity and sensitivity and is suitable for supermarkets, farms, grassroots testing stations, and port quarantine sites, providing a basis for pathogen screening and guiding targeted prevention and control decisions.
Smart Images

Figure CN120843745A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection, specifically relating to a primer set for simultaneous detection of four porcine viruses, namely sgRNA and RPA primers, a detection system, and its applications. Background Technology
[0002] The primary bottleneck currently facing the field of porcine virus detection lies in the high laboratory dependence of traditional molecular detection technologies. Standard detection procedures centered on polymerase chain reaction (PCR) require sophisticated thermal cycling equipment to complete multiple temperature-step reactions, with a single test taking 2-3 hours, and operators needing specialized molecular biology skills. This technical characteristic makes it difficult to adapt to the rapid screening needs of on-site scenarios such as farms and slaughterhouses. Especially during outbreaks, delays in sample transport and laboratory queues significantly exacerbate the risk of pathogen spread. More seriously, the high requirements of existing technologies for equipment and environment directly lead to high detection costs, severely restricting their widespread application in resource-scarce areas.
[0003] The core issue further limiting detection efficiency lies in the technical deficiencies of simultaneous multi-virus detection. When attempting joint screening of multiple viruses, multiple primer designs are prone to primer dimer formation and an imbalance in amplification efficiency. This interference not only reduces the detection rate of low-abundance targets but may also produce false positive results due to non-specific signal enhancement. Although existing commercially available kits claim to achieve quadruple detection, their clinical validation data show significant signal inhibition between different targets, indicating that multi-target detection systems have not yet solved the fundamental challenge of cross-interference.
[0004] While CRISPR detection technology has emerged as a new solution for rapid on-site testing due to its high specificity and isothermal reaction advantages, it faces a dual obstacle to engineering implementation. On the one hand, core components of the CRISPR system, such as Cas12b protein and sgRNA, are extremely sensitive to temperature and require storage at -20°C throughout the process. This not only increases storage and transportation costs but also limits its application in areas without a stable power supply. On the other hand, the mainstream two-step process requires the manual transfer of RPA amplification products to the CRISPR reaction system. Opening the cap not only introduces the risk of aerosol contamination but also complicates the process, contradicting the "sample in - result out" principle of rapid on-site testing.
[0005] Ultimately, the key factor limiting the effectiveness of on-site testing is the trade-off between sensitivity and portability. Existing portable devices, due to limitations in reaction system miniaturization and signal acquisition accuracy, generally have a detection limit of only 1. 3The copy / test level is insufficient to meet the needs of detecting viral load in early infection or convalescent carrier states. Conventional rapid test strips have a high false negative rate for such samples. This sensitivity deficiency directly delays the golden window for epidemic intervention, causing irreversible economic losses. These pain points constitute the core obstacle to the development of rapid on-site detection technology for swine viruses, urgently requiring breakthroughs through technological innovation. Summary of the Invention
[0006] To overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide a set of sgRNA and RPA primers for the simultaneous detection of four porcine viruses.
[0007] Another object of the present invention is to provide a microfluidic chip system for simultaneous detection of four porcine viruses.
[0008] Another object of the present invention is to provide the application of the above-described sgRNA and RPA primer sets and systems.
[0009] The objective of this invention is achieved through the following technical solution: A set of sgRNA and RPA primers for simultaneous detection of four porcine viruses includes sgRNA and RPA primers for detecting Swine acute diarrhea syndrome coronavirus (SADS-CoV), Group A porcine rotavirus (RVA), Transmissible gastroenteritis virus of swine (TGEV), and Porcine epidemic diarrhea virus (PEDV). The nucleotide sequences of the sgRNA and RPA primer sets for detecting porcine acute diarrhea syndrome coronavirus are shown in SEQ ID NO: 7, 26, and 29, respectively; the nucleotide sequences of the sgRNA and RPA primer sets for detecting porcine rotavirus are shown in SEQ ID NO: 9, 31, and 35, respectively; the nucleotide sequences of the sgRNA and RPA primer sets for detecting porcine transmissible gastroenteritis virus are shown in SEQ ID NO: 13, 38, and 41, respectively; and the nucleotide sequences of the sgRNA and RPA primer sets for detecting porcine epidemic diarrhea virus are shown in SEQ ID NO: 16, 44, and 48, respectively.
[0010] A kit for simultaneous detection of four porcine viruses, comprising the aforementioned sgRNA and RPA primer set.
[0011] The kit preferably further comprises at least one of the following components: magnesium acetate, amplification buffer containing lyophilized enzyme preparation, Cas12b, CRISPR detection buffer (e.g., 10×Reaction buffer, Yisheng Bio, 14808ES65), CRISPRssDNA Reporter, and water.
[0012] The application of the sgRNA and RPA primer set or kit in the detection of porcine viruses.
[0013] The applications described do not include the purpose of treating or diagnosing diseases.
[0014] A method for detecting four porcine viruses using the above-mentioned sgRNA and RPA primer set or kit includes the following steps: Prepare the RPA amplification system and the CRISPR detection system, and perform the RPA amplification reaction and the CRISPR detection reaction in sequence.
[0015] Each 50 μL RPA amplification system contains the following components: 1 μL of the nucleic acid sample to be tested, 2.5 μL of 10 mM magnesium acetate, 2 μL each of 10 μmol / L RPA primer F and RPA primer R, 25 μL of amplification buffer containing lyophilized enzyme preparation, and water to make up to 50 μL.
[0016] Each 50 μL CRISPR assay contains the following components: Cas12b 2 µL, 100 ng / μL sgRNA 1 µL, 10×Reaction buffer 5 μL, CRISPR ssDNA Reporter 0.5 μL, and water to make up to 50 μL.
[0017] The RPA amplification reaction procedure is: 43℃ for 30 min, and the CRISPR detection reaction procedure is: 43℃ for 30 min.
[0018] A centrifugal microfluidic chip for simultaneous detection of four porcine viruses comprises a sample-RPA reagent dissolution chamber, four quantitative dispensing chambers, four primer encapsulation / reaction chambers 1, and four detection probe encapsulation / reaction chambers 2. The quantitative dispensing chambers are located radially outside the sample-RPA reagent dissolution chamber, and each quantitative dispensing chamber is connected to the sample-RPA reagent dissolution chamber via a connecting channel. The primer encapsulation / reaction chambers 1 are located radially outside the quantitative dispensing chambers, and each primer encapsulation / reaction chamber 1 is connected to the quantitative dispensing chamber via a siphon valve. The detection probe encapsulation / reaction chambers 2 are located radially outside the primer encapsulation / reaction chambers 1, and each detection probe encapsulation / reaction chamber 2 is connected to the primer encapsulation / reaction chamber 1 via a siphon valve. The four primer encapsulation / reaction chambers 1 and the detection probe encapsulation / reaction chambers 2 contain the RPA primers and sgRNA from the aforementioned sgRNA and RPA primer sets, respectively.
[0019] The method for preparing the centrifugal microfluidic chip for simultaneous detection of four porcine viruses includes the following steps: (1) Prepare the RPA amplification system and the CRISPR detection system. Each 5 μL of RPA amplification system in each reaction contains the following components: 1 μL of 10 mM magnesium acetate, 2 μL each of 10 μmol / L RPA primer F and RPA primer R; each 10 μL of CRISPR detection system in each reaction contains the following components: 0.4 μL of Cas12b, 0.75 μL of sgRNA, 1 μL of 10×Reactionbuffer, 0.3 μL of CRISPR ssDNA Reporter, and water to a final volume of 10 μL. (2) Place the RPA amplification system and the CRISPR detection system in primer encapsulation / reaction chamber 1 and encapsulation and reaction chamber 2 respectively, and then dry the chip; after drying, take out the centrifugal microfluidic chip and cover it with a transparent sealing film to obtain a centrifugal microfluidic chip for simultaneous detection of four porcine viruses.
[0020] The preferred drying conditions are 40-50℃ for 1.5-3 hours.
[0021] A centrifugal microfluidic chip system for simultaneous detection of four porcine viruses, comprising the aforementioned chip.
[0022] The system preferably also includes centrifuge equipment, warm bath reaction equipment, and an intelligent photographic fluorescence detection system for collecting, analyzing, and outputting fluorescence signals, so as to achieve accurate reception and interpretation of the final detected fluorescence signal.
[0023] The application of the centrifugal microfluidic chip or centrifugal microfluidic chip system in the detection of porcine viruses.
[0024] The applications described do not include the purpose of treating or diagnosing diseases.
[0025] A method for simultaneous detection of four porcine viruses includes the following steps: Prepare the sample loading solution, which consists of 25 μL of amplification buffer containing lyophilized enzyme preparation, 1 μL of nucleic acid sample to be tested, and 24 μL of water. After mixing the sample loading solution, transfer it to the sample-RPA reagent dissolution chamber of the centrifugal microfluidic chip, seal it tightly with a film, and then perform the test.
[0026] The detection method preferably includes the following steps: (1) After adding the sample solution to the sample-RPA reagent dissolution chamber of the centrifugal microfluidic chip, centrifuge at 1500-2000 rpm for 15-30 s to transfer the sample from the sample-RPA reagent dissolution chamber to the quantitative dispensing chamber; (2) Let stand for 30-60 s to allow the sample to be transferred to primer encapsulation / reaction chamber 1 through the siphon valve; (3) Centrifuge at 1500-2000 rpm for 15-30 s, and transfer the sample from the siphon valve to primer encapsulation / reaction chamber 1; (4) RPA amplification: The sample was reacted at 43℃ for 10-15 min; (5) Centrifuge at 1500-2000 rpm for 15-30 s, and transfer the sample to the detection probe encapsulation / reaction chamber 2 through the siphon valve; (6) CRISPR detection: The reaction was carried out at 43℃ for 8-10 min, and fluorescence signals were collected at the beginning (0 min) and the end (8-10 min) of the reaction.
[0027] The methods described are not intended for the treatment or diagnosis of diseases.
[0028] The present invention has the following advantages and effects compared with the prior art: (1) This invention provides a primer set and kit for the simultaneous detection of multiple porcine viruses based on RPA-CRISPR technology, after multiple optimizations of RPA primer combinations and sgRNA screening.
[0029] (2) This invention provides a centrifugal microfluidic chip and centrifugal microfluidic chip system for simultaneous detection of four porcine viruses. The chip adopts an integrated design and is divided into at least four compartments. The bottom and top membranes (including the sealing membrane) of the chip are made of transparent materials (e.g., transparent plastic). The two can provide simple and intuitive feedback on the closed state through changes in optical properties. The operation is simple and the results are highly reliable. In addition, the chip also incorporates a flow channel siphon valve design, which can achieve precise transfer of liquid under different centrifugation processes while ensuring that the centrifugation module speed remains constant.
[0030] (3) The centrifugal microfluidic chip and centrifugal microfluidic chip system provided in this patent for the simultaneous detection of four porcine viruses are based on RPA-CRISPR and combined with microfluidic technology. It can achieve simultaneous, rapid, efficient, and accurate detection of four porcine viruses—Sinoadenovirus Acute Diarrhea Syndrome Coronavirus (SADS-CoV), porcine rotavirus (RVA), porcine transmissible gastroenteritis virus (TGEV), and porcine epidemic diarrhea virus (PEDV)—with only a single sample addition. The chip achieves directional transfer between compartments through a siphon valve, taking approximately 27.5 minutes in total. The core steps include three centrifugations, one settling period, and a two-stage isothermal reaction. Figure 2 This means that the "sample in - result out" process can be completed within 28 minutes. It is quick, requires no professional laboratory equipment, and significantly improves the efficiency of on-site screening. It solves the core problems in on-site detection of swine viruses, such as poor synchronization of multiple targets, high equipment dependence and cumbersome operation, long time consumption of PCR technology, strong cold chain dependence of CRISPR detection (such as Cas12b protein needs to be stored at -20℃), and cross-contamination risk of microfluidic platforms (such as traditional centrifugation equipment requires multi-stage speed change). Compared with conventional RPA-CRISPR technology, it has higher specificity and sensitivity.
[0031] (4) This invention successfully overcomes the bottleneck of multi-virus joint detection technology—relying on the isothermal multi-target joint detection mechanism, it can simultaneously and specifically identify multiple porcine viruses and accurately distinguish infection types in a single detection process, with the detection results possessing both laboratory-level sensitivity and accuracy. Its instrument-free and easy-to-operate characteristics allow this technology to be seamlessly integrated into supermarkets, farm checkpoints, grassroots testing stations, and port quarantine sites, achieving a revolutionary breakthrough in the timeliness of epidemic response. The detection results not only provide a basis for pathogen screening but also directly guide targeted detoxification strategies and prevention and control decisions, forming a closed loop of "detection-diagnosis-intervention".
[0032] (5) This invention provides the first tool integrating “on-site rapid detection + intelligent typing + decision support” for dynamic monitoring of pig diseases, border biosecurity defense and grassroots prevention and control system. It solves the core pain points of existing technologies in terms of multiple detection capabilities and timeliness, and has significant economic and social value in promoting the upgrading of pig disease prevention and control to an efficient and precise model. Attached Figure Description
[0033] Figure 1 This is a design diagram of the centrifugal microfluidic chip of the present invention.
[0034] Figure 2 This is a flowchart of the centrifugal microfluidic chip for sample detection according to the present invention.
[0035] Figure 3 This is a graph showing the screening results of SADS-CoV target sgRNA; where A: fluorescence change rate, B: fluorescence curve.
[0036] Figure 4 This is a graph showing the screening results of RVA target sgRNA; where A: fluorescence change rate, B: fluorescence curve.
[0037] Figure 5 This is a graph showing the screening results of TGEV target sgRNA; where A: fluorescence change rate, B: fluorescence curve.
[0038] Figure 6 This is a graph showing the screening results of PEDV target sgRNA; where A: fluorescence change rate, B: fluorescence curve.
[0039] Figure 7 This is a graph showing the screening results of RPA primers for the SADS-CoV target; where A: fluorescence change rate; B / C: fluorescence curves at high / low concentrations.
[0040] Figure 8 This is a graph showing the screening results of RVA target RPA primers; where A: fluorescence change rate; B / C: fluorescence curves at high / low concentrations.
[0041] Figure 9 This is a graph showing the results of primer screening for TGEV target RPA; where A: fluorescence change rate; B / C: fluorescence curves at high / low concentrations.
[0042] Figure 10 This is a graph showing the results of PEDV target RPA primer screening; where A: fluorescence change rate; B / C: fluorescence curves at high / low concentrations.
[0043] Figure 11 This is a graph showing the SADS-CoV sensitivity verification results; where A: fluorescence change rate; B: RPA-CRISPR fluorescence curves at different concentrations.
[0044] Figure 12 This is a graph showing the RVA sensitivity verification results; where A: fluorescence change rate; B: RPA-CRISPR fluorescence curves at different concentrations.
[0045] Figure 13This is a graph showing the results of TGEV sensitivity verification; where A: fluorescence change rate; B: RPA-CRISPR fluorescence curves at different concentrations.
[0046] Figure 14 This is a graph showing the results of PEDV sensitivity verification; where A: fluorescence change rate; B: RPA-CRISPR fluorescence curves at different concentrations.
[0047] Figure 15 This is a graph showing the test results for simultaneously detecting non-target viruses.
[0048] Figure 16 This is a diagram showing the effect of chip detection of a single target nucleic acid.
[0049] Figure 17 This is a graph showing the specificity test results of the chip simultaneously detecting four targets.
[0050] Figure 18 This is a graph showing the sensitivity verification results of a microfluidic chip that simultaneously detects four targets. Detailed Implementation
[0051] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0052] Example 1: Design, screening, and validation of sgRNA and RPA primers 1. Design, screening, and validation of sgRNAs (1) In this invention, the CHOPCHOP website was used to design three sgRNAs (Table 1) targeting selected regions (SEQ ID NO.1-4) of the SADS-CoV, RVA, TGEV and PEDV genes respectively, and then synthesized and validated them.
[0053] SADS-CoV (SEQ ID NO.1): RVA(SEQ ID NO.2): aaagatgctagggacaaaattgttgaaggtacattgtattcaaatgtgagtgatttcattcagcaatttaatcaaatgatagttaccatgaatgggaatgattttcagacaggagggattggaaatttgcctattagaaactggacttttgactttggactacttggcactactttccttaatctggatgctaattacgttgagaatgctagaactactattgaatatttcattgatttcattgacaatgtatgcatggatgaaatggccagagaatcacaacggaatggaatagctccacaatctgaata TGEV(SEQ ID NO.3): tcacttggaatcacagacaacggttaaacgtagtcgttaatggatacccatactccatcacagttacaacaacccgcaattttaattctgctgaaggtgctattatatgcatttgtaagggctc accacctactaccaccacagaatctagtttgacttgcaattggggtagtgagtgcaggttaaaccataagttccctatatgtccttctaattcagaggcaaattgtggtaatatgctgtatggc ctacaaatggtttgcagatgaggttgttgcttatttacatggtgctagttaccgtattagttttgaaaatcaatggtctggcactgtcacatttggtgatatgcgtgcgacaacattagaagtcg ctggcacgcttgtagacctttggtggtttaaatcctgtttatgatgtcagttattatagggttaataataaaaatggtactaccgtagtttccaattgcactgatcaatgtgctagttatgtggct PEDV(SEQ ID NO.4): ctagacttcaaccttacgaagtttttgaaaaggtccacgtgcagtgatgtttcttggactttttcaatacacgattgacacagttgtcaaagatgtctcaaagtctgctaacttgtctttggatgctgtccaagagttggagctcaatgtagttccaattagacaagcttcaaatgtgacgggttttcttttcaccagtgtttttatctacttctttgcactgtttaaagcgtcttctttgaggcgcaattatattatgttggcagcgcgttttgctgtcattgttctttattgcccacttttatattattgtggtgcatttttagatgcaactattatttgttgcacacttattggcaggctttgtttagtctgcttttactcctggcgctataaaaatgcgctctttattatttttaatactacgacactttctttcctcaatggtaaagcagcttattatgacggcaaatccattgtgattttagaaggtggtgaccattacatcacttttggcaactcttttgttgcttttgttagtagcatcgacttgtatctagctatacgtgggcggcaagaagctgacctacagctgttgcgaactgttgagcttcttgatggcaagaagctttatgtcttttcgcaacatcaaattgttggcattactaatgctgcatttgactcaattcaactagacgagtatgctacaattagtgaatgataatggtctagtagttaatgttatactttggcttttcgtactctttttcctg Table 1 Related sgRNA Information
[0054] Note: The underlined sequence part is the spacer region of the sgRNA.
[0055] (2) Based on the location of the sgRNA, PCR primers were designed within 100 bp upstream and downstream of the sgRNA (Table 2). Primers were designed using the NCBI website, and the primer length was controlled between 20-25 bp. All sgRNAs were validated using the same template.
[0056] Table 2 Template amplification specific primers
[0057] (3) The nucleotide sequences of SADS-CoV (SEQ ID NO.1), RVA (SEQ ID NO.2), TGEV (SEQ ID NO.3) and PEDV (SEQ ID NO.4) were artificially synthesized, and KpnI and SphI restriction sites were introduced at the 5' and 3' ends, respectively. The sequences and primers were synthesized by Shanghai Sangon Biotech.
[0058] (4) The nucleotide sequence with restriction sites synthesized in step (3) is ligated to the pUC57 plasmid through KpnI and SphI restriction sites, respectively. Sequencing is performed to identify the correctly identified recombinant plasmids pUC57-PEDV, pUC57-TGEV, pUC57-RVA, and pUC57-SADS-CoV, which are used as positive standard plasmids.
[0059] (5) PCR amplification was performed using pUC57-PEDV, pUC57-TGEV, pUC57-RVA, pUC57-SADS-CoV positive standard plasmids and the corresponding primers in Table 2 to obtain high-concentration PCR products. The specific amplification system (50 μL) was as follows: 44 μL of 1.1×PCR MIX (Gold Medal Green, Qingke Biotechnology Co., Ltd., catalog number: TSE102), 2 μL each of 10 μM upstream and downstream primers, and 2 μL of plasmid template. The final concentrations of each component were as follows: PCR MIX 1×, final concentration of upstream and downstream primers was 0.4 μM, and plasmid template was 1~100 pg. The PCR reaction program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 50℃ annealing for 15 s, 72℃ extension for 10 s, for a total of 30 cycles; 72℃ final extension for 5 min; and incubation at 10℃.
[0060] (6) Prepare the CRISPR detection system (50 μL): Cas12b (Yisheng Biotechnology, 14808ES65) 2 µL, sgRNA (100 ng / μL) 1 µL, 10×Reaction buffer (Yisheng Biotechnology, 14808ES65) 5 μL, CRISPR ssDNA Reporter (Haihexi Biotechnology DNA-FAM-12b; 12b-FAM) 0.5 μL, DEPC water 41.5 μL. Take 1 μL of the PCR amplification product obtained in step (5) (approximately 10~100 ng) and mix it with the above CRISPR system. Incubate the qPCR instrument at 43℃ for 15 min, collecting the FAM fluorescence signal every minute. Based on the changes in the fluorescence signal curve, perform preliminary verification of the sgRNA performance or specificity. The endpoint where the fluorescence value curve of the target amplification product and the negative control stops rising should be significantly different. The formula for calculating the fluorescence growth rate is: Fluorescence growth rate = (nth measurement value - baseline value of the first measurement of the negative control) / baseline value of the first measurement of the negative control × 100%.
[0061] The fluorescence intensity of the CRISPR reaction was measured for each sgRNA and its corresponding template amplification product. The fluorescence curves and fluorescence growth rate trends are shown in [the table below]. Figures 3-6 Analysis of fluorescence growth rate results showed that SADS-CoV target SADS-CoV-sgRNA-3, RVA target RVA-sgRNA-2, TGEV target TGEV-sgRNA-3 and PEDV target PEDV-sgRNA-3 showed good results and can be used for subsequent RPA primer screening.
[0062] 2. Design, screening, and validation of RPA primers (1) Within the target sequence range of pUC57-PEDV, pUC57-TGEV, pUC57-RVA, and pUC57-SADS-CoV positive standard plasmids, fragments of 30-35 bases in length were selected as candidate RPA primers. To ensure stability and specificity, the GC content of the RPA primers was between 40-60%, and the RPA amplification fragment was between 100-200 bp. Based on this primer design principle, three upstream and three downstream primers were designed for RPA primer validation, and NCBI primer-BLAST was used to validate amplification coverage and specificity. Based on the above design principles, RPA primers as shown in Table 3 were designed for each plasmid / template for subsequent synthesis and validation experiments.
[0063] Table 3 RPA Primer Table
[0064] (2) Positive standard plasmid samples of pUC57-PEDV, pUC57-TGEV, pUC57-RVA, and pUC57-SADS-CoV were diluted to 10,000 copies / reaction and 1,000 copies / reaction to screen different combinations of RPA primers. A two-step RPA-CRISPR reaction was used. The RPA amplification system (50 μL) consisted of: 1 μL of positive standard plasmid sample, 2.5 μL of 10 mM magnesium acetate, 2 μL each of 10 μmol / L RPA primer F and RPA primer R, 17.5 μL of DEPC water, and 25 μL of amplification buffer (containing lyophilized enzyme preparation, RT-basic nucleic acid amplification reagent (RAA method), product number: S003ZC, Hangzhou Zhongce Biotechnology). After premixing, the buffer was added to a 0.2 mL reaction tube. The RPA reaction procedure was: constant temperature reaction at 43℃ for 30 min.
[0065] The CRISPR detection system (50 μL) consisted of: Cas12b (Yisheng Biotechnology, 14808ES65) 2 µL, sgRNA (100 ng / μL) 1 µL, 10×Reaction buffer (Yisheng Biotechnology, 14808ES65) 5 μL, CRISPR ssDNA Reporter (Haihexi Biotechnology DNA-FAM-12b; 12b-FAM) 0.5 μL, and DEPC water 41.5 μL. The CRISPR detection program was: incubation at 43℃ for 30 min. The formula for calculating the copy number of the positive standard plasmid is shown below:
[0066] Note: N 质粒 The calculated plasmid copy number concentration is expressed in copies / μL; N A Here, is Avogadro's constant, which is 6.02 × 10⁻⁶. 23 C represents the plasmid concentration after measurement, in ng / μL; N L 2710 is the number of base insertions in the plasmid, 2710 is the fragment length of the pUC57 vector, and 660 is the average molecular weight of the base pairs.
[0067] In this embodiment, the fluorescence curves and fluorescence growth rate trends of different primer sets are shown in [the figure]. Figures 7-10The validation results of each target primer showed that SADS-CoV-RPA-F2 / R2, RVA-RPA-F1 / R2, TGEV-RPA-F2 / R2, and PEDV-RPA-F2 / R3 all had strong fluorescence signals under both high concentration (10,000 copies / reaction) and low concentration (1,000 copies / reaction) conditions. Therefore, SADS-CoV-RPA-F2 / R2, RVA-RPA-F1 / R2, TGEV-RPA-F2 / R2, and PEDV-RPA-F2 / R3 were ultimately selected for subsequent performance validation experiments.
[0068] Example 2: Sensitivity and Specificity Validation 1. Sensitivity Detection: Referring to Example 1, the copy number concentrations of pUC57-PEDV, pUC57-TGEV, pUC57-RVA, and pUC57-SADS-CoV positive standard plasmids were calculated at specified concentrations. Then, the pUC57-PEDV, pUC57-TGEV, pUC57-RVA, and pUC57-SADS-CoV positive standard templates were serially diluted with gradients including 1000 copies / reaction, 100 copies / reaction, 1 copy / reaction, 1, and 5 × 10⁻⁶. -1 Copy / Reaction. Using the optimal sgRNA and RPA primer combination determined in Example 1, as well as the RPA amplification system and CRISPR detection system in step 2 of Example 1, the sensitivity of the target virus was tested. Each gradient was repeated at least 3 times for verification.
[0069] 2. Specific detection: Nucleic acid samples (cDNA or DNA, concentration ≥10) from porcine deltacoronavirus vaccine (PDCoV; Wuhan Keqian Biotechnology Co., Ltd., inactivated porcine d-coronavirus vaccine (CHN-HN-2014 strain)), classical swine fever virus vaccine (CSFV; Guangdong Yongshun Biopharmaceutical Co., Ltd., attenuated classical swine fever virus strain CVCCAV1412), and porcine circovirus vaccine (PCV; Pulike Biotechnology Co., Ltd., inactivated porcine circovirus type 2 vaccine SH strain) were collected. 3 The copy / reaction group was used as the experimental group, and DEPC water was set as the blank control. Specificity was tested according to step 1, and each treatment was repeated at least 3 times for verification.
[0070] The amplification curves and fluorescence growth rates for sensitivity validation of each single target site are shown in the figure. Figures 11-14 Among them, RVA and TGEV can be detected at 1 copy / reaction, while SADS-CoV and PEDV can be detected at 10 copies / reaction.
[0071] Specific test results are shown Figure 15As can be seen from the figure, the amplification curves of PDCoV, CSFV, PCV and blank control all showed no signal, indicating that the RPA primer and sgRNA combination provided by this invention has good specificity.
[0072] Example 3: Single-target chip detection effect
[0073] The optimal sgRNA and primer set selected in Example 1 were used to perform single-target microarray detection, as shown in the following details: 1. Chip Composition like Figure 1 As shown, this invention provides a centrifugal microfluidic chip for simultaneous detection of four porcine viruses. The chip body is a circular disk containing multiple identical detection units, which are evenly arranged around the microfluidic chip body. Each detection unit includes a sample-RPA reagent dissolution chamber, four quantitative dispensing chambers, one four-primer encapsulation / reaction chamber 1, and four detection probe encapsulation / reaction chambers 2. The quantitative dispensing chambers are located radially outside the sample-RPA reagent dissolution chamber, and each quantitative dispensing chamber is connected to the sample-RPA reagent dissolution chamber via a connecting channel. The primer encapsulation / reaction chamber 1 is located radially outside the quantitative dispensing chamber, and each primer encapsulation / reaction chamber 1 is connected to the quantitative dispensing chamber via a siphon valve. The detection probe encapsulation / reaction chambers 2 are located radially outside the primer encapsulation / reaction chamber 1, and each detection probe encapsulation / reaction chamber 2 is connected to the primer encapsulation / reaction chamber 1 via a siphon valve.
[0074] The centrifugal microfluidic chip for simultaneous detection of four porcine viruses also includes a waste liquid chamber. The waste liquid chamber is located radially outside the sample-RPA reagent dissolution chamber and is connected to the sample-RPA reagent dissolution chamber through a connecting channel. It is used to collect and store excess sample liquid in the sample-RPA reagent dissolution chamber to ensure that the liquid in other chambers remains consistent and to prevent liquid overflow caused by excessive sample loading.
[0075] The centrifugal microfluidic chip for simultaneous detection of four porcine viruses has a centrifugation port or other similar component in the middle that can be detachably connected to a centrifugation device.
[0076] 2. Chip fabrication (1) Prepare the RPA amplification system. Each reaction (5 μL) contains the following components: 1 μL of 10 mM magnesium acetate, 2 μL of upstream RPA primer F (10 μM), and 2 μL of downstream RPA primer R (10 μM). Place the prepared system in primer encapsulation / reaction chamber 1 of the chip. Each chip corresponds to one target, that is, the same RPA primer is in all 4 primer encapsulation / reaction chambers 1.
[0077] (2) Prepare the CRISPR detection system. Each reaction (10 μL) contains the following components: Cas12b (Yisheng Bio, 14808ES65) 0.4 μL, sgRNA (100 ng / µL) 0.75 μL, 10×Reaction buffer (Yisheng Bio, 14808ES65) 1 μL, CRISPR ssDNA Reporter (Haihexi Bio DNA-FAM-12b; 12b-FAM) 0.3 μL, and DEPC water to make up to 10 μL. The final concentrations of each component are 0.1 µM, 7.5 ng / µL, 1×, and 3 μM, respectively. Place the prepared system in the detection probe encapsulation / reaction chamber 2 of the chip. Each chip corresponds to one target, that is, the same sgRNA is in all 4 detection probe encapsulation / reaction chambers 2.
[0078] (3) Place the chip in a 50°C oven and dry it for 1.5 h. After drying, take the chip out, cover it with a film, and place it in a sealed aluminum foil bag for storage in a low-humidity environment.
[0079] 3. Single-target chip verification (1) Dilute the positive standard plasmids of pUC57-PEDV, pUC57-TGEV, pUC57-RVA and pUC57-SADS-CoV and load them at a concentration of 10,000 copies / reaction.
[0080] (2) Prepare the loading solution, wherein the loading solution system (50 μL) is: 25 μL of amplification buffer (containing lyophilized enzyme preparation, RT-basic nucleic acid amplification reagent (RAA method), Hangzhou Zhongce Biotechnology), 1 μL of plasmid template, 24 μL of DEPC water, and a total of 50 μL.
[0081] (3) After mixing the sample solution, add it to the sample-RPA reagent dissolution chamber of the centrifugal microfluidic chip, then seal the chip tightly with the chip film, place the chip in the instrument, start the instrument and perform detection according to the procedure and conditions in Table 4 and read the detection results.
[0082] Table 4 Detection Procedure and Reaction Conditions
[0083] Each chip corresponds to a specific target, and the verification results for each target are as follows: Figure 16 As shown, all four targets can produce strong fluorescence signals after CRISPR in situ formulation, indicating that the CRISPR in situ formulation performance of the four targets in this invention meets the requirements of subsequent testing.
[0084] Example 4: Detection effect of multi-target chip and verification of inter-target specificity
[0085] Based on previous validation, pUC57-PEDV, pUC57-TGEV, pUC57-RVA, and pUC57-SADS-CoV positive standards were diluted to 10,000 copies / reaction and tested using a multi-target centrifugal microfluidic chip. The detection effect was confirmed using the optimal sgRNA and primer set screened in Example 1, combined with the system configuration and preparation process in Example 3, as detailed below: 1. Chip composition: Same as in Example 3.
[0086] 2. Chip fabrication (1) Preparation of RPA amplification system: Same as in Example 3, RPA amplification system containing primers PEDV-RPA-F2 / R3, RVA-RPA-F1 / R2, TGEV-RPA-F2 / R2 and SADS-CoV-RPA-F2 / R2 is added sequentially to each of the four primer encapsulation / reaction chambers 1 of each detection unit in the chip; (2) Preparation of CRISPR detection system: Same as in Example 3, CRISPR detection system containing SADS-CoV-sgRNA-3, RVA-sgRNA-2, TGEV-sgRNA-3 and PEDV-sgRNA-3 is sequentially added to the packaging / reaction chamber 2 of the 4 detection probes in each detection unit of the chip.
[0087] 3. Multi-target chip verification: The specific detection method is the same as in Example 3.
[0088] The performance confirmation results are shown in the following figure. Figure 17 The experimental results of this round of verification show that the primer combination of the four targets combined with the CRISPR process can output a strong positive signal in the detection platform. Furthermore, with only one type of sample added, only the corresponding well of the four-target chip can generate a positive signal, indicating that the RPA-CRISPR detection process designed in this invention has good specificity among the four targets.
[0089] Example 5: Sensitivity Verification of Multi-Target Chip
[0090] Based on the completion of the feasibility verification of the multi-target chip, this invention continued to verify the sensitivity of the multi-target chip. This invention selected 1000, 100, and 1 copy / reaction of pUC57-PEDV, pUC57-TGEV, pUC57-RVA, and pUC57-SADS-CoV positive standard plasmids to verify the sensitivity of the microfluidic platform. The specific method is described in Example 4.
[0091] The verification results are shown below. Figure 18The verification results show that the detection sensitivity of the three target chips in this patent, namely PEDV, SADS-CoV and TGEV, can reach 100 copies / reaction, and the RVA target sensitivity can reach 1 copy / reaction.
[0092] Example 6: Accuracy Verification of Multi-Target Chips
[0093] To verify the reliability of the multi-target chip method established in this invention, the optimal sgRNA and primer set selected were used, combined with the multi-target chip and corresponding detection method of Example 4, to detect 35 nucleic acids. Among them, 8 nucleic acids were TGEV positive samples preserved in the laboratory, 6 were PEDV positive samples, 5 were RVA positive samples, 4 were SADS-CoV positive samples, and 12 were negative samples. RNA was extracted from each sample and reverse transcribed into cDNA. The cDNA was used as the test sample for detection, and the detection steps were the same as in Example 4.
[0094] The results showed that 23 positive nucleic acids were significantly amplified with fluorescent signals by multi-target chip detection, while no fluorescent signals were detected in any negative samples. This was consistent with the results of quantitative real-time PCR detection, with an accuracy of 100%. The results comparison is shown in Table 5.
[0095] Table 5. RAA-CRISPR Detection Results
[0096] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. A primer set for simultaneous detection of four porcine viruses, characterized in that... It includes sgRNA and RPA primer sets for detecting porcine acute diarrhea syndrome coronavirus, sgRNA and RPA primer sets for detecting porcine rotavirus, sgRNA and RPA primer sets for detecting porcine transmissible gastroenteritis virus, and sgRNA and RPA primer sets for detecting porcine epidemic diarrhea virus. The nucleotide sequences of the sgRNA and RPA primer sets for detecting porcine acute diarrhea syndrome coronavirus are shown in SEQ ID NO: 7, 26, and 29, respectively; the nucleotide sequences of the sgRNA and RPA primer sets for detecting porcine rotavirus are shown in SEQ ID NO: 9, 31, and 35, respectively; the nucleotide sequences of the sgRNA and RPA primer sets for detecting porcine transmissible gastroenteritis virus are shown in SEQ ID NO: 13, 38, and 41, respectively; and the nucleotide sequences of the sgRNA and RPA primer sets for detecting porcine epidemic diarrhea virus are shown in SEQ ID NO: 16, 44, and 48, respectively.
2. A kit for simultaneous detection of four porcine viruses, characterized in that... It contains the sgRNA and RPA primer set as described in claim 1.
3. The kit for simultaneous detection of four porcine viruses according to claim 2, characterized in that: The kit also contains at least one of the following components: magnesium acetate, amplification buffer containing lyophilized enzyme preparation, Cas12b, CRISPR detection buffer, CRISPR ssDNA Reporter, and water.
4. The use of the sgRNA and RPA primer set according to claim 1 or the kit according to claim 2 or 3 in the detection of porcine viruses.
5. A centrifugal microfluidic chip for simultaneous detection of four porcine viruses, characterized in that... The device comprises a sample-RPA reagent dissolution chamber, four quantitative dispensing chambers, four primer encapsulation / reaction chambers 1, and four detection probe encapsulation / reaction chambers 2. The quantitative dispensing chambers are located radially outside the sample-RPA reagent dissolution chamber, and each quantitative dispensing chamber is connected to the sample-RPA reagent dissolution chamber via a connecting channel. The primer encapsulation / reaction chambers 1 are located radially outside the quantitative dispensing chambers, and each primer encapsulation / reaction chamber 1 is connected to the quantitative dispensing chamber via a siphon valve. The detection probe encapsulation / reaction chambers 2 are located radially outside the primer encapsulation / reaction chambers 1, and each detection probe encapsulation / reaction chamber 2 is connected to the primer encapsulation / reaction chamber 1 via a siphon valve. Each of the four primer encapsulation / reaction chambers 1 and the detection probe encapsulation / reaction chambers 2 contains the RPA primers and sgRNA from the sgRNA and RPA primer sets described in claim 1, respectively.
6. The method for preparing the centrifugal microfluidic chip for simultaneous detection of four porcine viruses as described in claim 5, characterized in that... It includes the following steps: (1) Prepare the RPA amplification system and the CRISPR detection system. Each 5 μL of RPA amplification system in each reaction contains the following components: 1 μL of 10 mM magnesium acetate, 2 μL each of 10 μmol / L RPA primer F and RPA primer R; each 10 μL of CRISPR detection system in each reaction contains the following components: 0.4 μL of Cas12b, 0.75 μL of sgRNA, 1 μL of 10×Reaction buffer, 0.3 μL of CRISPR ssDNA Reporter, and water to a final volume of 10 μL. (2) Place the RPA amplification system and the CRISPR detection system in primer encapsulation / reaction chamber 1 and encapsulation and reaction chamber 2 respectively, and then dry the chip; after drying, take out the centrifugal microfluidic chip and cover it with a transparent sealing film to obtain a centrifugal microfluidic chip for simultaneous detection of four porcine viruses.
7. A centrifugal microfluidic chip system for simultaneous detection of four porcine viruses, characterized in that... It includes the chip described in claim 5.
8. The application of the centrifugal microfluidic chip of claim 5 or the centrifugal microfluidic chip system of claim 7 in the detection of porcine viruses.
9. A method for simultaneous detection of four porcine-derived viruses, characterized in that... It includes the following steps: Prepare the sample loading solution, wherein the sample loading solution system is: 25 μL of amplification buffer containing lyophilized enzyme preparation, 1 μL of nucleic acid sample to be tested, and 24 μL of water; after mixing the sample loading solution, transfer it to the sample-RPA reagent dissolution chamber of the centrifugal microfluidic chip system described in claim 5 or the centrifugal microfluidic chip system described in claim 7, seal the chamber tightly, and then perform the detection.
10. The method for simultaneous detection of four porcine-derived viruses according to claim 9, characterized in that: The detection method specifically includes the following steps: (1) After adding the sample solution to the sample-RPA reagent dissolution chamber of the centrifugal microfluidic chip, centrifuge at 1500-2000 rpm for 15-30 s to transfer the sample from the sample-RPA reagent dissolution chamber to the quantitative dispensing chamber; (2) Let stand for 30-60 s to allow the sample to be transferred to primer encapsulation / reaction chamber 1 through the siphon valve; (3) Centrifuge at 1500-2000 rpm for 15-30 s, and transfer the sample from the siphon valve to primer encapsulation / reaction chamber 1; (4) RPA amplification: The sample was reacted at 43℃ for 10-15 min; (5) Centrifuge at 1500-2000 rpm for 15-30 s, and transfer the sample to the detection probe encapsulation / reaction chamber 2 through the siphon valve; (6) CRISPR detection: The reaction was carried out at 43℃ for 8-10 min, and fluorescence signals were collected at the beginning and end of the reaction.
Citation Information
Patent Citations
Multiplex ligation-dependent probe amplification detection kit for simultaneously detecting five swine disease viruses, primers and probes
CN102943129A
CrRNA, kit and method for rapidly and visually detecting SADS-CoV
CN114752710A
Method for detecting virus based on CRISPR technology
CN115678898A
Joint detection kit for influenza A viruses H1N1, H3N2, H5N1 and H7N9
CN118147373A
Primer probe combination and kit for detecting porcine diarrhea related viruses
CN119162379A