One-step detection primer group, kit and detection method for group A porcine rotavirus

By designing specific primer sets and kits, and combining them with one-step RT-qPCR technology, the sensitivity and accuracy issues of group A porcine rotavirus detection have been resolved, achieving efficient and accurate virus detection suitable for large-sample testing.

CN120967069APending Publication Date: 2025-11-18LINGNAN MODERN AGRI SCI & TECH GUANGDONG PROVINCIAL LAB ZHAOQING BRANCH CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511212978.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-28
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

The lack of a high-sensitivity and high-precision one-step RT-qPCR detection method for group A porcine rotavirus in existing technologies results in low detection efficiency, making it difficult to meet the needs of rapid diagnosis and prevention.

Method used

A one-step detection primer set for group A porcine rotavirus was designed and provided, including the upstream primer TCAGCTAGTACGACCACCGA and the downstream primer GTCCGCAAGCACAGATTCA. Combined with the reverse transcription system and fluorescence quantitative system in the kit, rapid and accurate detection is achieved through one-step RT-qPCR amplification.

Benefits of technology

It achieves highly sensitive detection of group A porcine rotavirus, capable of detecting 10 copies, with good specificity, good repeatability, and accurate and reliable detection results, suitable for large-sample detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120967069A_ABST
    Figure CN120967069A_ABST
Patent Text Reader

Abstract

The invention provides a one-step detection primer group, kit and detection method for group A porcine rotavirus, the one-step detection primer group comprises an upstream primer and a downstream primer, the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO.2; wherein the sequence as shown in SEQ ID NO. 1 is TCAGCTAGTACGACCACCGA, and the sequence as shown in SEQ ID NO. The sequence shown in SEQ ID NO.2 is GTCCGCAAGCACAGATTCA. The one-step method RT-qPCR detection of the group A porcine rotavirus is carried out by adopting the one-step method detection primer group, the specificity is good, the sensitivity is high, the repeatability is good, direct quantification can be realized, the detection is convenient and rapid, and the result is accurate and reliable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the technical field of molecular biology, specifically relating to a one-step detection primer set, reagent kit, and detection method for group A porcine rotavirus. Background Technology

[0002] Porcine rotavirus A (PoRVA) is a highly contagious enterovirus and a major pathogen causing acute gastroenteritis in one-week-old piglets. The main clinical symptoms include loss of appetite, vomiting, and diarrhea, with a mortality rate as high as 50%-100%. PoRVA is one of the leading causes of diarrhea in pig herds. In recent years, the detection rate and morbidity of PoRVA have increased significantly, posing a considerable threat to the pig industry. Therefore, the establishment of rapid diagnostic methods and the development of vaccines against prevalent genotypes are of great importance for the prevention and control of PoRVA.

[0003] One-step RT-qPCR (Reverse transcription quantitative real-time polymerase chain reaction) is a highly sensitive nucleic acid quantification technique. Compared with traditional PCR and two-step RT-qPCR, one-step RT-qPCR directly quantifies RNA without the need to open the cap during the process, reducing the risk of contamination. It is easy to operate and is suitable for high-precision, large-sample detection of porcine rotavirus.

[0004] Currently, there is no ideal one-step RT-qPCR detection method for group A swine rotavirus. Therefore, it is necessary to provide a one-step detection primer set, kit, and detection method for group A swine rotavirus to detect it. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a one-step detection primer set, kit, and detection method for group A porcine rotavirus, which offers advantages such as high accuracy and sensitivity, thereby resolving the issues mentioned in the background section.

[0006] On the one hand, the invention provides the following technical solution: a one-step detection primer set for group A porcine rotavirus, the one-step detection primer set including an upstream primer and a downstream primer, the sequence of the upstream primer is shown in SEQ ID NO.1, and the sequence of the downstream primer is shown in SEQ ID NO.2; The sequence shown in SEQ ID NO.1 is: TCAGCTAGTACGACCACCGA; The sequence shown in SEQ ID NO.2 is: GTCCGCAAGCACAGATTCA.

[0007] On the other hand, the invention provides the following technical solutions, such as the application of the above-mentioned one-step detection primer set for group A rotavirus in the preparation of a group A rotavirus detection kit.

[0008] In another aspect, the invention provides the following technical solution: a kit for detecting group A porcine rotavirus, the kit comprising the one-step detection primer set as described above.

[0009] In addition, the kit for detecting group A porcine rotavirus provided by the present invention may also have the following additional technical features: Preferably, the kit further includes one or more combinations of a reverse transcription system, a fluorescence quantitative system, a positive control, a negative control, an RNA positive template, and a buffer.

[0010] On another aspect, the invention provides the following technical solution: a detection method for group A swine rotavirus, the method comprising: S1. Extract RNA from the sample to be tested to obtain a template for one-step RT-qPCR reaction; S2. Perform one-step RT-qPCR amplification on the one-step RT-qPCR reaction template using the one-step detection primer set to output the detection results.

[0011] In addition, the kit for detecting group A porcine rotavirus provided by the present invention may also have the following additional technical features: Preferably, in step S2, the reaction system for one-step RT-qPCR amplification is as follows: 10.0 μL of 2 × One Step SYBR Green Mix, 5.8 μL of RNase-free ddH2O, 1.0 μL of One Step SYBR Green Enzyme Mix, 0.4 μL of 50 × ROX Reference Dye, 0.4 μL of Primer F, 0.4 μL of Primer R, and 2.0 μL of template RNA.

[0012] Preferably, in step S2, the reaction program for one-step RT-qPCR amplification is as follows: 50℃ for 15 min, 95℃ for 30 s; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; 95℃ for 15 s, 60℃ for 15 s, 95℃ for 15 s, and collect the melting curve.

[0013] The one-step detection primer set, kit, and detection method for group A porcine rotavirus proposed in this invention have the following advantages: The primers of this invention are used for one-step RT-qPCR detection of group A porcine rotavirus. This method has good specificity, high sensitivity (up to 10 copies), good repeatability, can be directly quantified, and is convenient, fast, accurate and reliable. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0015] Figure 1 This is an electrophoresis result of the PoRVA VP6 dsRNA standard in Example 1 of the present invention; Figure 2 This is a diagram showing the PCR verification results of the three pairs of candidate primers in Example 2 of this invention; Figure 3 This is an amplification curve diagram of the three pairs of candidate primers in Example 2 of the present invention; Figure 4 This is a dissolution curve diagram from Example 4 of the present invention; Figure 5 This is the standard curve diagram in Embodiment 4 of the present invention; Figure 6 This is the RT-qPCR amplification curve from Example 5 of the present invention; Figure 7 This is a band diagram of the RT-PCR amplification product in Example 5 of the present invention; Figure 8 This is a diagram showing the results of a specificity test in Example 8 of the present invention.

[0016] The present invention will be further described below with reference to the accompanying drawings and description. Detailed Implementation

[0017] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain embodiments of the present invention, and should not be construed as limiting the present invention.

[0018] This invention provides a one-step detection primer set, kit, and method for group A porcine rotavirus. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments; those skilled in the art will clearly be able to modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0019] For the one-step detection primer set of group A porcine rotavirus of the present invention, the one-step detection primer set includes an upstream primer and a downstream primer, the sequence of the upstream primer is shown in SEQ ID NO.1, and the sequence of the downstream primer is shown in SEQ ID NO.2; The sequence shown in SEQ ID NO.1 is: TCAGCTAGTACGACCACCGA; The sequence shown in SEQ ID NO.2 is: GTCCGCAAGCACAGATTCA; It should be noted that the above sequences are all expressions that omit the 3' and 5' connectors. Therefore, the above three sequences can actually be represented as 5'-TCAGCTAGTACGACCACCGA-3' and 5'-GTCCGCAAGCACAGATTCA-3'.

[0020] This invention also provides the application of the one-step detection primer set for group A porcine rotavirus as described above in the preparation of a group A porcine rotavirus detection kit.

[0021] For a kit for detecting group A porcine rotavirus, the kit includes the one-step detection primer set as described above.

[0022] The kit also includes one or more combinations of a reverse transcription system, a fluorescence quantitative system, a positive control, a negative control, an RNA positive template, and a buffer solution.

[0023] For the detection method of group A rotavirus in this invention, the method includes: S1. Extract RNA from the sample to be tested to obtain a template for one-step RT-qPCR reaction; S2. Perform one-step RT-qPCR amplification on the one-step RT-qPCR reaction template using the one-step detection primer set to output the detection results.

[0024] In step S2, the reaction system for one-step RT-qPCR amplification is as follows: 10.0 μL of 2 × One Step SYBR Green Mix, 5.8 μL of RNase-free ddH2O, 1.0 μL of One Step SYBR Green Enzyme Mix, 0.4 μL of 50 × ROX Reference Dye, 0.4 μL of Primer F, 0.4 μL of Primer R, and 2.0 μL of template RNA.

[0025] In step S2, the reaction program for one-step RT-qPCR amplification is as follows: 50℃ for 15 min, 95℃ for 30 s; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; 95℃ for 15 s, 60℃ for 15 s, 95℃ for 15 s, and collect the melting curve.

[0026] The reagents and consumables used in this invention are all commercially available products, as shown in Table 1 below: Table 1

[0027] The present invention will be further illustrated below with reference to the embodiments: Example 1: Primer design and establishment of dsRNA standard for group A porcine rotavirus VP6 gene 1. Based on the PoRVA YN-A VP6 gene sequence and the PoRVA VP6 gene sequences of major circulating strains already included in GenBank, three pairs of SYBR Green I one-step RT-qPCR candidate primers and one pair of VP6 full-length gene primers with a T7 promoter added to the 5' end were designed using SanpGene software in the highly conserved region of the VP6 gene. The specificity of the designed primers was analyzed using the Primer-BLAST function on the NCBI website. The primers were synthesized by Qingke Biotechnology Co., Ltd., and the primer sequences are shown in Table 2. Table 2

[0028] 2. Using the pre-constructed PoRVA VP6 gene recombinant plasmid standard as a template, amplification of the PoRV VP6 linearized template with T7 promoters at both ends was performed according to the system in Table 3 and the reaction procedure in Table 4. The PCR product was purified using the FastPure Gel DNA Extraction Mini Kit. The purified product was then processed using the T7 RNAi Transcription Kit, and the in vitro transcription system was prepared according to Table 5. The reaction was carried out at 37℃ for 2 hours and then at 72℃ for 10 minutes. The PCR system is shown in Table 3, the PCR reaction procedure is shown in Table 4, and the in vitro transcription system is shown in Table 5. Table 3

[0029] Table 4

[0030] Table 5

[0031] 3. The external transcription products were prepared into a two-enzyme digestion system according to Table 6 and incubated at 37°C for 30 min to degrade DNA, single-stranded RNA, and the three G bases at the 5' end. The two-enzyme digestion system is shown in Table 6. Table 6

[0032] 4. Purify dsRNA using magnetic beads in the T7 RNAi Transcription Kit. The specific steps are as follows: Remove the RNA Clean Beads from 4°C and allow them to equilibrate to room temperature for 30 minutes. Invert or vortex to mix well before use.

[0033] Add 80 μL of magnetic bead solution to the transcription product and pipette to mix the solution thoroughly more than 10 times.

[0034] Incubate at room temperature for 8 minutes to allow the RNA to fully bind with the magnetic beads.

[0035] Place the 1.5 mL EP tube on the magnetic rack for about 5 minutes. After the solution becomes clear, carefully remove the supernatant. When aspirating the supernatant, be careful not to disturb the magnetic beads.

[0036] Keep the 1.5 mL EP tube on the magnetic rack at all times, add 200 μL of freshly prepared 80% ethanol, being careful not to disturb the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Repeat this step once.

[0037] Open the lid and air-dry the magnetic beads for 5 to 10 minutes. Note that drying is only required until there is no water droplet on the surface of the magnetic beads; excessive drying will affect RNA elution.

[0038] Remove the 1.5 mL EP tube from the magnetic rack, add 40 μL of RNase-free H2O, use a pipette to blow the magnetic beads off the tube wall, mix thoroughly, and incubate at room temperature for 3 min.

[0039] Place the tube on the magnetic rack and wait for the solution to clarify. Carefully transfer the supernatant to a new RNase-free EP tube, being careful not to pick up the magnetic beads.

[0040] The concentration and purity of the product were determined using a spectrophotometer, and the size of the dsRNA was verified by 2% agarose gel electrophoresis. The purified product was stored at -80°C.

[0041] The standard should be prepared fresh before use. The dsRNA copy number concentration and mass concentration should be calculated using the following formula, where X is the mass concentration (ng / μL) and MW represents the average molecular weight (g / mol), calculated using SnapGene 6 software: ; The in vitro transcription product was digested with a two-enzyme system and purified by magnetic bead method to obtain PoRVA VP6 dsRNA standard. The electrophoretic detection results of the standard are as follows: Figure 1 As shown, the concentration of the standard stock solution was measured to be 7379.1 ng / μL under UV spectrophotometry. The A260 / A280 ratio was 2.08, which is between 1.9 and 2.1, indicating good purity. The A260 / A230 ratio was 2.54, which is greater than 2.0, indicating that there are basically no salt ion residues. After electrophoresis of the standard on a 2% agarose gel, the electrophoretic band was found to be at the expected position (1356 bp).

[0042] Example 2 Primer Optimization 1. Using diluted standard plasmids as templates, and following the reaction system outlined in Table 3 and the reaction procedure outlined in Table 4, PCR verification was performed on the three candidate primer pairs (qP1, qP2, and qP3) listed in Table 2. The results are as follows: Figure 2 As shown, in Figure 2In the diagram, M: D2000 DNA Marker; 1: qP1 amplification product (136 bp); 2: qP1-NTC; 3: qP2 amplification product (96 bp); 4: qP2-NTC; 5: qP3 amplification product (146 bp); 6: qP3-NTC. The PoRVA VP6 gene standard was amplified by PCR using the three candidate primer pairs qP1, qP2, and qP3. Following 2% agarose gel electrophoresis, the results showed that the bands amplified by the three primer pairs were all at the expected positions (136 bp, 96 bp, and 146 bp, respectively), with single bands, and no band was observed at NTC, indicating that the designed primer pairs had good specificity. 2. Using diluted PoRVA VP6 dsRNA standard as a template, quickly prepare the reaction system as shown in Table 7 on an ice-free, non-light-sensitive surface. Follow the default reaction program from the HiScript II One Step qRT-PCR SYBR Green Kit instructions (as shown in Table 8). Compare the Ct values ​​during the one-step RT-qPCR reaction of the three primer pairs, and select the primer pair with the lowest Ct value. Figure 3 It can be seen from this that, Figure 3 In the diagram, 1 represents the amplification curve of qP1, 2 represents the amplification curve of qP2, and 3 represents the amplification curve of qP3. The geometric mean Ct values ​​of qP1, qP2, and qP3 are 24.967, 28.601, and 26.233, respectively. Primer pair qP1 has the lowest Ct value, so qP1 was ultimately selected as the optimal primer pair.

[0043] Table 7

[0044] Table 8

[0045] Example 3: Optimization of Annealing Temperature and Primer Concentration 1. Set annealing temperatures: 58℃, 60℃, 62℃; final primer concentrations: 0.1μM, 0.2μM, 0.4μM, 0.8μM; final template concentration: 10. 3 copies / reaction, 10 4 copies / reaction, 10 5 copies / reaction, 10 6 Copies / reaction, comparing the linear relationship between final template concentration and Ct value under different combinations of annealing temperature and primer concentration (using correlation coefficient R). 2 R represents amplification efficiency (E). 2The annealing temperature and primer concentration combination closest to 1 and with 83.3% < E < 110% is the optimal combination. Table 9 shows the linear relationship (R 2 ) and amplification efficiency (Efficiency, E) between the final template concentration and the Ct value under different combinations of annealing temperature and primer concentration. When the primer reaction concentration is 0.4 μM and the annealing temperature is 62 °C, the R 2 value is the largest and the linear relationship is the best. At this time, R 2 = 0.998 and E = 95.140%.

[0046] Table 9

[0047] Example 4 Establishment of Standard Curve 1. Dilute the dsRNA standard product serially with DEPC water. Using the optimal annealing temperature and final primer concentration combination, set the final template concentration: 10 2 copies / reaction, 10 3 copies / reaction, 10 4 copies / reaction, 10 5 copies / reaction, 10 6 copies / reaction, 10 7 copies / reaction, 10 8 copies / reaction. Establish a standard curve and observe the melting curve through Quantstudio TM Design&Analysis software. The results are as Figure 4 shown. After amplifying the standard product templates at each dilution (10 2 copies / reaction ~ 10 8 copies / reaction) under the optimized reaction conditions, the following standard curve is constructed through QuantstudioTM Design&Analysis software. The results are as Figure 5 shown. The standard curve equation of the Ct value (y) and the copy number (x) is y = -3.444 × lgx + 38.473, the amplification efficiency is 95.139%, and the correlation coefficient R 2 = 0.999. The melting curve shows a single peak, further verifying that the primer has good specificity.

[0048] Example 5 Sensitivity, Specificity and Repeatability Tests 1. Dilute the dsRNA standard product serially with DEPC water. Using the optimal annealing temperature and final primer concentration combination, set the final template concentration: 10 0 copies / reaction ~ 10 8The sensitivity difference between the one-step RT-qPCR method and the conventional RT-PCR method was compared, with a template-free control (NTC) included. The minimum detectable template copy number for the one-step RT-qPCR method is 10 copies, while the minimum detectable template copy number for RT-PCR is 10. 2 copies, the result is as follows Figure 6 , 7 As shown, in Figure 6 Middle, 1, 10 8 copies / reaction; 2, 10 7 copies / reaction; 3, 10 6 Copies / Reaction; 4:10 5 Copies / Reaction; 5:10 4 Copies / Reaction; 6:10 3 copies / reaction; 7:10 2 8: 10 copies / reaction; 9: 1 copy / reaction; 10: NTC, in Figure 7 In the middle, M: D2000 DNA Marker; 1:10 8 Copies / Reaction; 2:10 7 Copies / Reaction; 3:10 6 Copies / Reaction; 4:10 5 Copies / Reaction; 5:10 4 Copies / Reaction; 6:10 3 copies / reaction; 7:10 2 8: 10 copies / reaction; 9: 1 opy / reaction; 10: NTC.

[0049] 2. Extracted nucleic acids of PoRVA, PEDV, TEGV, PDCoV, PRRSV, SIV, SADS-CoV, E. coli, SS, Pm, CSFV, and PRV were used as reaction templates under optimal conditions, with an NTC control included to test the specificity of the method. Using common viral and bacterial nucleic acids as templates, amplification was performed according to the established one-step RT-qPCR method, with an NTC control. The results showed that only PoRVA nucleic acid exhibited fluorescence signals and a specific amplification curve. PEDV, TEGV, PDCoV, PRRSV, SIV, SADS-CoV, E. coli, SS, Pm, CSFV, PRV nucleic acids, and NTC showed no amplification curves. The results are as follows: Figure 8 As shown.

[0050] 3. Serially dilute the dsRNA standard to achieve a final template concentration of 10 in the reaction system. 5 copies / reaction ~10 3 The copy / reaction was repeated in three replicates per group to evaluate the intra-group reproducibility. Amplification was performed at three different time points to evaluate the inter-group reproducibility. The results are shown in Table 10. Table 10

[0051] Example 6 Clinical Sample Testing The one-step RT-qPCR method established in this invention and the existing RT-PCR method were used to detect and compare 83 collected pig anal swabs, intestinal tissues, and intestinal contents. The samples were obtained from pig farms in Guangdong, Sichuan, Yunnan, and Jiangxi provinces from 2022 to 2024. The detection comparison results are shown in Table 11. Table 11

[0052] As shown in Table 11 above, the one-step RT-qPCR method established in this application detects the most positive samples. Its sensitivity is superior to RT-PCR, and it can detect pathogens with lower viral loads or weaker signals. At the same time, it can more accurately identify true positives, and its positive rate is high.

[0053] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention are equivalent substitutions and are included within the protection scope of the present invention.

Claims

1. A one-step primer set for detecting group A porcine rotavirus, characterized in that, The one-step detection primer set includes an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ ID NO.1, and the sequence of the downstream primer is shown in SEQ ID NO.

2. The sequence shown in SEQ ID NO.1 is: TCAGCTAGTACGACCACCGA; The sequence shown in SEQ ID NO.2 is: GTCCGCAAGCACAGATTCA.

2. The application of the one-step detection primer set for group A porcine rotavirus as described in claim 1 in the preparation of a group A porcine rotavirus detection kit.

3. A kit for detecting group A porcine rotavirus, characterized in that, The kit includes the one-step detection primer set as described in claim 1.

4. The kit for detecting group A porcine rotavirus according to claim 3, characterized in that, The kit also includes one or more combinations of a reverse transcription system, a quantitative fluorescence system, a positive control, a negative control, an RNA positive template, and a buffer solution.

5. A method for detecting group A porcine rotavirus, characterized in that, The method includes: S1. Extract RNA from the sample to be tested to obtain a template for one-step RT-qPCR reaction; S2. The one-step RT-qPCR reaction template is amplified by one-step detection primer set to output the detection results.

6. The detection method for group A porcine rotavirus according to claim 5, characterized in that, In step S2, the reaction system for one-step RT-qPCR amplification is as follows: 10.0 μL of 2 × One Step SYBR Green Mix, 5.8 μL of RNase-free ddH2O, 1.0 μL of One Step SYBR Green Enzyme Mix, 20.4 μL of 50 × ROX Reference Dye, 0.4 μL of Primer F, 0.4 μL of Primer R, and 2.0 μL of template RNA.

7. The detection method for group A porcine rotavirus according to claim 5, characterized in that, In step S2, the reaction program for one-step RT-qPCR amplification is as follows: 50℃ for 15 min, 95℃ for 30 s; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; 95℃ for 15 s, 60℃ for 15 s, 95℃ for 15 s, and collect the melting curve.