Application of WBSCR16 protein as target spot in preparation of medicine for treating diabetes

Abstract

The invention discloses an application of WBSCR16 protein as a target spot in preparation of a medicine for treating diabetes, and provides an application in research and development of related medicines. By constructing a mouse model of Wbscr16 with pancreatic beta cells specifically knocked out, the action mechanism of WBSCR16 in diabetes mellitus attack is deeply researched, and it is found that WBSCR16 participates in regulating the mitochondrial function of the pancreatic beta cells, and then insulin secretion is affected. On the basis, the invention provides a reagent for regulating the expression of the WBSCR16 protein for treating diabetes mellitus. Meanwhile, a construction method of the Wbscr16 pancreatic beta cell specific knockout mouse model is described in detail, and an important tool is provided for related research. Meanwhile, candidate drugs capable of acting on a WBSCR16 target spot are screened out through drug prediction, and a new strategy and a potential intervention direction are provided for treatment of diabetes mellitus.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, and specifically discloses the use of WBSCR16 protein as a target in the preparation of drugs for treating diabetes. Background Technology

[0002] With economic development and improved living standards, the incidence of diabetes in my country has reached 12.8%, and is showing a year-on-year increasing trend. Diabetes has become a serious disease threatening people's health. Type 2 diabetes mellitus (T2DM), as the main type of diabetes, is characterized by the persistent loss of functional pancreatic β-cells, leading to insulin secretion defects and insulin resistance. This alteration in pancreatic β-cell function and abnormal insulin action constitute the core elements of the complex pathophysiological mechanism of type 2 diabetes. Although existing diabetes drugs can effectively lower blood sugar levels in the short term, long-term use is often accompanied by side effects, such as weakened drug efficacy, accelerated decline in β-cell function, increased risk of hypoglycemia, and weight gain, failing to fundamentally address the problem of pancreatic β-cell apoptosis and exhaustion. Therefore, in-depth exploration of the intrinsic mechanisms of pancreatic β-cell dysfunction and the discovery of new drug targets will help alleviate pancreatic β-cell apoptosis, improve pancreatic β-cell function, and thus delay or reverse the progression of type 2 diabetes.

[0003] Mitochondria are crucial for the function and survival of pancreatic β-cells, primarily responsible for cellular energy metabolism and participating in insulin secretion. In pancreatic β-cells, mitochondria, as the core organelle for energy supply, produce adenosine triphosphate (ATP) through metabolic pathways such as oxidative phosphorylation, providing the necessary energy support for insulin synthesis, processing, and secretion. Simultaneously, mitochondrial metabolic signals participate in the complex signaling pathways regulating insulin secretion to ensure that insulin secretion levels are appropriate for the body's blood glucose levels, thereby maintaining blood glucose homeostasis. Mitochondria regulate pancreatic β-cell function through various pathways and processes, including but not limited to mitochondrial bioenergy and metabolism, and calcium ion (Ca) regulation. 2+ Mitochondrial homeostasis involves processes such as dynamic equilibrium, proton leakage, kinetic properties, and mitophagy. Recent studies have increasingly revealed a close link between mitochondrial dysfunction and the decline of pancreatic β-cell function and the development of diabetes. Despite this, exploration of mitochondria as a therapeutic target for type 2 diabetes remains limited. Therefore, in-depth investigation into the molecular mechanisms of mitochondrial dysfunction and the search for new strategies to restore mitochondrial homeostasis are of significant research value and clinical importance for the treatment of diabetes. Summary of the Invention

[0004] To address the aforementioned issues, this invention discloses the use of WBSCR16 protein as a target in the preparation of drugs for treating diabetes. This invention is the first to discover that WBSCR16 (Williams-Beuren Syndrome Chromosome Region 16), a protein located in mitochondria and involved in mitochondrial fission and fusion, can regulate mitochondrial function and improve pancreatic β-cell function.

[0005] The technical solution adopted in this invention is as follows:

[0006] This invention discloses the use of WBSCR16 protein as a target in the preparation of drugs for treating diabetes.

[0007] This invention discloses the use of a reagent that regulates WBSCR16 protein expression in the preparation of a drug for treating diabetes.

[0008] This invention discloses a method for constructing a Wbscr16 pancreatic β-cell-specific knockout mouse model, comprising the following steps:

[0009] 1) Gene targeting vector construction: Design and construct a gene targeting vector containing the LoxP site and the homologous sequence of the wbscr16 gene;

[0010] 2) ES cell transfection and screening: Gene targeting vectors are introduced into ES cells by electroporation or microinjection, and ES cell clones that have successfully undergone homologous recombination are screened by positive and negative selection.

[0011] 3) The above ES cells were injected into C57BL / 6 embryos and then re-implanted into CD-1 pseudopregnant female mice to generate chimeric mice;

[0012] 4) Male offspring were mated with wild-type C57BL / 6 female mice after coat color identification, and homozygous wbscr16 flox / flox genotype mice were screened by genotyping.

[0013] 5) The wbscr16 flox / flox genotype mice were further crossbred with inscre mice, and the pancreatic β-cell-specific knockout wbscr16 mice, namely βwb16 ko mice, were screened out by genotype identification.

[0014] Furthermore, in the above construction method, the nucleic acid sequence of the wbscr16 gene in step 1) is shown in SEQ ID NO.1.

[0015] Furthermore, in the above construction method, the genotype identification in step 4) includes the following primers:

[0016] LoxP PCR primers:

[0017] LoxP-F(F1): 5'-CTGAGTAAGTTGCATGAGTCGGG-3'=SEQ ID NO.2

[0018] LoxP-R(R1): 5'-GCTGAGATCTGTCTGGCATGGCT-3'=SEQ ID NO.3;

[0019] Neo deletes PCR primers:

[0020] Neo-del-F(F2):5'-AGCTGCTGTTTTGCCGACCTGGAA-3=SEQ ID NO.4'

[0021] Neo-del-R(R2):5'-GGAGATCAGGGGACAAGTTCAAAGA-3'=SEQ ID NO.5.

[0022] Furthermore, in the above construction method, the genotype identification in step 5) includes the following primers:

[0023] The following PCR identification primers are used to differentiate between Wbscr16 flox / flox, Wbscr16 flox / +, and WT:

[0024] Wbscr16-flox-F1:5'-GTTTCTTCTTGGTCACAACCACTA-3'=SEQ ID NO.6

[0025] Wbscr16-flox-R1:5'-GGTATCTTGTACACTCAGTGATGGG-3'=SEQ ID NO.7

[0026] Identification primers to distinguish between positive and negative Ins2 cre:

[0027] Ins2 cre-F: 5'-ACTCCAAGTGGAGGCTGAGA-3'=SEQ ID NO.8

[0028] Ins2 cre-R: 5'-TCCTTCCACAAACCCATAGC-3'=SEQ ID NO.9.

[0029] This invention discloses the use of the above-mentioned mouse model and its construction method in the research / preparation of drugs for treating diabetes.

[0030] Furthermore, in the above-mentioned uses, the drug is a drug that acts on the WBSCR16 target.

[0031] Compared with the prior art, the present invention has the following outstanding features:

[0032] 1) This invention is the first to discover the mRNA expression level of WBSCR16 in the pancreatic islet tissues of diabetic and normal mice, analyze the correlation between WBSCR16 and the occurrence and development of diabetes, and explore the possibility of WBSCR16 as a target for diabetes intervention.

[0033] 2) Construct pancreatic β-cell-specific knockout Wbscr16 mice (βwb16 ko) and use them as a research model to study the effects of pancreatic β-cell-specific knockout Wbscr16 on the basic phenotype and glucose metabolism of mice.

[0034] 3) The above effects specifically include elevated fasting and random blood glucose levels in mice, impaired glucose tolerance, impaired pancreatic β-cell function, and decreased pancreatic insulin levels.

[0035] 4) This invention also uses transcriptomics sequencing technology to reveal the mechanism by which pancreatic β-cell-specific knockout of Wbscr16 affects pancreatic β-cells.

[0036] 5) The above-mentioned mechanism of action was verified by mouse pancreatic tissue sections, which specifically included changes in pancreatic islet structure, reduction in pancreatic β-cell mass, decrease in pancreatic β-cell area, decrease in pancreatic β-cell proliferation rate, and increase in cell apoptosis rate.

[0037] 6) This invention also found that Wbscr16-specific knockout may lead to pancreatic β-cell dysfunction or even death by causing a decrease in ATP levels and altering mitochondrial function.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] In the first aspect of this application, a search and analysis was conducted using the GEO public database to investigate whether there are significant differential expressions of Wbscr16 in the pancreatic islets of diabetic and normal mice. The study found that in the GSE228726 dataset, the Wbscr16 mRNA level in db / db mice showed a significantly reduced trend. This finding provides, for the first time, a possible basis for Wbscr16 to serve as an intervention target for type 2 diabetes.

[0040] On the other hand, this invention constructed a mouse model of pancreatic β-cell-specific Wbscr16 knockout and investigated the effects of the mitochondrial protein WBScr16 on pancreatic β-cell function in vivo from multiple dimensions, including basic animal characteristics, glucose metabolism levels, cell proliferation, apoptosis, and changes in cell function. Its mechanism of action may be that specific knockout of Wbscr16 leads to a decrease in ATP levels, thereby altering mitochondrial function and ultimately causing pancreatic β-cell dysfunction, even inducing cell death.

[0041] In summary, the WBSCR16 protein disclosed in this invention can serve as a novel target for the treatment of type 2 diabetes. Attached Figure Description

[0042] Figure 1 Differential expression of Wbscr16 in diabetic and non-diabetic mice: Wbscr16 mRNA levels were found to be significantly lower in db / db mice compared with control db / + mice in the GSE228726 database; p<0.0001;

[0043] Figure 2 A schematic diagram illustrating the genotype identification strategy during the gene knockout mouse breeding process;

[0044] Figure 3 Electrophoresis image used to verify genotype identification during the gene knockout mouse breeding process;

[0045] Figure 4 Electrophoresis images were used to verify the gene identification of pancreatic β-cell-specific knockout WBSCR16 mice. Five mice were used as an example: mice 1, 2, and 3 had the genotype WBSCR16 flox / flox, indicating they were WBSCR16 fl / fl mice. Mouse 4 had the genotype WBSCR16 flox / +, indicating it was a heterozygous mouse. Mouse 5 had the genotype WBSCR16 flox / flox; Ins2 cre, indicating it was a βwb16 ko mouse. Water served as a negative control.

[0046] Figure 5 Effects of Wbscr16 pancreatic β-cell-specific knockout on mouse basic characteristics and glucose metabolism:

[0047] A: There was no significant difference in body weight between the wb16 fl / fl control group and the βwb16 ko knockout group mice;

[0048] BC:βwb16 ko mice had higher fasting and random blood glucose levels than control mice;

[0049] D, F: Fasting insulin detection and insulin tolerance test showed no significant differences between the two groups of mice;

[0050] E; Glucose tolerance test showed that βwb16 ko mice had impaired glucose tolerance; n≥3; ns showed no significant difference; *p<0.05; **p<0.01; ****p<0.0001;

[0051] Figure 6 Wbscr16 knockout specifically into pancreatic β cells leads to impaired pancreatic β cell function.

[0052] A: In vivo glucose-stimulated insulin secretion experiment;

[0053] B: Insulin content detection was used to assess the reserve function and secretory capacity of mouse pancreatic β cells; n≥3; *p<0.05; ****p<0.0001;

[0054] Figure 7 Transcriptomic sequencing results of pancreatic islets from the wb16 fl / fl control group and the βwb16 ko knockout group mice, with 3 samples in each group:

[0055] A: Principal component analysis (PCA) visualizes the differences in gene expression patterns between two groups of samples;

[0056] B: Volcano plots represent differentially expressed genes between two groups of samples. Red dots represent significantly upregulated genes, blue dots represent downregulated genes, and gray dots represent genes with no significant difference. The threshold for screening significantly differentially expressed genes is set to |log2FC|>1 and p<0.05.

[0057] C: GO enrichment analysis is used to describe the function of genes and gene products, and is divided into three main aspects: biological process, molecular function, and cellular component; D: KEGG enrichment analysis is used to identify key signaling pathways associated with specific biological processes or diseases.

[0058] Figure 8 Morphological changes in mouse pancreatic tissue:

[0059] AB: Immunofluorescence staining with insulin and glucagon antibodies was used to assess changes in the ratio of pancreatic β cells to pancreatic α cells;

[0060] CD: Immunohistochemical staining of pancreatic tissue to detect pancreatic β-cell mass;

[0061] EF: β-catenin antibody labels the cell membrane, insulin antibody labels pancreatic β cells, and the size changes of pancreatic β cells are measured;

[0062] GI: Ki67 / Tunel labeled proliferating / apoptotic cells, insulin antibody labeled pancreatic β cells, and pancreatic β cell proliferation rate and apoptosis rate were statistically analyzed using Photoshop software. At least 1000 pancreatic β cells were counted per mouse; n=3, scale bar 50μm, *p<0.05; **p<0.01; ***p<0.001;

[0063] Figure 9Wbscr16 knockout specifically into pancreatic β cells leads to impaired mitochondrial function in pancreatic β cells.

[0064] A: Measurement of ATP levels in mouse pancreatic islet tissue;

[0065] B: Changes in mitochondrial pathway and related gene expression, n=3, scale bar 50μm, *p<0.05; **p<0.01.

[0066] Figure 10 These are candidate drugs predicted for the WBSCR16 target. Detailed Implementation

[0067] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Reagents or instruments used in the embodiments of the present invention, unless otherwise specified, are all commercially available conventional reagent products.

[0068] SEQ ID NO.1=

[0069] gcgccataagcggttgaggcgtgacgcggaggatgttggcggcggcccgg

[0070] gctctgcgggggccgcggccgaggtggccgacaccggctcgcgagcactg

[0071] gacaccggccggccgttcgcggagccggcgagaagcggccgaggccgagg

[0072] cggacgttccggtgtttcagtacgtgggcgagcgcgcggctcgcgccgat

[0073] cgcgtcttcgtctggggcttcagcttctccggggcgctcggggtgcccag

[0074] cttcgtggtgccgtcctcggggcctggaccgcgcgccggcctgcggcccc

[0075] gacgcaggatccagccggtcccctaccgcctggagctggatcataagatt

[0076] tcctctgctgcctgtggctatggattcacattgctgtcctcgaaaaccaa

[0077] ggatgttacaaaagtctggggcatgggactcaacaaagattcccagctgg

[0078] gattccacaggagccggaaggataaaaccaggggctatgagtacgttttg

[0079] gagccctcgcctgtcccgctgccgctggacagacctcaggagacaaaggt

[0080] gttgcaggtgtcctgcggtcgagcacactcccttgtcctgacagacagag

[0081] aaggtgtcttcagcatgggcaacaattcccacgggcagtgtggccggaag

[0082] gtggtggaggatgaagtatacagcgagagtcacaaagtgcacaggatgca

[0083] ggacttcgatggacaggtggtccaggttgtctgtggtcaggaccacagcc

[0084] tgttcctcacagacaaaggtgaagtctattcttgtggctggggtgccgat

[0085] ggacagacaggcctgggtcactacaacatcaccagcacacccagcaagct

[0086] gggcggagaccttgccggggtgaccgttgtccaggtcgccacctacggtg

[0087] actgctgcttagctttgtccgctgatggaggtgtctttggctggggaaat

[0088] tccgagtacctgcagttggcctctgtcacagactccacacaggtgaatgt

[0089] ccctcggtgcctgcctttctctggagtaggcaaggtgaagcaggtggctt

[0090] gtggtggcacaggctgtgctgtactgaacgcggagggacatgttttcgtc

[0091] tggggctatggaattcttgggaaaggaccaaagctcttggaaacggcaat

[0092] tccagaaatgattccacccacgctctttggtttgacggagtttaaccctg

[0093] aagtccaggtttcccagatccgatgtgggcttagccactttgccgcactc

[0094] accaacaagggtgagctgttcgtgtggggcaagaacatccgagggtgctt

[0095] ggggattggccgcctggaagaccagtacttcccatggagggtgacgatgc

[0096] ccggtgagcctgtggatgtggcgtgtggagtggatcacatggtgactcta

[0097] gccaagtcattcatctgaaaggccctctgggcccagcctgggagccacac

[0098] cacagcagcagcttggcagaggcagggggtggccaccagcagagcttctg

[0099] agggtactgggagagggccagggcctctggggtgcaggatgcttgctgtg

[0100] tgtcctcagtggggacattctactagaggtgtgtggacaaagcccttccc

[0101] ccgctgaggttcctgctgctggcctcagctcaggatggctacagttggct

[0102] tgccgtgtttctgaggagcaccagggcgtgaagaccttgggtggccaggc

[0103] agattccttttccaggtaacacatggtagcatctggggatgtgtcttgtc

[0104] tgagacactattcttagagaaagttcactgctcatgacacatttgatatt

[0105] aagagtttagagacatgacaaggcactcagaagaacttgtagtcccctgt

[0106] cacaggaggataaagttggcctcagctcagcaagaagccagctgactgcc

[0107] tgcagctagggcctctggtcagctgtcatcccaggagtcccgcagaagga

[0108] cagtccaggagcccaggatgccttggcttgagactcttgatggagctgcc

[0109] agtgggagccagcctcccgctcaggcctacagtatcccagccttggaact

[0110] tcctcactgcctggctttgaacagcccagaagcccctgaagaaagactct

[0111] gcgggccaagtgcttgtgggctgagggccgtggaatcttggctgaagggc

[0112] tggccttggagtaggaggcctcagaaactgggaaatacttgtttttaggg

[0113] aagcttgccctttcctttcagaacagggttggaaaaggtcttttggaata

[0114] aagcctattttctgccttttt

[0115] Example 1

[0116] Differential expression analysis of Wbscr16 in diabetic and non-diabetic individuals

[0117] Log in to the NCBI website, select "GEO DataSets", search for the keywords "islet, diabetes", find and analyze RNA-Seq data. In order to screen for more differentially expressed genes, set the screening difference threshold to |log2FC|≥0.585, p<0.05.

[0118] like Figure 1 As shown, this invention, through searching and analyzing the transcriptome GEO database GSE228726 of pancreatic islet tissues in diabetic and non-diabetic individuals, found that the expression level of WBScr16 mRNA was significantly reduced in db / db mice compared to the control group db / + mice (p<0.0001). This suggests that WBScr16 may serve as a target for intervention in type 2 diabetes.

[0119] Example 2

[0120] Effects of Wbscr16 pancreatic β-cell-specific knockout on basic characteristics and glucose metabolism in mice.

[0121] 1. Constructing Wbscr16 pancreatic β-cell-specific knockout mice

[0122] (1) Target gene sequence to be knocked out:

[0123] The target gene sequence was obtained from the following URL:

[0124] https: / / genome.ucsc.edu / cgi-bin / hgTracks? db=hg38&lastVirtModeType=default&lastVirt ModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr

[0125] 7%3A75042193%2D75073664&hgsid=2383784157_r2JXUKm2quleWjA8dCRt2PU54y QA,AF410456.1, sequence as shown in SEQ ID NO.1.

[0126] (2) Gene targeting vector construction: Design and construct a gene targeting vector containing the LoxP site and the homologous sequence of the wbscr16 gene according to existing technology. The loxP site is located on both sides of exon 2 of the wbscr16 gene, i.e., the target gene fragment in (1).

[0127] (3) ES cell transfection and screening: Gene targeting vectors were introduced into ES cells by electroporation or microinjection according to existing technology, and ES cell clones 1E3 and 1G12 that successfully underwent homologous recombination were screened out by positive and negative screening.

[0128] (4) Gene knockout mouse breeding process

[0129] ES cell clones 1E3 and 1G12 were injected into C57BL / 6 embryos, which were then re-implanted into CD-1 pseudopregnant female mice. After coat color identification, the offspring were mated with C57BL / 6 females, and genotyping was performed to confirm their germline transmission. Three male and one female heterozygous targeted mice were generated from clone 1E3, and one male and two female heterozygous targeted mice were generated from clone 1G12.

[0130] Genotyping strategies, such as Figure 2 As shown:

[0131] LoxP PCR primers:

[0132] LoxP-F(F1): 5-CTGAGTAAGTTGCATGAGTCGGG-3=SEQ ID NO.2

[0133] LoxP-R(R1):5-GCTGAGATCTGTCTGGCATGGCT-3=SEQ ID NO.3

[0134] PCR product length:

[0135] Wild type: 307bp

[0136] Knockout type: 347bp

[0137] Neo deletes PCR primers:

[0138] Neo-del-F(F2):5'-AGCTGCTGTTTTGCCGACCTGGAA-3'=SEQ ID NO.4

[0139] Neo-del-R(R2):5'-GGAGATCAGGGGACAAGTTCAAAGA-3'=SEQ ID NO.5

[0140] PCR product length:

[0141] Wild type: 177bp

[0142] Knockout type: 284bp

[0143] Verification image such as Figure 3 As shown:

[0144] 5) After obtaining wbscr16 flox / flox, continue mating and breeding with inscre mice to further identify pancreatic β-cell-specific knockout wbscr16 mice. The gene identification protocol is as follows:

[0145] The following PCR identification primers are used to differentiate between Wbscr16 flox / flox, Wbscr16 flox / +, and WT:

[0146] Wbscr16-flox-F1:GTTTCTTCTTGGTCACAACCACTA=SEQ ID NO.6

[0147] Wbscr16-flox-R1:GGTATCTTGTACACTCAGTGATGGG=SEQ ID NO.7

[0148] MT: 259bp

[0149] WT: 219bp

[0150] PCR results:

[0151] Only one band: 259bp; for Wbscr16 flox / flox;

[0152] Only one band: 219bp; indicating a wild-type mouse.

[0153] Two bands: 259bp and 219bp; Wbscr16 flox / +.

[0154] Identification primers to distinguish between positive and negative Ins2 cre:

[0155] Ins2 cre-F:ACTCCAAGTGGAGGCTGAGA==SEQ ID NO.8

[0156] Ins2 cre-R:TCCTTCCACAAACCCATAGC==SEQ ID NO.9

[0157] The size of the positive band was 203 bp.

[0158] Verification image such as Figure 4 As shown:

[0159] Taking five mice as an example, mice 1, 2, and 3 have the genotype Wbscr16 flox / flox, making them wb16 fl / fl mice. Mouse 4 has the genotype Wbscr16 flox / +, making it a heterozygous mouse. Mouse 5 has the genotype Wbscr16flox / flox;Ins2 cre, making it a βwb16 ko mouse. Water served as a negative control.

[0160] 2. Measurement of mouse body weight, blood glucose, and insulin levels:

[0161] Weight changes of 8-week-old βwb16 ko mice and wb16 fl / fl mice were measured. Blood glucose levels were measured by tail blood sampling using a Bayer Glucose Meter. Serum insulin levels in mice were detected using an insulin mouse ultrasensitive ELISA kit.

[0162] 3. Insulin Tolerance Test (IPITT):

[0163] After fasting for 6 hours, the mice were measured for body weight and fasting blood glucose. They were then injected intraperitoneally with 1.0 U / kg insulin solution. Blood glucose changes were measured by collecting blood samples from the tail tip at 15, 30, and 60 minutes after injection.

[0164] Example 3

[0165] Wbscr16 knockout of pancreatic β cells specifically leads to impaired pancreatic β cell function.

[0166] 1. Insulin Release Test (IRT):

[0167] Mice were fasted for 16 hours, weighed, and injected intraperitoneally with 2 g / kg glucose. Blood was collected from the ocular vein at different time points (0, 15, and 30 min). After centrifugation, the supernatant was collected, and the changes in serum insulin levels in mice were detected using an insulin mouse ultrasensitive ELISA kit.

[0168] 2. Measurement of pancreatic insulin content

[0169] (1) Anesthetize mice with 1% pentobarbital solution, collect blood from the eyeballs and separate the whole pancreas, absorb the impurities on the surface of the pancreas with filter paper, and weigh the pancreas.

[0170] (2) Place the pancreas into a centrifuge tube containing 8 mL of acidified ethanol (the ratio is 75% ethanol + 1.5% concentrated hydrochloric acid + 23.5% water), quickly cut the pancreas into small pieces with scissors, and homogenize it.

[0171] (3) Rinse the scissors and homogenizer rotor with 2 mL of acidified ethanol, and place the centrifuge tube on the vortex and shake it a few times.

[0172] (4) Rotate the homogenized suspension slowly at 4°C overnight, and seal the tube opening.

[0173] (5) Remove the centrifuge tube, shake it on the vortex a few times and then start centrifugation: 15000g / rpm at 4℃ for 20min.

[0174] (6) Collect the supernatant, filter it and store it at -20℃ for insulin testing.

[0175] like Figure 5 and Figure 6 As shown, we performed a series of metabolic function analyses on 8-week-old β-cell-specific wbscr16 gene knockout mice (βwb16 ko) and their control group (wb16 fl / fl). The results showed no statistically significant difference in body weight between the two groups. Figure 5 A). However, in terms of blood glucose levels, the fasting blood glucose and random blood glucose levels of βwb16 ko mice were higher than those of the control group, and the blood glucose levels of some individuals exceeded the normal physiological range, exhibiting characteristics of diabetes. Figure 5 BC). Furthermore, although the fasting insulin levels in βwb16 ko mice did not reach statistical significance, they showed a trend of being higher than those in the control group. Figure 5 D). Furthermore, in the interproximal glucose tolerance test (IPGTT), βwb16 ko mice exhibited significant impaired glucose tolerance, indicating that these mice had impaired glycemic regulation. Figure 5 E). Impaired glucose regulation can be attributed to two main factors: insulin resistance and reduced pancreatic β-cell function. To assess whether pancreatic β-cell-specific knockout of the wbscr16 gene affects peripheral insulin resistance, both groups of mice underwent an insulin tolerance test (IPITT), and no significant difference was observed between βwb16 ko mice and wb16 fl / fl mice. Figure 5 F). Conversely, further insulin release assays (IRT) revealed impaired pancreatic β-cell function. Figure 6 A). This finding is supported by the results of pancreatic insulin content detection, where we found that the pancreatic insulin content of βwb16 ko mice was significantly lower than that of wb16 fl / fl mice (A). Figure 6 B). In summary, these results indicate that the deletion of the wbscr16 gene leads to pancreatic β-cell dysfunction, which in turn affects blood glucose regulation and may ultimately contribute to the development of diabetes.

[0176] Example 4

[0177] Transcriptomic sequencing of mouse pancreatic islets

[0178] 1. Isolation of primary mouse islets:

[0179] After anesthetizing the mice, the abdominal cavity was opened along the midline. The duodenum and common bile duct were located first, and the common bile duct was clamped with small hemostatic forceps. Collagenase was then injected from a syringe and used to fill the entire pancreas along the common bile duct. The pancreas was separated and placed in a centrifuge tube containing collagenase, where it was digested at 37°C. After digestion was complete, the pancreas was centrifuged and sieved. Finally, islets were manually selected under a stereomicroscope. These islets were stored at -80°C for subsequent experimental analysis.

[0180] 2. Transcriptome sequencing:

[0181] Primary pancreatic islet tissues were isolated from 12-week-old wb16 flox / flox control group and βwb16 ko mice, with 3 mice in each group. RNA sequencing analysis was performed, and the threshold for screening differentially expressed genes was set to |log2FC|≥1, p<0.05.

[0182] The results showed that the PCA plots indicated good dispersion between the two groups of samples, making them suitable for differential gene analysis. Figure 7 A). Compared with the control group, a total of 456 genes were significantly differentially expressed in the βwb16 gene knockout group, including 320 upregulated genes and 136 downregulated genes. Figure 7 B). GO enrichment analysis showed that it was involved in processes such as pancreatic β-cell proliferation, regulation of pancreatic β-cell proliferation, regulation of lipid metabolism, immune response, adipocyte differentiation and development, etc. Figure 7 C). In addition, we performed a KEGG pathway enrichment analysis and listed the top 30 significantly enriched signaling pathways (C). Figure 7 D). These pathways include hematopoietic cell lines, folic acid biosynthesis, cholesterol metabolism, type 1 diabetes, drug metabolism-cytochrome P450, thiamine metabolism, galactose metabolism, ovarian steroid production, MAPK signaling pathway, and apoptosis. These results suggest that the deletion of the wbscr16 gene may be closely related to pancreatic β-cell proliferation and apoptosis.

[0183] Example 5

[0184] Morphological changes in mouse pancreatic tissue.

[0185] 1. Immunofluorescence staining of paraffin-embedded pancreatic tissue sections:

[0186] (1) Dewaxing and hydration: Dewaxing the tablets in a 60℃ oven for 2 hours; soaking the tablets in fresh xylene I for 10 minutes; soaking the tablets in fresh xylene II.

[0187] Soaking in anhydrous ethanol for 10 min; soaking in anhydrous ethanol for 5 min; soaking in 95% ethanol I for 5 min; soaking in 95% ethanol II for 5 min;

[0188] Soak slides in 75% ethanol for 5 min; soak slides in 50% ethanol for 5 min; wash slides with PBS for 5 min each time, 3 times.

[0189] (2) Antigen repair: Place the dewaxed and hydrated slide in the repair cup and immerse it in EDTA antigen repair solution 1* working solution. The working solution is 50X, and 4mL is added to 200mL PBS. Boil the rice cooker in advance, place the repair cup in the rice cooker and boil for 20min, let it sit for 20min, and place it at room temperature for 45min.

[0190] (3) Serum blocking: Remove residual washing solution from the slide. Circle the sample area on the slide with a histochemical pen, add 0.3% Triton-X to make holes for 15 min, wash with PBS for 5 min * 3 times, cover the sample area with IF blocking buffer, and incubate at room temperature for 1 h.

[0191] (4) Antibody incubation: Remove the blocking solution from the slide, add diluted primary antibody solution, immerse the sample area, and incubate overnight at 4°C. On the second day, wash with PBS for 5 min*3 times, add fluorescent secondary antibody at a 1:200 dilution ratio, and incubate at room temperature for 1 h; wash with PBS for 5 min*3 times.

[0192] (5) Mounting and photographing: Remove residual liquid, add mounting medium (containing DAPI) to immerse the sample area, add coverslip, and mount with nail polish; preserve the slide at -20℃ and take pictures and record using a high-content imaging system.

[0193] 2. Changes in the pancreatic β / α cell ratio:

[0194] Using the immunofluorescence staining method described above, glucagon antibody was used to label pancreatic α cells and insulin antibody was used to label pancreatic β cells. At least 1000 positive cells were counted for each mouse, and the changes in the ratio of pancreatic β cells to α cells were calculated in βwb16 ko mice and wb16 fl / fl mice.

[0195] 3. Measurement of mouse pancreatic β-cell mass:

[0196] After dewaxing and hydrating the paraffin sections of the pancreas, β cells were labeled with insulin antibody, and the cell nuclei were stained with hematoxylin for 3-8 min, followed by rinsing with tap water. The cytoplasm was stained with eosin for 1-3 min, followed by rinsing with tap water. The sections were then placed in 95% ethanol I for 5 min, 95% ethanol II for 5 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, xylene I for 5 min, and xylene II for 5 min to dehydrate and clear the sections. After removing and slightly drying the sections, they were mounted with neutral resin.

[0197] 4. Detection of pancreatic β-cell size, proliferation, and apoptosis:

[0198] Using the above immunofluorescence staining method, β-catenin antibody was used to identify cell membranes, Ki67 / Tunel was used to label proliferating / apoptotic cells, and insulin antibody was used to label pancreatic β cells. After taking pictures and recording, ImageJ software was used to measure cell area, and Photoshop software was used to count the number of insulin-Ki67 and insulin-Tunel double positive cells and insulin-labeled pancreatic β cells. The proliferation rate and apoptosis rate of pancreatic β cells were calculated.

[0199] Based on the results of transcriptome analysis, we conducted mechanistic validation experiments in pancreatic tissue sections. Figure 8 The results presented by AB showed that specific knockout of the wbscr16 gene led to a decrease in the ratio of pancreatic β cells to α cells, which may indicate a reduction in the number of pancreatic β cells and a relative increase in the number of α cells. Immunohistochemical assessment of pancreatic β cell quality revealed a significant decrease in the mass of pancreatic β cells in βwb16 knockout mice. Figure 8 CD). Furthermore, compared to control mice, βwb16 ko mice showed a significant reduction in pancreatic β-cell size (CD). Figure 8 EF). Using Ki67 and TUNEL staining to label proliferating and apoptotic cells, it was found that wbscr16 gene knockout mouse pancreatic β cells showed a trend of decreased proliferation and increased apoptosis. Figure 8 These findings suggest that WBSCR16 is crucial for maintaining the number and function of pancreatic β cells.

[0200] Example 6

[0201] Wbscr16 knockout specifically into pancreatic β cells leads to impaired mitochondrial function in pancreatic β cells.

[0202] ATP level measurement: Measured using an ATP assay kit (Beyotime).

[0203] (1) Isolate mouse primary pancreatic islets, add 200 μL of cell lysis buffer, centrifuge at 12000 g for 5 min at 4 °C, and retain the supernatant.

[0204] (2) Prepare ATP standard solutions and set concentration gradients of 0.01, 0.03, 0.1, 0.3, 1, 3 and 10 μM.

[0205] (3) Add 100 μL of ATP detection working solution to the detection well and let it stand at room temperature for 5 min.

[0206] (4) Add 20 μL of sample or standard to each well, mix quickly with a pipette, and measure the RLU value using a chemiluminescence analyzer after at least 2 seconds. Convert the ATP units to nM according to the standard curve.

[0207] (5) Perform protein quantification normalization on the remaining samples and convert the units to nmol / mg protein.

[0208] The WBSCR16 protein, as a guanine nucleotide exchange factor (GEF), plays a crucial role in mitochondrial fusion, a key process for maintaining mitochondrial function and cellular energy metabolism. Therefore, we analyzed whether specific knockout of the WBSCR16 gene would affect mitochondrial function by measuring ATP levels and examining changes in mitochondrial genes and pathways. Figure 9 As shown in Figure A, specific knockout of Wbscr16 in pancreatic β-cells led to a significant decrease in ATP levels. In terms of mitochondrial signaling pathways, major pathways such as metabolism, mitochondrial dynamics and surveillance, oxidative phosphorylation (OXPHOS), protein homeostasis, and small molecule transport were altered. Therefore, we investigated whether specific knockout of the Wbscr16 gene in pancreatic β-cells affects mitochondrial function by measuring ATP levels and analyzing changes in mitochondrial genes and related signaling pathways. Figure 9 As shown in Figure A, specific knockout of the WBSCR16 gene in pancreatic β cells led to a significant decrease in ATP levels. Furthermore, analysis of mitochondrial signaling pathways revealed alterations in key pathways including metabolism, mitochondrial dynamics and surveillance, oxidative phosphorylation (OXPHOS), protein homeostasis, and small molecule transport. These findings indicate that the WBSCR16 protein is crucial for mitochondrial function.

[0209] Example 7

[0210] Predict and screen drugs that can target WBSCR16.

[0211] Potential therapeutic compounds targeting the Wbscr16 gene were predicted using the DSigDB database. The Drug SIGnatures Database is a novel gene set resource that links drugs / compounds with their target genes for gene set enrichment analysis. Results showed that rifabutin (PubChem CID 155802577), vorinostat (PubChem CID 5311), and theophylline (PubChem CID 2153) were the three most important compounds associated with the Wbscr16 gene (Table 1 and 2010). Figure 10 ( ), which can be used as a potential drug for treatment targeting Wbscr16.

[0212] Table 1. Drug prediction using DSigDB

[0213]

[0214] The above examples demonstrate that WBSCR16 is differentially expressed in the pancreatic islets of diabetic and normal mice, suggesting its potential as a target for intervention in type 2 diabetes. Furthermore, this invention, through the construction of a mouse model with WBSCR16 knockout specifically targeting pancreatic β-cells, found that the deletion of the WBSCR16 gene leads to pancreatic β-cell dysfunction, thereby affecting blood glucose regulation and potentially contributing to the development of diabetes. Its mechanism of action may involve WBSCR16 protein altering mitochondrial function, leading to pancreatic β-cell dysfunction and even death. Therefore, the WBSCR16 protein disclosed in this invention can serve as a potential therapeutic target for the treatment of type 2 diabetes.

[0215] The above embodiments illustrate and describe the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.

Claims

1. The use of WBSCR16 protein as a target in the preparation of drugs for the treatment of diabetes.

2. The use of reagents that regulate WBSCR16 protein expression in the preparation of drugs for treating diabetes.

3. A method for constructing a Wbscr16 pancreatic β-cell-specific knockout mouse model, characterized in that, Includes the following steps: 1) Gene targeting vector construction: Design and construct a gene targeting vector containing the LoxP site and the homologous sequence of the wbscr16 gene; 2) ES cell transfection and screening: Gene targeting vectors are introduced into ES cells by electroporation or microinjection, and ES cell clones that have successfully undergone homologous recombination are screened by positive and negative selection. 3) The above ES cells were injected into C57BL / 6 embryos and then re-implanted into CD-1 pseudopregnant female mice to generate chimeric mice; 4) Male offspring were mated with wild-type C57BL / 6 female mice after coat color identification, and homozygous wbscr16 flox / flox genotype mice were screened by genotyping. 5) The wbscr16 flox / flox genotype mice were further crossbred with inscre mice, and the pancreatic β-cell-specific knockout wbscr16 mice, namely βwb16 ko mice, were screened out by genotype identification.

4. The construction method according to claim 4, characterized in that, The nucleic acid sequence of the wbscr16 gene in step 1) is shown in SEQ ID NO.

1.

5. The construction method according to claim 4, characterized in that, The genotype identification in step 4) includes the following primers: LoxP PCR primers: LoxP-F(F1):5'-CTGAGTAAGTTGCATGAGTCGGG-3' LoxP-R(R1):5'-GCTGAGATCTGTCTGGCATGGCT-3'; Neo deletes PCR primers: Neo-del-F(F2):5'-AGCTGCTGTTTTGCCGACCTGGAA-3' Neo-del-R(R2):5'-GGAGATCAGGGGACAAGTTCAAAGA-3'.

6. The construction method according to claim 4, characterized in that, The genotyping identification in step 5) includes the following primers: The following PCR identification primers are used to differentiate between Wbscr16 flox / flox, Wbscr16 flox / +, and WT: Wbscr16-flox-F1:5'-GTTTCTTCTTGGTCACAACCACTA-3' Wbscr16-flox-R1:5'-GGTATCTTGTACACTCAGTGATGGG-3'; Identification primers to distinguish between positive and negative Ins2 cre: Ins2 cre-F: 5'-ACTCCAAGTGGAGGCTGAGA-3' Ins2 cre-R: 5'-TCCTTCCACAAACCCATAGC-3'.

7. Use of the mouse model construction method as described in any one of claims 4-6 in the study / preparation of a medicament for treating diabetes.

8. The use according to claim 8, characterized in that, The drug is a drug that can act on the WBSCR16 target.

Images