Bursaphelenchus xylophilus effect factor BxEF1 and application thereof as well as method and preparation for preventing and treating bursaphelenchus xylophilus

Abstract

The invention discloses a bursaphelenchus xylophilus effect factor BxEF1 and application thereof as well as a method and a preparation for preventing and controlling bursaphelenchus xylophilus. Researches show that the BxEF1 is positioned in the middle esophageal ball and gonad of the pine wood nematodes, is highly expressed in the early stage of invasion of the pine wood nematodes, and can cause tobacco cell necrosis. After the BxEF1 is silenced, the activity, the feeding speed and the pathogenicity of the pine wood nematodes are obviously reduced. The Pinus tabulaeformis defensive protein PtTHESEUS1 can recognize BxEF1, trigger response of salicylic acid in vivo and activate autoimmunity. The invention discloses a molecular mechanism of interaction between the pine wood nematode and the host in a pathogenic process, and has important significance on research on occurrence and prevention and treatment of pine wood nematode diseases.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering control technology for pine wood nematodes, specifically involving the pine wood nematode effector BxEF1 and its application, as well as methods and preparations for controlling pine wood nematodes. Background Technology

[0002] Pinus tabuliformis, a tree species endemic to China, is distributed across several provinces. Many parts of the pine have medicinal value: pine needles have blood-activating and calming effects, pine cones can dispel cold and relieve constipation, and pine pollen can stop bleeding. Furthermore, the pine is used in construction, shipbuilding, and furniture making, resulting in significant economic value. However, due to the invasion of pine wilt nematodes, most pine trees in my country have died from pine wilt disease, causing incalculable economic losses.

[0003] Plants have evolved complex immune systems to combat pathogen invasion. Plant innate immunity operates on two levels. The first level involves pattern recognition receptors on the plant cell surface recognizing conserved molecular patterns or damage-associated molecular patterns of pathogens; this is called pathogen-associated molecular pattern-triggered immunity (PTI). PTI can resist the invasion of most pathogens. To counteract the plant's PTI response, pathogens have evolved effector factors, which are secreted into plant cells, inhibiting the PTI response and weakening the plant's defenses. Plants have also evolved immune strategies to counteract pathogen effector factors. Plants utilize leucine-rich repetitive immune receptors at nucleotide-binding sites within cells to sense effector factors secreted by pathogens, thereby generating an immune response; this is called effector-triggered immunity (ETI).

[0004] The pine wood nematode (Bursaphelenchus xylophilus) is a migratory endoparasitic nematode and one of the main invasive pests causing pine wilt disease (PWD). Since its introduction to Asia and Europe in the early 20th century, the pine wood nematode has thrived in environments highly suitable for its growth. The presence of crustaceans provides a suitable vector for its spread, leading to its rapid proliferation and significant damage to local forestry. The pine wood nematode's life cycle consists of two stages: a phytoparasitic stage and a fungal parasitic stage. In the phytoparasitic stage, the nematode invades the xylem of pine trees, feeding on the wood and disrupting the transport of water and other nutrients, ultimately causing the tree's death. After the tree dies, the nematode enters the fungal parasitic stage, infecting crustaceans and feeding on fungi in the dead tree. It then migrates to other pine trees via the pine sawyer beetle to begin a new round of parasitism. Although it is now known that pine wilt nematode is one of the main culprits causing pine wilt disease, the specific mechanisms of interaction between pine wilt nematode and its host are still unclear. Summary of the Invention

[0005] The primary objective of this invention is to provide the effector protein BxEF1 from the pine wood nematode and its applications. Studies show that BxEF1 is located in the midesophageal bulb and gonads of the pine wood nematode, is highly expressed in the early stages of nematode invasion, and is virulent, capable of inducing tobacco cell necrosis. Silencing BxEF1 significantly reduces the activity, feeding rate, and pathogenicity of the pine wood nematode, but does not affect its reproductive capacity. The pine defense protein PtTHESEUS1 can recognize BxEF1, triggering a salicylic acid response and activating autoimmunity. This reveals the molecular mechanism of the interaction between the pine wood nematode and its host during pathogenicity, which is of great significance for the research and prevention of pine wood nematode disease.

[0006] The pine wood nematode effector BxEF1 described in this invention has the amino acid sequence shown in SEQ ID NO.1 and the nucleotide sequence shown in SEQ ID NO.2.

[0007] The BxEF1 is located in the midesophageal bulb and gonads of pine wood nematode, and is highly expressed in the early stage of pine wood nematode invasion, and can cause tobacco cell necrosis.

[0008] It was also discovered that the pine defense protein PtTHESEUS1 can recognize BxEF1, triggering a salicylic acid response in the body and activating the autoimmune system.

[0009] This invention also provides the application of the pine wilt nematode effector BxEF1, silencing BxEF1 to control pine wilt nematodes.

[0010] Silencing BxEF1 reduced the activity, feeding rate, and pathogenicity of pine wood nematodes.

[0011] Specifically, BxEF1 is silenced using RNA interference, with the interference sequence shown in SEQ ID NO.3.

[0012] The present invention also provides a method for controlling pine wood nematode, namely silencing BxEF1 expression.

[0013] Specifically, BxEF1 is silenced using RNA interference, with the interference sequence shown in SEQ ID NO.3.

[0014] The present invention also provides a preparation for controlling pine wood nematode, namely a reagent for silencing BxEF1 expression.

[0015] Specifically, it refers to reagents that silence BxEF1 expression, including RNA interference reagents, with the interference sequence shown in SEQ ID NO.3.

[0016] This invention utilizes RNA from pine wood nematodes to obtain the pine wood nematode effector gene BxEF1 via PCR cloning technology. Studies have shown that BxEF1 is located in the midesophageal bulb and gonads of the pine wood nematode, with the highest expression level 24 hours after nematode invasion. It is also located in the cytoplasm and nucleus and can induce necrosis in tobacco cells. Experimental results indicate that silencing BxEF1 significantly reduces the activity, feeding rate, and pathogenicity of the pine wood nematode. Furthermore, the *Pinus tabuliformis* molecule *PtTHESEUS1* can recognize BxEF1, thereby activating its own immune system. This invention elucidates the molecular mechanism of the interaction between the pine wood nematode and its host during pathogenicity, which is of great significance for the research and prevention of pine wood nematode disease. Attached Figure Description

[0017] Figure 1 Yeast double hybridization verifies the interaction between PtTHESEUS1 and BxEF1;

[0018] Figure 2 In situ hybridization of BxEF1, an effector protein of pine wood nematode;

[0019] Figure 3 Expression levels of BxEF1 at different time points after *Pinus tabuliformis* invasion;

[0020] Figure 4 Subcellular localization of BxEF1 in tobacco;

[0021] Figure 5 BxEF1 can induce necrosis in tobacco Benzodiazepine cells;

[0022] Figure 6 The amount of BxEF1 expressed after being silenced;

[0023] Figure 7Changes in nematode activity after BxEF1 is silenced;

[0024] Figure 8 Changes in the rate at which nematodes feed on Botrytis cinerea after BxEF1 is silenced;

[0025] Figure 9 Changes in the reproductive capacity of nematodes after BxEF1 is silenced;

[0026] Figure 10 Changes in the pathogenicity of nematodes to Pinus tabuliformis after BxEF1 was silenced;

[0027] Figure 11 The effect of BxEF1 silencing on PtTHESEUS1 expression in Pinus tabuliformis after nematode invasion;

[0028] Figure 12 The effect of BxEF1 silencing on the expression levels of PAL and ICS, SA-related genes in Pinus tabuliformis, after nematode invasion;

[0029] Figure 13 The effect of BxEF1 silencing on the expression level of the SA receptor NPR1 in Pinus tabuliformis after nematode invasion;

[0030] Figure 14 The effect of BxEF1 silencing on the expression level of SOD, a reactive oxygen species-related gene in Pinus tabuliformis, after nematode invasion. Detailed Implementation

[0031] The following examples are intended to further illustrate the present invention, but not to limit it.

[0032] 1. In situ hybridization experiment of the effector BxEF1 of pine wood nematode

[0033] Using yeast library screening technology, the candidate effector BxEF1 of the pine wood nematode PtTHESEUS1 was screened, and the interaction between PtTHESEUS1 and BxEF1 was verified using yeast two-hybrid technology. PtTHESEUS1 and BxEF1 were constructed into BD and AD vectors, respectively, transformed into yeast, and plated on SD / -Leu-Trp solid medium. After overnight incubation at 28°C, single yeast colonies were mixed with water and added dropwise to SD / -Leu-Trp and SD / -Leu-Trp-His (5mM 3-AT) solid medium, respectively, and incubated overnight at 28°C.

[0034] The results are as follows Figure 1As shown, all yeasts can grow on SD / -Leu-Trp medium, but only yeasts containing both PtTHESEUS1 and BxEF1 can grow on SD / -Leu-Trp-His (5mM 3-AT) medium, which proves that there is an interaction between PtTHESEUS1 and BxEF1.

[0035] The in situ hybridization probe for BxEF1 was synthesized using the DIG-High Prime DNA Labeling and Detection Starter Kit Ⅰ (Roche). The primer sequences for the synthesized probe are as follows: upstream primer: ATGGGTAAGGAAAAGGTCCA; downstream primer: CTTGATAAAATCACGATGGC. The specific steps are as follows: First, nematodes were fixed with 4% paraformaldehyde at room temperature and 4°C for 24 h, respectively, and then washed with M9 buffer. Subsequently, the nematodes were treated with proteinase K (0.5 mg / mL), formaldehyde, and acetone, respectively. After washing with M9 buffer, the nematodes were treated with hybridization solution at 55°C for 1 h, followed by the addition of the hybridization probe and incubation at 55°C in the dark for 18 h. After washing with maleic acid, the nematodes were treated with blocking solution at 22°C for 30 min, washed again with maleic acid, and then treated with chromogenic solution at 4°C in the dark for 16 h. Finally, after washing with M9 buffer, the nematodes were observed and photographed under a Zeiss microscope.

[0036] The results are as follows Figure 2 BxEF1 is expressed in the midesophageal bulb and gonads of *Pinus pineus*, indicating that BxEF1 conforms to the characteristics of an effector.

[0037] 2. Expression analysis of BxEF1 at different time points after pine wood nematode invasion of Pinus tabuliformis.

[0038] A wound was made on a segment of Pinus tabuliformis stem, and 30,000 nematodes were introduced into the wound to infect the pine. The stem segment was removed at 12h, 24h, 3d, 6d, and 9d, and the nematodes were collected using the Bellman funnel method. RNA was extracted from the pine wood nematodes according to the instructions of the Takara RNAiso Plus kit. The RNA was reverse transcribed into cDNA according to the instructions of the Takara PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect RealTime) kit.

[0039] RT-qPCR amplification was performed using specific primers BxEF1-qPCR-F / R with the FP217-FastReal rapid real-time RT-qPCR reagent from Tiangen Biotech, following the kit's instructions. The primer sequences are as follows: BxEF1-qPCR-F: ATCTCCGTCAAGGACATCCG; BxEF1-qPCR-R: GGTCAACCTTCTCCTTGAGCT. Experimental results were reported according to a 2... -△△Ct The calculations were repeated three times.

[0040] The results are as follows Figure 3 As shown, BxEF1 expression was highest 24 hours after the pine wilt nematode invaded Pinus tabuliformis, indicating that BxEF1 plays a role in the early stage of pine wilt nematode invasion of Pinus tabuliformis.

[0041] 3. Subcellular localization of BxEF1 in tobacco

[0042] Using cDNA from *Pinus wiltii* as a template, specific primers were designed, and the BxEF1 gene was amplified by PCR using Takara's PrimeSTAR® MaxDNA Polymerase. The PCR amplification system consisted of 25 μL PrimeSTAR Max Premix (2X), 2 μL each of forward and reverse primers, 1 μL cDNA, and 50 μL ddH2O. The PCR conditions were: 98℃ for 10 sec, 55℃ for 5 sec or 15 sec, 72℃ for 5 sec / kb, and 30–35 cycles. The complete CDS sequence was ligated into a 1300GFP vector using Vazyme's Clone Express II One Step Cloning Kit. 10 μL of the ligation product was transformed into DH5α competent cells and cultured, then plated on LB agar containing kanamycin and incubated overnight at 37℃. Single colonies were picked, cultured overnight on LB liquid medium containing kanamycin, and sent to BGI Genomics for sequencing. The plasmid BxEF1-1300GFP was extracted using a plasmid miniprep kit from Tiangen Biotech. 2 μL of the plasmid was added to GV3101 Agrobacterium competent cells. The cells were then incubated sequentially on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, incubated at 37°C for 5 min, and then on ice for 5 min. LB broth was added and cultured at 28°C for 2 h. The cells were then plated onto LB solid medium containing rifampin and kanamycin and incubated for 2 days. Single colonies were picked for PCR identification.

[0043] Add BxEF1-1300GFP Agrobacterium to liquid medium containing rifampin and kanamycin and incubate overnight at 28°C with shaking. Centrifuge at 4000 rpm for 10 min, wash and resuspend the cells using tobacco osmosis buffer (10 mM MES, 10 mM MgCl2 and 150 μM AS). Adjust the OD of the bacterial suspension to 0.5% using a spectrophotometer. 600 =0.6, and the bacterial solution was injected into the leaves of Nicotiana benthamiana using a 1mL syringe, with GFP as a control. The mixture was treated overnight in darkness at 25°C, followed by 24 hours of light exposure at 25°C, and then fluorescence was observed under a laser confocal microscope (Zeiss).

[0044] The results are as follows Figure 4 As shown, tobacco leaves injected with BxEF1-1300GFP exhibit fluorescence in both the cell membrane and nucleus, indicating that BxEF1 is localized in both the cell membrane and nucleus.

[0045] 4. Transient expression of BxEF1 in tobacco

[0046] BxEF1 was constructed into the pDT1 vector using the method described above, and then transformed into GV3101 competent cells. BxEF1-pDT1 was injected into tobacco using the same method, with pDT1 empty vector as a negative control and Bax as a positive control. Disease development in tobacco was observed after 2 days of culture.

[0047] The results are as follows Figure 5 As shown, the unloaded pDT1 did not induce tobacco cell death, but both BxEF1-pDT1 and Bax induced disease in tobacco. This suggests that BxEF1 may be a toxic effector capable of damaging plant cells.

[0048] 5. In vitro silencing of BxEF1 to verify its effect on the parasitic process of pine wood nematode.

[0049] Specific interference primers were designed based on the conserved CDS sequence of BxEF1. The primer sequences are as follows: BxEF1-RNAi-F: TAATACGACTCACTATAGGGCCACATCAACATTGTCGTTATCG; BxEF1-RNAi-R: TAATACGACTCACTATAGGGAAGCAACGACCAAGACAGCA. The PCR amplification system described above and the Promega T7 RiboMAX were used. TMThe Express RNAiSystem kit amplified the BxEF1 interference fragment dsBxEF1 (sequence shown in SEQ ID NO.3). Approximately 10,000 pine wood nematodes were immersed in dsBxEF1 interference solution (final concentration 800 ng / μL), while the control group was treated with GFP dsRNA. All RNAi reactions were incubated at 25°C and 200 rpm for 36 h. After the RNAi reaction, the nematodes were washed three times with sterile water, and RNA was extracted from the nematodes according to the above method for RT-qPCR detection.

[0050] The results are as follows Figure 6 As shown, compared with the control group, the expression level of BxEF1 in pine wood nematodes was significantly reduced after treatment with dsBxEF1, with an interference efficiency of 50%. The number of swings per minute of the interfered pine wood nematodes was observed under a microscope, and the results are as follows. Figure 7 As shown, the oscillation frequency of BxEF1 decreased significantly after being silenced, which proves that BxEF1 affects the activity of pine wood nematode.

[0051] Approximately 500 disturbed pine wood nematodes were added to a Botrytis cinerea agar plate, and the feeding area of ​​the pine wood nematodes was observed daily. After 9 days, the Botrytis cinerea agar plate was chopped up, and the pine wood nematodes on the plate were collected using the Bellman funnel method and counted under a microscope.

[0052] The results are as follows Figure 8 and Figure 9 As shown, the feeding rate of BxEF1 on Botrytis cinerea decreased significantly after BxEF1 was silenced, indicating that BxEF1 plays an important role in the fungal parasitic stage of pine wood nematode. The reproduction rate of pine wood nematode did not change significantly after BxEF1 was silenced, suggesting that BxEF1 may not affect the reproductive capacity of pine wood nematode.

[0053] Make a cut in the stem of a Pinus tabuliformis, and add about 3,000 disturbed Pinus wilt disease nematodes to the wound. Observe the disease situation of the Pinus tabuliformis every day.

[0054] The results are as follows Figure 10 As shown, after BxEF1 was disturbed, the onset time of pine disease slowed down and the toxicity of pine wood nematode to pine was reduced, indicating that BxEF1 also plays an important role in the phytoparasitic stage of pine wood nematode.

[0055] 6. In vitro silencing of BxEF1 to verify its effect on the resistance gene in Pinus tabuliformis.

[0056] After the BxEF1-disrupted pine wood nematode invaded *Pinus tabuliformis*, total RNA was extracted from *Pinus tabuliformis* using the RNAprep Pure polysaccharide-polyphenol plant total RNA extraction kit from Tiangen Biotech and reverse transcribed into cDNA. Based on the *Pinus tabuliformis* cDNA, specific RT-qPCR primers for PtTHESEUS1 (PtTHE1), PAL, ICS, NPR1, and SOD were designed, and RT-qPCR detection was performed according to the above method. The primers are as follows: PtTHE1-qPCR-F:ATGATCAGTCCGAGGATGGG;PtTHE1-qPCR-R:ACGAATCCGCCTCAAAGATC PAL-qPCR-F:ATGGTTGCAGCAGCAGAAAT;PAL-qPCR-R:GCAACGTCTGAGATTGTCAGAG ICS-qPCR-F:ATGTATGCTGGACCTGTGGG;ICS-qPCR-R:GCCTTCAGGTCAAGTTCTTGCC NPR1-qPCR-F:CCCAGTTCTCCCCAAGCTTC;NPR1-qPCR-F:TAAGTTTTTTCAAGGGCGGCG SOD-qPCR-F:CACTTCCGCTACTTCCATTGG;SOD-qPCR-F:AGTGCAACTGTTGGTGGAGCA

[0057] The results are as follows Figure 11-14 As shown, after BxEF1 was interfered with, the expression level of PtTHE1 in Pinus tabuliformis decreased significantly. At the same time, the expression levels of two important genes in the SA synthesis pathway, PAL and ICS, as well as the SA receptor gene NPR1, also decreased significantly. This indicates that BxEF1 invasion of Pinus tabuliformis caused an SA response in the plant. Meanwhile, the expression level of SOD also decreased significantly, which further illustrates that BxEF1 can activate the immune response of Pinus tabuliformis.

Claims

1. The pine wood nematode effector BxEF1, characterized in that, The amino acid sequence is shown in SEQ ID NO.

1.

2. The pine wood nematode effect factor BxEF1 according to claim 1, characterized in that, BxEF1 is located in the midesophageal bulb and gonads of pine wood nematode, and is highly expressed in the early stages of pine wood nematode invasion, and can induce tobacco cell necrosis.

3. The pine wood nematode effect factor BxEF1 according to claim 1, characterized in that, The pine defense protein PtTHESEUS1 can recognize BxEF1, triggering a salicylic acid response in the body and activating the autoimmune system.

4. The application of the pine wood nematode effector BxEF1, characterized in that, Silent BxEF1 controls pine wilt disease.

5. The application according to claim 4, characterized in that, Silencing BxEF1 reduced the activity, feeding rate, and pathogenicity of pine wood nematodes.

6. The application according to claim 4 or 5, characterized in that, BxEF1 was silenced using RNA interference.

7. A method for controlling pine wilt disease, characterized in that, Silent BxEF1 expression.

8. The method according to claim 7, characterized in that, BxEF1 was silenced using RNA interference.

9. A preparation for controlling pine wood nematode, characterized in that, Reagents for silencing BxEF1 expression.

10. The formulation according to claim 9, characterized in that, Reagents that silence BxEF1 expression include RNA interference reagents.

Images