A snp molecular marker related to pig backfat thickness and application thereof

Abstract

The application belongs to the technical field of molecular genetics, and provides a SNP molecular marker related to pig backfat thickness and application thereof. The application studies and determines that the pig backfat thickness related molecular marker is located at the 9558333th site of chromosome 18 in the international pig reference genome 11.1 version (corresponding to the 701th base A / G mutation of SEQ ID NO:1), and verifies the influence effect on the pig backfat thickness. When the base of the site is A, the pig has lower backfat thickness. Based on this, the application establishes a molecular marker assisted selection breeding technology for rapidly improving the pig backfat thickness, and the frequency of the advantageous allele (A) can be increased generation by generation, the backfat thickness of the breeding pig is significantly reduced, the genetic improvement process of the commercial pig population containing the bloodline of the Landrace pig and the Large White pig is accelerated, the breeding efficiency is improved, the sales profit of the enterprise is increased, the core competitiveness is improved, and the economic benefit of the commercial pig is improved.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular genetics, and particularly relates to a SNP molecular marker related to pig backfat thickness and application thereof. BACKGROUND

[0002] Pigs are key species in China's animal husbandry and an important source of animal protein for residents. In recent years, with the change in residents' dietary patterns and the improvement of health awareness, the pork consumption market has undergone structural changes, and consumers' demand for lean pork products with "high protein and low fat" has surged, making the study of pig backfat thickness, an important trait, increasingly critical in the field of animal science. Pig backfat thickness, as a core trait indicator of pig carcass, is mainly composed of lipid components such as triglyceride (TG), and its value directly reflects the level of pig fat deposition. It is not only an important economic trait but also has complex quantitative genetic characteristics, directly affecting the economic benefits of pig breeding industry and has become the core breeding goal of commercial pig genetic improvement.

[0003] In the field of animal genetic improvement, single nucleotide polymorphism (SNP) as an important genetic variation refers to the single base difference at the same nucleotide site of different individual genomic DNA sequences caused by base substitution (such as C / T or G / A type) or base transversion (such as C / G, C / A, T / A or T / G type). Based on the SNP genetic marker system, the efficiency and accuracy of animal breeding programs are significantly improved with the help of marker-assisted selection technology. In recent years, the SNP-based molecular marker technology system has been continuously improved, providing a new genome selection strategy for the field of animal breeding and promoting the innovation of traditional breeding methods towards precision and efficiency. At the same time, genome-wide association study (GWAS) as a core method for analyzing the genetic mechanism of complex quantitative traits provides an important genetic basis for molecular marker-assisted selection breeding by screening genetic variation sites significantly associated with target traits on the whole genome scale.

[0004] However, although researchers have found multiple molecular markers significantly associated with pig backfat thickness, these markers generally have population specificity, and their stability and applicability need to be verified by multiple populations. This situation restricts the in-depth analysis of the genetic mechanism of pig backfat thickness and limits the development and implementation of precise and efficient breeding strategies. Therefore, the present application provides a SNP molecular marker related to pig backfat thickness and application thereof. SUMMARY

[0005] The present application aims to provide a SNP molecular marker related to pig backfat thickness and application thereof, and aims to solve the problems in the background art.

[0006] The present application is achieved by the following technical solutions.

[0007] A SNP molecular marker related to pig backfat thickness, which is located at the 9558333th site on chromosome 18 of the international pig reference genome version 11.1, the sequence of the SNP molecular marker is shown in SEQ ID NO:1, the site has an A / G allele mutation (the 701th base from the 5' end of the sequence shown in SEQ ID NO:1 is A or G), and the base polymorphism of the site causes the difference in pig backfat thickness.

[0008] A method for screening pig breeds with low backfat thickness, comprising the following steps:

[0009] Detecting the genotype of the SNP molecular marker of the pig to be tested, and selecting individuals with AA genotype at the site as breeding pigs;

[0010] The pig breed is a commercial pig population containing long white pig and large white pig bloodlines.

[0011] A method for pig molecular marker assisted breeding, comprising the following steps:

[0012] Detecting the genotype of the SNP molecular marker of the pig to be tested, and preferentially selecting individuals with AA genotype for breeding to breed pigs with lower backfat thickness.

[0013] The pig breed is a commercial pig population containing long white pig and large white pig bloodlines.

[0014] Further, the step of detecting the genotype of the SNP molecular marker comprises:

[0015] Step 1: Genomic DNA extraction;

[0016] Genomic DNA is extracted from the pig sample to be tested using standard molecular biology techniques;

[0017] Step 2: Target region PCR amplification;

[0018] The genomic DNA of the pig to be tested is subjected to PCR amplification using a primer pair with nucleic acid sequences shown in SEQ ID NO:2 and SEQ ID NO:3, and an amplification product covering the target genomic region is obtained;

[0019] Step 3: Sanger sequencing analysis;

[0020] The PCR amplification product is subjected to Sanger sequencing;

[0021] Step 4: SNP genotype determination;

[0022] Based on the sequencing results, the genotype of the SNP molecular marker in the pig to be tested is determined.

[0023] A method for genetic improvement of pigs, comprising the following steps:

[0024] The genotype of the SNP molecular marker as described above in the core group of breeding pigs is determined, breeding pig individuals with AA and AG genotypes are selected, and breeding pig individuals with GG genotype are eliminated, so as to increase the frequency of allele A in the population from generation to generation, thereby reducing the backfat thickness of the offspring pigs.

[0025] The pig breed is a commercial pig population containing the bloodlines of Landrace and Large White.

[0026] The application of a primer pair for detecting the SNP molecular marker as described above in identifying pig backfat thickness-related traits, screening pig breeds with low backfat thickness traits, or reducing pig backfat thickness to improve pig lean meat rate, the nucleic acid sequences of the primer pair are shown in SEQ ID NO: 2 and SEQ ID NO: 3; wherein the backfat thickness of the AA genotype is lower than that of the GG and GA genotypes.

[0027] The pig breed is a commercial pig population containing the bloodlines of Landrace and Large White.

[0028] The application of a kit for detecting the SNP molecular marker as described above in identifying pig backfat thickness-related traits, screening pig breeds with low backfat thickness traits, or reducing pig backfat thickness to improve pig lean meat rate, the kit comprising a primer pair with nucleic acid sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3; wherein the backfat thickness of the AA genotype is lower than that of the GG and GA genotypes.

[0029] The pig breed is a commercial pig population containing the bloodlines of Landrace and Large White.

[0030] Compared with the prior art, the present application has the following beneficial effects:

[0031] 1. The present application researches and determines that the pig backfat thickness-related molecular marker is located at the 9558333th position of chromosome 18 of the international pig reference genome version 11.1 (corresponding to the 701th base A / G mutation of SEQ ID NO: 1), and verifies its influence effect on pig backfat thickness traits. When the base at this position is A, the pig has lower backfat thickness. Based on this, the present application establishes a molecular marker-assisted selection breeding technology for rapidly improving pig backfat thickness traits, which can increase the frequency of the advantageous allele (A) from generation to generation, significantly reduce the backfat thickness of breeding pigs, and accelerate the genetic improvement process. This technology greatly improves the breeding efficiency of commercial pig populations containing the bloodlines of Landrace and Large White, increases sales profits for enterprises, and enhances core competitiveness.

[0032] 2. The application constructs a pig breeding system based on SNP molecular marker assisted selection (MAS) of target, preferentially screens the advantageous allele (A) of the target site (18:9558333) for commercial pig populations containing the bloodlines of Landrace and Large White, and accelerates the genetic progress of the pig population. Through systematic application of the technology, the economic benefits of breeding of breeding pigs can be significantly improved, and ultimately the economic benefits of commercial pigs can be improved. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 Figure 1 is a whole genome association (GWAS) analysis diagram of commercial pig populations containing the bloodlines of Landrace and Large White on the backfat thickness trait on chromosome 18; wherein: the abscissa represents the chromosome number of the pig; the ordinate represents the -log 10 ( p ).

[0034] Figure 2 Figure 4 is a box plot of the backfat thickness breeding value of individuals with different genotypes of SNP site 18:9558333.

[0035] Figure 3 Figure 5 is a result analysis diagram of the phenotypic differences of backfat thickness of pigs with different genotypes; wherein (A) is the AA genotype (single-peak T base); (B) is the GG genotype (single-peak C base); (C) is the AG genotype (double-peak C, T base). DETAILED DESCRIPTION

[0036] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present application, the technical solutions of the present application will be described in detail below, but it cannot be understood as limiting the scope of implementation of the present application.

[0037] The specific implementation of the present application will be described in detail in combination with specific examples below.

[0038] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0039] Experimental pig population: In this experiment, a commercial pig population containing the bloodlines of Landrace and Large White, a total of 439 individuals, was selected as the research object.

[0040] Example 1: Determination process of backfat thickness;

[0041] (1) Test materials;

[0042] The present application takes 439 commercial pig populations containing the bloodlines of Landrace and Large White as experimental objects. By slaughtering the 439 pigs, backfat thickness data is collected.

[0043] (2) Phenotypic trait determination;

[0044] After the pigs were slaughtered, the backfat thickness at the lumbar-sacral joint was measured using a vernier caliper, and the corresponding data were recorded.

[0045] (3) Sample collection;

[0046] The obtained pork tissue samples were immersed in an ethanol solution with a volume fraction of 75%, and then stored in a -20°C refrigerator for standby use.

[0047] Example 2: Invention process of genetic markers;

[0048] (1) Genomic DNA extraction: Genomic DNA was extracted from the pork tissue samples according to the standard operating procedures of the DNA extraction kit. The concentration and purity of the extracted DNA samples were detected using a UV spectrophotometer. The results showed that the concentration of the DNA was above 50 ng / μL, the purity A260 / 280 value was around 1.8-2.0, and the A260 / 230 ratio was around 1.7-1.9, which met the requirements for subsequent experiments. The extracted samples were stored in a -20°C refrigerator.

[0049] (2) Porcine whole-genome 50K SNP genotyping: The samples were genotyped using a 50K chip. The SNPs of autosomes were retained, and the obtained genotype data were quality-controlled using PLINK software, including removing SNPs with a minor allele frequency (MAF) < 5% and a genotyping rate < 90%. The missing genotypes were filled using BEAGLE (version 5.4; beagle.29Oct24.c8e.jar) software. Finally, 45,487 SNPs were retained for subsequent analysis.

[0050] (3) Whole-genome association analysis (GWAS): 439 commercial pigs containing bloodlines of Landrace and Large White pigs were used as the research objects. The phenotypes of the pig population were statistically analyzed, and the average value of their backfat thickness (BF) was 19.36 mm. The estimated value of the heritability (h 2 ) of this trait was 0.374, indicating that the backfat thickness trait was greatly affected by genetic factors and had the basis for improving the trait through molecular marker-assisted selection.

[0051] GWAS analysis was performed using the BLINK (Bayesian-information and Linkage-disequilibrium Iteratively Nested Keyway model) model in the GAPIT software package of R language, with the breeding value as the response variable. The top 3 principal components corresponding to the largest eigenvalues were used as covariates to control the population structure.

[0052] Three SNPs significantly associated with backfat thickness were determined by GWAS analysis, of which the QTL at nucleotide position 9558333 on chromosome 18 of the international pig reference genome version 11.1 (18:9558333, corresponding to the 701st base of the sequence of SEQ ID NO: 1 (A / G mutation), denoted as g.9558333 A>G) was the most significantly associated site (P=2.73x10 Figure 1 p -12 The average breeding value of AA genotype individuals at this site was -0.651, lower than that of AG (0.294) and GG (0.759) genotype individuals (Table 1). Boxplot analysis of the estimated breeding value of backfat thickness of individuals with different genotypes (AA, AG, GG) at this site by R software showed that the backfat thickness of AA genotype individuals was lower than that of GG and GA genotypes (Figure 1). Figure 2 These results indicated that the A allele was the dominant allele of the backfat thickness trait. This result showed that the molecular marker could significantly affect the backfat thickness trait of commercial pig populations containing Landrace and Yorkshire bloodlines, and through marker-assisted selection of this SNP site, the backfat thickness of the population could be reduced, and the breeding process of the pig backfat thickness trait could be accelerated.

[0053] Table 1 Correlation analysis of the SNP site 18:9558333 of the molecular marker with the backfat thickness trait

[0054]

[0055] Example 3: Amplification and sequencing of the target DNA sequence

[0056] (1) Primer design

[0057] The DNA sequence of SEQ ID NO: 1 on pig chromosome 18 was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). The SnapGene software was used to design primers, and the sequences are as follows:

[0058] P001-F: 5'-TCCATTTGCCTCGAGAAGTGGC-3' (as shown in SEQ ID NO: 2);

[0059] P002-R: 5'-GTCACTCCTCCAGGAACTGGT-3' (as shown in SEQ ID NO: 3);

[0060] The primer pair can be used for subsequent SNP genotype detection, providing a tool for molecular marker-assisted selection.

[0061] The DNA sequence of SEQ ID NO: 1 is as follows:​​

[0062] TCCATTTGCCTCGAGAAGTGGCCCTAGAAAAGGCAAAAAGACAAAAAATAAAATAAAAAAATAATCCATCCAGTCTATAGCATTTGATACAGCAGCACAAGCTGATCAAAGCAATATTATTTGGATGGGATAAATGTTTAAATGGGTGGACCTTGGGAGTTCCTGTTGTGGCTCAGCAGTAGTGAACCCAGCTAGTATCCATGAGGATGTGGGTTCAATTCCTGGCCTCACTTGATGGGTTAAATATGCAGCATTGCCATGAGCTGTGGCATAGGCTGGCAGCTGCAGCTCTGATTGACCCCTAGACTGGGAACTTCCATATGCTGCATGTGCAGCCCTAAGCAAAAGAAAAAAAAAGGGTGGACTTTAAGAAAGCAGATTGCCCTCCATAATATGGGTGGGCCTGACACAATCAGTTGATGGCCTTAAGAAAAAGACCAATCACTCTTGAGGAAGAGGGAAATCTGCCAGCAGACTGCCTTCAGGCTCGAGCTGCAACAGCAGCTCTTCCCTGGGTCTCCAGCCTATCAGCCTACCTTGCAGATTTTTGGCTTTGTCAAAAGCCAAATACACACACACACACACACACACACACAAAATTCAGGGGACGATGGGGACCCCCTAAAGTTTCATGAGCAGGTCAGTGTAGATCAGTGAGTTGTTTTAGGAAGATGCTCTGAGCTGAACTGGAGGAATGAGA r (A / G)ATCTAAAGCTTTGGAGAATTTCTGGTACTGAGGATTGTAAGAATCCAGGTGTGTGGCAGGAAGGAAGGAGGGGATGGAAGAAAGGGGTCAACAAGAAAAATAATTTTGGGGGGCTTCTTTTTTTTAGGGCTGCACCCTTGGCATATGGAAGTTCCCAGGCTAGGAGTCAAATCGGGGCTCCAGCTGCTGGCCTACGTCAGAGCCACAGCAATACCAGATCCGAGCCGAGTCTGCGACCTACACTACAGCTCCTGGCAATGCTGGATCCTTACCCCACTGAGCGAGGCCAGGGATCGAACCTGCATCCTCATGGATACTAGTCGGATTCGTTACAGCTGAGTCACGATGGGAACGCCAGAAAACCAATTTTAAAGAAAGAATTTATAGGGTCTGGTAAAGACTCTTTCTTATTCATTTGACTGAGGGTGAGGGGAGGCATTTCAGTAAAGTCCCAGTGGTGCAAACTGCATTCCAGGGGTTGGGGAGTGATGGATAATGAGGAAATGGTACCCAAGCTCCTCGTGGAAGAAAAGGATGACTAGACCAGTTCCTGGAGGAGTGAC.

[0063] Note: The mutation site is marked with r and underlined, and the alleles (A / G) are in parentheses. The primer design position is shown in bold at the beginning and end of the sequence.

[0064] (2) PCR amplification;

[0065] A 25 μL reaction system was used: DNA template 2 μL, double distilled water 8 μL, 2×Phanta Flash Master Mix 13 μL, primer P001-F and P002-R each 1 μL. The PCR reaction conditions were: 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 62℃ annealing for 5s, 72℃ extension for 7s, 30 cycles, finally 72℃ extension for 1 min, and preservation at 4℃.

[0066] (3) DNA sequencing;

[0067] The gene fragment was subjected to reverse single reaction sequencing, and the measured sequence was compared with the NCBI genome sequence to obtain the mutation of the corresponding SNP site. Since it was reverse sequencing, if the sequencing detection result of site g.9558333 was single-peak T base, such as Figure 3If the site is detected as shown in (A), the genotype of the individual is AA; if the site is detected as shown in (B), the genotype of the individual is GG; and if the site is detected as shown in (C), the genotype of the individual is AG. Figure 3 Figure 3

[0068] Example 4: Effect analysis of SNP site g.9558333 A>G of the molecular marker

[0069] According to the statistical results in Table 1 and Figure 2 The average value of the backfat thickness phenotype of the dominant allele genotype (AA) individual of the SNP site g.9558333 A>G is 18.22 mm, and the estimated breeding value is -0.65, which is significantly lower than that of the GG genotype (the average value of the phenotype is 20.82 mm, and the average value of the estimated breeding value is 0.759), indicating that the AA genotype has a positive genetic effect on reducing the backfat thickness, and the A allele of the site is the dominant allele of the backfat thickness trait.

[0070] In the pig population, by screening the dominant allele (A) of the SNP site for marker-assisted selection, the backfat thickness of commercial pigs can be reduced, the lean meat rate can be improved, and the economic benefits of the breeding industry can be improved. The specific screening steps are as follows:

[0071] Genomic DNA is extracted from the pig sample to be tested using standard molecular biology techniques;

[0072] PCR amplification is performed using the primer pair of SEQ ID NO:2 and SEQ ID NO:3;

[0073] Sanger sequencing is performed on the amplification product to determine the SNP genotype of the 9558333th nucleotide site on chromosome 18 in the pig genome to be tested;

[0074] The individual with AA genotype is preferentially selected for breeding, and pigs with lower backfat thickness can be bred.

[0075] In addition, in the core group of breeding pigs, breeding pigs with the 9558333th nucleotide site on chromosome 18 of the international pig reference genome 11.1 version are eliminated, and breeding pigs with AA and AG genotypes are retained, so as to increase the frequency of allele A in the population from generation to generation, thereby reducing the backfat thickness of the offspring pigs.

[0076] The present application detects the 701th base mutation site in the sequence of SEQ ID NO:1, analyzes the correlation between the genotype and the backfat thickness trait, and provides a new molecular marker for molecular marker-assisted selection of pigs, which has important application significance for promoting precision breeding.

[0077] ​​The above are only preferred embodiments of the present application, it should be pointed out that, for those skilled in the art, without departing from the concept of the present application, can also make several variations and improvements, these should also be considered as the protection scope of the present application, these will not affect the effect and the practicality of the patent of the present application.

Claims

1. A method of screening a pig breed for a low backfat trait, characterized in that, The method comprises the following steps: The genotype of the SNP molecular marker of the pig to be tested is detected, and the individual with AA genotype is selected as the breeding pig; The sequence of the SNP molecular marker is shown as SEQ ID NO:1, wherein the base at position 701 is A or G; The pig breed is a commercial pig population containing Landrace and Large White bloodlines.

2. A method for pig marker assisted selection, characterized in that, The method comprises the following steps: The genotype of the SNP molecular marker of the pig to be tested is detected, and the individual with AA genotype is selected as the breeding pig; and the breeding pig with lower backfat is bred; The sequence of the SNP molecular marker is shown as SEQ ID NO:1, wherein the base at position 701 is A or G; The pig breed is a commercial pig population containing Landrace and Large White bloodlines.

3. The method according to claim 1 or 2, characterized in that, The step of detecting the genotype of the SNP molecular marker comprises: Step 1: genomic DNA extraction; Genomic DNA is extracted from the sample of the pig to be tested by using standard molecular biology techniques; Step 2: target region PCR amplification; The genomic DNA of the pig to be tested is subjected to PCR amplification by using a primer pair with nucleic acid sequences shown as SEQ ID NO:2 and SEQ ID NO:3, so as to obtain an amplification product covering the target genomic region; Step 3: Sanger sequencing analysis; The PCR amplification product is subjected to Sanger sequencing; Step 4: SNP genotype determination; The genotype of the SNP molecular marker in the pig to be tested is determined based on the sequencing result.

4. A method for genetic improvement of pigs, characterized in that, The method comprises the following steps: The genotype of the SNP molecular marker in the core group of breeding pigs is determined, the breeding pig individual with AA and AG genotype is selected, and the breeding pig individual with GG genotype is eliminated, so as to increase the frequency of allele A in the population from generation to generation, thereby reducing the backfat of the offspring pig; The sequence of the SNP molecular marker is shown as SEQ ID NO:1, wherein the base at position 701 is A or G; The pig breed is a commercial pig population containing Landrace and Large White bloodlines.

5. The use of a primer pair for detecting a SNP molecular marker in identifying a pig backfat related trait, screening a pig breed for a low backfat trait, or reducing pig backfat to increase pig lean yield, characterized in that, The nucleic acid sequences of the primer pair are shown as SEQ ID NO:2 and SEQ ID NO:3; wherein the backfat of the AA genotype is lower than that of the GG and GA genotypes; The sequence of the SNP molecular marker is shown as SEQ ID NO:1, wherein the base at position 701 is A or G; The pig breed is a commercial pig population containing Landrace and Large White bloodlines.

6. Use of a kit for detecting a SNP molecular marker in identifying a pig backfat thickness related trait, in screening a pig breed for a low backfat thickness trait, or in reducing pig backfat thickness to increase pig lean meat yield, characterized in that, The kit comprises a primer pair with nucleic acid sequences shown as SEQ ID NO:2 and SEQ ID NO:3; wherein the backfat of the AA genotype is lower than that of the GG and GA genotypes; The sequence of the SNP molecular marker is shown as SEQ ID NO:1, wherein the base at position 701 is A or G; The pig breed is a commercial pig population containing Landrace and Large White bloodlines.

Images