PCR primer pair and molecular marker probe for distinguishing between barnyard grass and rice, detection kit and application thereof

Abstract

The application discloses a PCR primer pair and a molecular marker probe for distinguishing between barnyard grass and rice, a detection kit and application thereof. After align analysis on chloroplast genome sequences of the barnyard grass and the rice, it is found that a difference site exists in a 91 kb region, sequences of the upstream and downstream of the difference site are taken as reference sequences to select homologous sequences to design primers for PCR amplification, and the amplification result proves that the difference site fragment obtained by chloroplast genome sequence analysis exists and can be amplified and identified subsequently; the PCR amplification product is sequenced, and the sequencing result is compared to find that a 12 bp insertion site exists in the site and can separate the barnyard grass from the rice, a colloidal gold probe is designed according to the insertion site, and a RPA detection kit and a detection method are established, and the RPA detection kit is used to detect the barnyard grass and the rice, and the barnyard grass and the rice can be accurately distinguished.

Description

Technical Field

[0001] This invention relates to molecular marker probes, and more particularly to PCR primer pairs and molecular marker probes for distinguishing barnyard grass and rice, detection kits and their applications, belonging to the field of molecular identification of barnyard grass and rice. Background Technology

[0002] barnyard grass ( Echinochloa crus-galli ) and rice ( Oryza sativa Both belong to the Poaceae family and have highly similar morphology in the seedling stage (such as leaf and tiller structure). Traditional manual identification relies on experience and has a high misjudgment rate (literature data: early misjudgment rate is over 30%), resulting in low weeding efficiency.

[0003] Barnyard grass grows faster than rice and is highly competitive for nutrients such as nitrogen and phosphorus. Studies have shown that the presence of five barnyard grass plants per square meter can reduce rice yield by 15%-20% (cite relevant literature), threatening food security. Barnyard grass seeds are similar in size and shape to rice seeds, making them easily mixed during harvesting and storage, thus lowering the commercial grade of rice.

[0004] Molecular identification technology is a technique for identifying biological genome differences at the molecular level. Compared with the subjectivity and complexity of traditional morphological identification, molecular identification technology can make the differences between species observable and simplified in the form of sequence data, so as to obtain more reliable identification results more efficiently.

[0005] Chloroplast genome (cpDNA) molecular markers are of great significance in plant science, particularly in phylogeny, evolutionary biology, species identification, population genetics, ecology, and conservation biology. The chloroplast genome is typically a single circular molecule, ranging in size from 120 to 160 kb, containing a series of genes encoding photosynthesis, electron transport, and other biosynthetic pathways. It exhibits high genetic stability, low recombination rate, and maternally inherited characteristics. These characteristics make the chloroplast genome a highly efficient and reliable molecular marker, providing high-resolution information, especially suitable for analyzing distantly related plants and assessing population structure, gene flow, and historical dynamics. By comparing the chloroplast genomes of different species or populations, researchers can gain a deeper understanding of how plants adapt to various ecological environments and the underlying evolutionary mechanisms, thus providing a scientific basis for biodiversity conservation and sustainable utilization.

[0006] Based on the analysis of chloroplast genome sequencing data of barnyard grass and rice, specific molecular markers can be screened to obtain DNA molecular probes for distinguishing barnyard grass and rice, which can then be used for molecular detection of barnyard grass and rice. Summary of the Invention

[0007] One of the purposes of the present application is to provide a PCR primer pair and a molecular marker probe for distinguishing between barnyard grass and rice.

[0008] The second purpose of the present application is to provide an RPA detection kit for distinguishing between barnyard grass and rice.

[0009] The third purpose of the present application is to provide an RPA detection kit for distinguishing between barnyard grass and rice.

[0010] To achieve the above-mentioned purposes, the main technical solutions adopted by the present application include:

[0011] The present application discloses a PCR primer pair and a molecular marker probe for distinguishing between barnyard grass and rice. The PCR primer pair consists of an upstream primer shown in SEQ ID No. 1 and a downstream primer shown in SEQ ID No. 2. The nucleotide sequence of the molecular marker probe is shown in SEQ ID No. 4. The 5' end of the molecular marker probe is labeled with a FAM fluorescent group, and the 3' end of the molecular marker probe is modified with C3-Spacer. From the 5' end to the 3' end, a tetrahydrofuran (THF) is inserted between the 34th and 35th nucleotides of the nucleotide sequence shown in SEQ ID No. 4.

[0012] The present application discloses an RPA detection kit for distinguishing between barnyard grass and rice, which includes PCR primers, a colloidal gold probe, buffer A, buffer B, double distilled water, and a single nucleic acid test strip. The colloidal gold probe is a molecular marker probe with a nucleotide sequence shown in SEQ ID No. 4. The 5' end of the molecular marker probe is labeled with a FAM fluorescent group, and the 3' end of the molecular marker probe is modified with C3-Spacer. From the 5' end to the 3' end, a tetrahydrofuran (THF) is inserted between the 34th and 35th nucleotides of the nucleotide sequence shown in SEQ ID No. 4. The PCR primers consist of an upstream primer shown in SEQ ID No. 1 and a downstream primer shown in SEQ ID No. 2.

[0013] The single nucleic acid test strip has a quality control line (C line) in the quality control area and a detection line (T line) in the detection area. In addition, one end of the single nucleic acid test strip is provided with a sample loading pad.

[0014] Another aspect of the present application provides a molecular identification method for distinguishing between barnyard grass and rice using the RPA detection kit, comprising: (1) extracting DNA from the sample to be detected; establishing a PCR amplification system by mixing the extracted DNA from the sample to be detected with PCR primers, colloidal gold probes, A buffer, B buffer and double distilled water, and performing PCR amplification; (2) diluting the PCR amplification product 10 times with a single nucleic acid test strip diluent to obtain a diluent, inserting a single nucleic acid test strip sample pad into the diluent, and recording the detection results in the judgment area within 5 minutes; (3) if two bands appear on the single nucleic acid test strip, one on the C line of the quality control area and the other on the T line of the detection area, then the DNA of the sample to be detected is that of barnyard grass; if only one band appears on the C line of the quality control area and no band appears on the T line of the detection area, then the DNA of the sample to be detected is that of rice.

[0015] In a preferred embodiment of the present application, the reaction conditions for the PCR amplification in step (1) are as follows: amplification temperature 42℃, and amplification time 17 min.

[0016] According to the alignment results of the chloroplast genomes of barnyard grass and rice, the present application found multiple difference sites, among which there is a difference site in the 91 kb region. This site can be used to distinguish between barnyard grass and rice, and is an ideal site for molecular markers. Based on this, the sequences of 200 bp upstream and downstream of the difference site were selected as reference sequences to design PCR primers. The DNA of barnyard grass and rice was used as a template for PCR amplification, and a single bright band with the expected size was amplified, proving that the difference site fragment obtained by chloroplast genome sequence analysis exists and can be amplified and identified subsequently. The PCR amplification product was subjected to Sanger sequencing, and the sequencing results were compared. The comparison results showed that there is a 12 bp insertion site in this site that can separate barnyard grass and rice. Based on this site, a colloidal gold probe was designed, which can be used for detecting barnyard grass and rice leaf tissues by using molecular identification methods such as RPA (Recombinase Polymerase Amplification), and barnyard grass and rice can be accurately and sensitively distinguished or identified by whether there is a fluorescence signal. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Figure 1 is the alignment results of the chloroplast genomes of barnyard grass and rice; note: the difference site between barnyard grass and rice is the position marked by 91920 bp in the figure.

[0018] Figure 2 Figure 3 is the electrophoresis band of the molecular marker PCR amplification of the chloroplast genomes of barnyard grass and rice; note: the electrophoresis bands from left to right are Marker, barnyard grass, rice 1 and rice 2, and the band size is about 370 bp.

[0019] Figure 3 The sequencing result alignment of the difference site (91K) of Echinochloa crus-galli and Oryza sativa; Note: the first two sequences are Oryza sativa, and the last sequence is Echinochloa crus-galli. The difference site is consistent with the alignment result.

[0020] Figure 4 The detection result of the DNA amplification product of Echinochloa crus-galli and Oryza sativa detected by using the RPA detection kit; positive control: provided by the kit; Echinochloa crus-galli: Echinochloa crus-galli leaf DNA; Oryza sativa: Oryza sativa leaf DNA; blank control: sterile water. DETAILED DESCRIPTION

[0021] The advantages and characteristics of the present application will become more apparent with the description of the specific experimental examples. However, it should be understood that the experimental examples are only exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, and such modifications or replacements all fall within the protection scope of the present application.

[0022] Experimental Example 1: Alignment screening of the difference site of Echinochloa crus-galli and Oryza sativa and design of molecular marker probe

[0023] 1. Materials and methods

[0024] 1.1 Experimental reagents

[0025] Plant genomic DNA extraction kit: Tiangen, DP305;

[0026] 2x Phanta Max Master Mix (Dye Plus): Novozyme, P525;

[0027] D2000 molecular weight marker: Tiangen, MD114;

[0028] 1.2 Experimental methods

[0029] Sample grinding: the sample tissue was ground into a uniform powder using liquid nitrogen.

[0030] DNA extraction: according to the instruction manual, the DNA of the leaf tissue of Echinochloa crus-galli and Oryza sativa plants was extracted and the concentration was detected.

[0031] Chloroplast genome acquisition: according to the existing data in the public database and the samples preserved in the laboratory of the present inventors, the chloroplast whole genome sequencing was performed, the clean reads were assembled after removing the low-quality data, and the relatively complete chloroplast genome data was obtained.

[0032] Sequence alignment: the chloroplast genomes of Echinochloa crus-galli and Oryza sativa were aligned using MAFFT software.

[0033] PCR primer design: According to the alignment results of the chloroplast genomes of Echinochloa crus-galli and Oryza sativa, the differential sites that can distinguish Echinochloa crus-galli and Oryza sativa were selected, and the sequences of the differential sites and their upstream 123 bp and downstream 348 bp were extracted to design primers. The following PCR primers were obtained by screening:

[0034] 91k-F: AATGTGATATATGGAATATATGACAAAGGTGGAGTCT (SEQ ID No. 1);

[0035] 91k-R: CTGGAATAAAAGAATTAGTAGATCTGTTCCGCC (SEQ ID No. 2);

[0036] PCR amplification verification: The PCR reaction system was configured according to Table 1, and the PCR program was set according to Table 2 to perform PCR amplification.

[0037] Table 1 PCR amplification system

[0038]

[0039] Table 2 PCR amplification program

[0040]

[0041] Gel electrophoresis: 1.5% agarose gel electrophoresis was used to detect the band size of the PCR product.

[0042] Sequencing: The PCR product with the electrophoretic band size consistent with the expected result was sequenced.

[0043] Sequence alignment: The DNAMAN software was used to align the differential sites of the chloroplast genomes of Echinochloa crus-galli and Oryza sativa.

[0044] Probe design: According to the probe design principle, an oligonucleotide probe with a length of 45-50 nt was designed at the chloroplast gene specific site, a FAM fluorescent group was labeled at the 5' end, a C3-spacer was modified at the 3' end, and a d-Spacer (THF-tetrahydrofuran) was inserted at a distance of greater than or equal to 35 nt from the 5' end in the middle of the probe.

[0045] 2 Experimental results

[0046] 2.1 Chloroplast genome sequencing results

[0047] The chloroplast genomes of Echinochloa crus-galli and Oryza sativa were retrieved, and the retrieval numbers are shown in Table 3.

[0048] Table 3 Genbank retrieval numbers of chloroplast genome sequences of research samples

[0049]

[0050] 2.2 Sequence alignment

[0051] After align analysis of the sequences of the chloroplast genomes of Echinochloa crus-galli and Oryza sativa, the differential sites can be screened, as shown in Table 1. Figure 1

[0052] 2.3 Selection and amplification verification of differential sites

[0053] The fragments of about 120 bp upstream and 240 bp downstream of the differential sites were amplified and verified, and the agarose nucleic acid electrophoresis detection results (Figure 2) were consistent with the expectations, and the target fragments were amplified in Echinochloa crus-galli and Oryza sativa. Figure 2

[0054] 2.4 Sequencing and comparison of differential sites

[0055] After sequencing the amplified fragments of Echinochloa crus-galli and Oryza sativa and analyzing using the DNAMAN software, the differential sites can be screened, as shown in Table 2. Figure 3 The alignment results show that there is a 12 bp (GATATCAAAATC (SEQ ID No. 3)) insertion site in Echinochloa crus-galli at this site, which can separate Echinochloa crus-galli and Oryza sativa.

[0056] 2.5 Molecular marker probe

[0057] The colloidal gold probe was designed according to the screened differential sites, and the results are shown in Table 4.

[0058] Table 4 Sequence of fluorescent probe based on specific site

[0059]

[0060] Experimental Example 2 Establishment of RPA detection kit and verification experiment of detecting Echinochloa crus-galli and Oryza sativa

[0061] 1 Experimental method

[0062] The composition of the RPA detection kit: PCR primer, colloidal gold probe, A buffer, B buffer, double distilled water, and single nucleic acid test strip (Anpu Future, WLFS8206). Among them, the A buffer and the B buffer are the A buffer and the B buffer in the DNA constant temperature rapid amplification kit (colloidal gold test strip type) (Anpu Future, WLN8203KIT);

[0063] ​​The colloidal gold probe is a molecular marker probe with a nucleotide sequence shown in SEQ ID No. 4; the molecular marker probe is labeled with a FAM fluorescent group at the 5' end, and is modified with C3-Spacer at the 3' end; from the 5' end to the 3' end, a tetrahydrofuran (THF) is inserted between the 34th and 35th nucleotides of the nucleotide sequence shown in SEQ ID No. 4; the PCR primer is composed of an upstream primer shown in SEQ ID No. 1 and a downstream primer shown in SEQ ID No. 2;

[0064] The single nucleic acid test strip has a quality control line (C line) in the quality control area and a detection line (T line) in the detection area; in addition, one end of the single nucleic acid test strip is provided with a sample loading pad.

[0065] DNA amplification: using primers 91k-F (SEQ ID No. 1) / 91k-R (SEQ ID No. 2), colloidal gold probe (SEQ ID No. 4) and amplification kit, the amplification system is prepared according to Table 5, sterile water is used to replace the DNA template as a negative control, and a positive control reaction unit system is prepared. After the amplification system is prepared, it is placed in a 42℃ water bath for 17 min and then stored.

[0066] Table 5: Sample DNA constant temperature amplification system

[0067]

[0068] Single nucleic acid test strip detection: take 10 microliters of amplification product, dilute 10 times with single nucleic acid test strip diluent (Anfu future, WLFS8206), then insert the single nucleic acid test strip sample pad into the diluted reaction solution, and record the detection results in the judgment area within 5 minutes.

[0069] 2 Experimental results

[0070] The single nucleic acid test strip detection result shows that the positive control single nucleic acid test strip appears two bands, indicating that the kit is effective; the crabgrass leaf DNA is successfully combined with the probe, and the single nucleic acid test strip appears two bands, one in the quality control area (C line) and one in the detection area (T line); while the rice leaf DNA is not combined with the probe, the result shows that there is no band in the detection area (T line) Figure 4 ); the result of sterile water (blank control) also shows that there is no band in the detection area (T line), and according to the detection result, the colloidal gold probe provided by the present application can be used to distinguish crabgrass and rice.

Claims

1. A pair of RPA primers and a molecular marker probe for distinguishing between barnyard grass and rice, characterized by, The RPA primer pair consists of an upstream primer shown in SEQ ID N0.1 and a downstream primer shown in SEQ ID N0.2; and the nucleotide sequence of the molecular marker probe is shown in SEQ ID N0.

4.

2. The RPA primer pair and molecular label probe of claim 1, wherein, The 5' end of the molecular marker probe is labeled with a FAM fluorescent group, and the 3' end of the molecular marker probe is modified with C3-Spacer; from the 5' end to the 3' end, a tetrahydrofuran is inserted between the 34th and 35th nucleotides of the nucleotide sequence shown in SEQ ID N0.

4.

3. The RPA primer pair and the molecular marker probe of claim 1 or 2 for use in distinguishing or identifying barnyard grass and rice.

4. An RPA test kit for distinguishing between barnyard grass and rice, comprising: The RPA primer pair, the colloidal gold probe, double distilled water, and the singleplex nucleic acid test strip; characterized in that the colloidal gold probe is the molecular marker probe with the nucleotide sequence shown in SEQ ID N0.4; the 5' end of the molecular marker probe is labeled with a FAM fluorescent group, and the 3' end of the molecular marker probe is modified with C3-Spacer; from the 5' end to the 3' end, a tetrahydrofuran is inserted between the 34th and 35th nucleotides of the nucleotide sequence shown in SEQ ID N0.4; the RPA primer pair consists of an upstream primer shown in SEQ ID N0.1 and a downstream primer shown in SEQ ID N0.

2.

5. The RPA detection reagent kit according to claim 4, characterized in that, The singleplex nucleic acid test strip has a quality control line in the quality control area and a detection line in the detection area; in addition, one end of the nucleic acid test strip is provided with a sample loading pad.

6. The RPA detection kit of claim 5 for use in distinguishing or identifying barnyard grass and rice.

7. Use according to claim 6, characterized in that, comprises: If two bands appear on the singleplex nucleic acid test strip, one C line in the quality control area and one T line in the detection area, the sample to be detected is the DNA of barnyard grass; If only the C line appears in the quality control area and the T line does not appear in the detection area on the singleplex nucleic acid test strip, the sample to be detected is the DNA of rice.

Images