Artificial non-coding RNA (Ribonucleic Acid) molecule, DNA (Deoxyribose Nucleic Acid) molecule, biological material and application of artificial non-coding RNA molecule, DNA molecule and biological material in improving carbon and nitrogen metabolism capability of
By using synthetically designed artificial non-coding RNA and DNA molecules, the carbon metabolism of rhizobia was regulated, which solved the problem of low carbon source utilization by rhizobia in complex rhizosphere environments, and improved the symbiotic nitrogen fixation efficiency and legume crop yield.
Patent Information
- Application Number
- CN202511403118.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2045-09-29
AI Technical Summary
In the complex rhizosphere microenvironment, rhizobia have low recognition and utilization rates of carbon sources in the host roots, which limits the effectiveness of the symbiotic nitrogen fixation system and affects the yield and quality of legumes.
We designed and constructed artificial non-coding RNA and DNA molecules, and through the modular design concept of synthetic biology, specifically regulated the expression of carbon metabolism-related genes in rhizobia, thereby improving the utilization of carbon sources and enhancing symbiotic nitrogen fixation capabilities.
It significantly improved the utilization of malic acid by rhizobia, enhanced symbiotic nitrogen fixation, promoted the yield and quality of leguminous crops, and broke through the limitations of the rhizosphere environment on carbon sources.
Smart Images

Figure CN120888552A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to an artificial non-coding RNA molecule, a DNA molecule and a biological material and application thereof in improving the carbon and nitrogen metabolic capacity of rhizobium. BACKGROUND
[0002] In the global agricultural production system, nitrogen, as a core nutrient element indispensable for plant growth and development, directly determines the yield and quality of crops. The symbiotic nitrogen fixation system composed of leguminous plants and rhizobium is the highest biological system in terms of nitrogen fixation efficiency in nature, and its nitrogen fixation amount accounts for a large proportion of the total biological nitrogen fixation in the world, which has irreplaceable application value in agricultural production. In this symbiotic system, rhizobium can invade the root system of leguminous plants and form a special symbiotic organ, i.e. nodule, and convert the inert nitrogen in the air into ammonia nitrogen that can be directly absorbed and utilized by plants through its own nitrogenase system, thereby providing a stable nitrogen source for the host plant. At the same time, the rhizobium relies on the specific organic substances (such as sucrose and organic acids) released by the host leguminous plant roots through active secretion as a carbon source to meet the carbon skeleton and energy supply required for its growth, reproduction, energy metabolism and efficient operation of the nitrogenase system, and the two form a close symbiotic relationship.
[0003] However, in the actual agricultural ecosystem, the rhizosphere environment is a complex microecosystem composed of bacteria, fungi, actinomycetes and other microorganisms, with high microbial diversity and intense interspecific competition. This complex rhizosphere microenvironment can significantly interfere with the production and release of root exudates of leguminous plants: on the one hand, other microorganisms in the rhizosphere can form a competitive relationship with rhizobium, competing for organic carbon sources produced by photosynthesis, resulting in a decrease in the total amount of carbon source substances secreted by the root system to rhizobium, causing a shortage of carbon source supply; on the other hand, some rhizosphere microorganisms can also change the chemical composition and proportion of root exudates through metabolic activity, destroy the recognition and utilization preference of rhizobium for specific carbon sources, and greatly reduce the utilization rate of rhizobium for existing carbon sources. The above problems directly lead to a serious restriction on the colonization ability, reproduction efficiency and nitrogen fixation activity of rhizobium in the rhizosphere environment, thereby affecting the nitrogen fixation efficiency of the entire symbiotic nitrogen fixation system, which becomes a core bottleneck limiting the large-scale and efficient application of the system in agricultural production. Therefore, how to improve the recognition ability, absorption efficiency and metabolic utilization level of rhizobium for host root carbon sources through scientific means, and break through the carbon source limitation brought by the rhizosphere microenvironment, has become a key breakthrough for further improving the symbiotic nitrogen fixation capacity of leguminous plants and rhizobium, promoting the industrial application of biological nitrogen fixation technology, and an important research direction in the fields of agricultural microbiology and plant nutrition.
[0004] With the deepening of molecular biology and microbial genetics research, non-coding RNA (ncRNA) as a class of RNA molecules without protein coding but with important regulatory functions, its role in environmental adaptability regulation of prokaryotes has been gradually revealed. Studies have shown that ncRNA can directly interact with target mRNA molecules through base complementary pairing, regulating the expression of target genes at the post-transcriptional level: it can not only inhibit the translation process by binding to the ribosome binding site of mRNA, but also promote the translation efficiency by stabilizing the secondary structure of mRNA, thereby precisely regulating key physiological processes such as carbon metabolism, nitrogen metabolism, quorum sensing and environmental stress response of microorganisms. In the symbiotic system of legume plants and rhizobium, ncRNA also plays an important role, it can not only regulate the expression of rhizobium carbon metabolism related genes (such as carbon source transporter genes, sugar metabolism enzyme genes, etc.), but also participate in the signal exchange process between rhizobium and host plants, affecting the formation and development of root nodules.
[0005] Based on the above research basis, synthetic biology as a new discipline combining molecular biology, engineering and information science, its core modular design concept provides a new way to solve the problem of rhizobium carbon metabolism regulation. This concept advocates that the complex physiological functions in living organisms can be disassembled into functional modules with specific functions, and through artificial design, modification and assembly of these functional modules, precise regulation and targeted modification of physiological processes of living organisms can be achieved. Therefore, by using the modular design concept of synthetic biology, artificial non-coding RNA functional modules that can specifically regulate the expression of carbon metabolism related genes are designed and constructed for the key nodes of the rhizobium carbon metabolism regulation network, which not only breaks through the limitations of low efficiency and poor specificity of natural ncRNA regulation, but also realizes precise regulation of carbon source absorption, transport and metabolism of rhizobium, thereby significantly improving the ability of rhizobium to utilize carbon source of host root in complex rhizosphere environment, providing core technical support for the creation of high-efficiency symbiotic nitrogen-fixing bacterial strain. SUMMARY
[0006] Therefore, the purpose of the present application is to provide an artificial non-coding RNA molecule, a DNA molecule and a biological material and their application in improving the carbon and nitrogen metabolism of rhizobium. The artificial non-coding RNA molecule provided by the present application can significantly improve the utilization of malic acid by rhizobium, thereby enhancing the symbiotic nitrogen fixation ability of rhizobium.
[0007] The present application provides an artificial non-coding RNA molecule, the nucleotide sequence of which is shown in SEQ ID NO. 1.
[0008] The application provides a DNA molecule, wherein the DNA molecule is transcribed to obtain the artificial non-coding RNA molecule, and the nucleotide sequence of the DNA molecule is shown in SEQ ID NO. 2.
[0009] The application provides a gene expression cassette AbcR1, which comprises a promoter responding to a symbiotic nitrogen fixation signal and the DNA molecule; and the nucleotide sequence of the gene expression cassette is shown in SEQ ID NO. 3.
[0010] The application provides a recombinant vector, which comprises an initial vector and the gene expression cassette AbcR1.
[0011] Preferably, the gene expression cassette AbcR1 is inserted into a multiple cloning site of the initial vector.
[0012] The application provides application of the artificial non-coding RNA molecule, the DNA molecule, the gene expression cassette AbcR1 and the recombinant vector in improving carbon and nitrogen metabolic utilization of rhizobium.
[0013] The application provides a recombinant rhizobium with high carbon and nitrogen metabolic capacity, wherein the recombinant vector is introduced into a host rhizobium.
[0014] Preferably, the host rhizobium is F. sinensis.
[0015] The application provides application of the recombinant rhizobium in improving yield and quality of legume crops.
[0016] The application provides application of the recombinant rhizobium in soil improvement.
[0017] Compared with the prior art, the application has the following beneficial effects: the application provides an artificial non-coding RNA molecule, which is synthesized according to a conserved region of a sequence obtained by comparing a phosphoenolpyruvate carboxykinase-encoding gene, which is a key enzyme for carbon metabolic regulation in F. sinensis, Sinorhizobium fredii pckA The application provides an artificial non-coding RNA molecule, which is synthesized by an artificial chemical synthesis method; the artificial non-coding RNA molecule and the recombinant expression vector constructed by using the RNA molecule can significantly improve the utilization capacity of rhizobium for malic acid, and further enhance the symbiotic nitrogen fixation capacity of rhizobium. The artificial non-coding RNA molecule and / or the DNA molecule provided by the application can be applied to construction of an artificial high-efficiency carbon and nitrogen coupling pathway in rhizobium.
[0018] Furthermore, the symbiotic signal-induced gene expression cassette AbcR1 significantly enhances the carbon source utilization capacity of rhizobia, especially malic acid, the main carbon source during rhizobia symbiosis. The recombinant rhizobia provided by this invention significantly improves the growth-promoting effect, nodule number, and nitrogenase activity when symbiotic with legumes, by 1.12 times, 1.32 times, and 1.23 times respectively compared to the basal species. This demonstrates that the recombinant rhizobia provided by this invention can significantly improve the yield and quality of legumes. Attached Figure Description
[0019] Figure 1 A schematic diagram illustrating the construction of the recombinant expression vector provided by this invention; Figure 2 PCR validation results for the recombinant expression vector provided by this invention; Figure 3 The utilization capacity of carbon sources such as malic acid by the chassis bacteria of the present invention and the recombinant rhizobium S. fredii (pAbcR1) provided by the present invention was determined. Figure 4 The binding ability of the artificial non-coding RNA provided in this invention to the pckA mRNA encoding the phosphoenolpyruvate carboxykinase gene was determined, wherein (a) AbcR1 and pckA (b) shows AbcR1 binding to mRNA molecules; pckA (c) shows the binding of pckA-m1 mRNA molecules with a 6-base mutation; pckA The pckA-m2 mRNA molecule, which has a 9-base mutation in its mRNA, binds to it. Detailed Implementation
[0020] This invention provides an artificial non-coding RNA molecule, the nucleotide sequence of which is shown in SEQ ID NO.1, and is as follows: agcygayacyygyyyggyggcyycyccycccagygccaccgcaggagaygyyccccycyggaggyycyaayaayyyygaccacyaccaggggcccacayyyccygcggyccgcyyyyyyy.
[0021] The above-mentioned artificial non-coding RNA molecule is based on the present invention of *Rhizobium fischeri* (F. ferruginea). Sinorhizobium fredii By comparing the conserved region of the sequence obtained from the alignment of the pckA mRNA encoding gene, a key enzyme in carbon metabolism regulation (PCR), an artificial non-coding RNA molecule with a degenerate complementary pairing region was synthesized using artificial chemical synthesis methods.
[0022] The application provides a DNA molecule, the nucleotide sequence of the DNA molecule is shown in SEQ ID NO. 2, and the DNA molecule is specifically as follows: agctgatacttgtttggtggcttctcctcccagtgccaccgcaggagatgttcccctctggaggttctaataattttgaccactaccaggggcccacatttcctgcggtccgcttttttt.
[0023] The application provides a gene expression cassette AbcR1, which comprises a promoter responding to a symbiotic nitrogen fixation signal and the DNA molecule; the nucleotide sequence of the gene expression cassette is shown in SEQ ID NO. 3, and the gene expression cassette is specifically as follows: cctgcctgcttggaatcggcatcgccatgctccccgactacatcgtcggccgggatcccggtctgatccagctgccgatcagtgccgacatcccctctttcgatacctatttctgctatccggacgaaatgaagaacgccgcgaagctgaaggtcttccgcgactatattgttgccaaggcgcgcaactggaatttttgacgcccgtcgcgattgcccgattaatgggcaattgccagttccgccgttacctcattgtttttcttgaagctttttcgccatggcgaaacgcccgggcaacgcgattctattgtgcgatgcaaaaatatgcaggaatgcgcagacggcatggctggcatgcatattaaatgattgcccctcgcccaaaaaaacagcataccaaatccagctgatacttgtttggtggcttctcctcccagtgccaccgcaggagatgttcccctctggaggttctaataattttgaccactaccaggggcccacatttcctgcggtccgcttttttt.
[0024] The artificial non-coding RNA molecule provided by the application is controlled by the symbiotic nitrogen fixation signal inducible promoter element, and the DNA molecule sequence and the promoter sequence of the artificial non-coding RNA are synthesized by an artificial synthesis method to obtain the gene expression cassette AbcR1 of the non-coding RNA molecule. The gene expression cassette AbcR1 is paired with the base of the phosphoenolpyruvate carboxykinase encoding gene pckA mRNA of the rhizobium disc fungus to cause the secondary structure of the inhibited base to be broken, so that the phosphoenolpyruvate carboxykinase is highly expressed. The DNA molecule provided by the application is controlled by the symbiotic nitrogen fixation signal inducible promoter to participate in the post-transcriptional regulation of the phosphoenolpyruvate carboxykinase encoding gene in microorganisms.
[0025] The application provides a recombinant vector, comprising an initial vector and the gene expression cassette AbcR1.
[0026] In the application, the gene expression cassette AbcR1 is preferably inserted into the multiple cloning site of the initial vector, and is further preferably inserted between Bam HI enzyme cutting sites and Hind III enzyme cutting sites. The application does not have special limitations on the preparation method and specific operation parameters of the recombinant vector, and the conventional enzyme cutting and connection operation in the field can be used. In the application, the initial vector is preferably pBBR1MCS-2.
[0027] The application also provides the application of the artificial non-coding RNA molecule, the DNA molecule, the gene expression cassette AbcR1 and the recombinant vector in improving the carbon and nitrogen metabolic utilization of rhizobium.
[0028] The application provides a recombinant rhizobium with high carbon and nitrogen metabolic capacity, and the recombinant vector is introduced into a host rhizobium.
[0029] In the application, the host rhizobium is preferably Sinorhizobium fredii, and more preferably Sinorhizobium fredii CCBAU45436. The method for introducing the recombinant vector into the host rhizobium preferably adopts a three-parent combination method.
[0030] The application provides the application of the recombinant rhizobium in improving the yield and quality of legume crops.
[0031] The application provides the application of the recombinant rhizobium in soil improvement.
[0032] The technical solutions provided by the application are described in detail below in combination with examples, but they should not be understood as limitations on the protection scope of the application.
[0033] Example 1
[0034] The present embodiment is used to illustrate the construction of the recombinant expression vector of the artificial non-coding RNA molecule provided by the present application
[0035] The present application is based on the key enzyme phosphoenolpyruvate carboxykinase encoding gene in carbon metabolism regulation of Mesorhizobium huakuii Sinorhizobium fredii ) (SEQ ID NO: 1). pckA The sequence-conserved region obtained by mRNA alignment is synthesized into an artificial non-coding RNA molecule with a "degenerate" complementary pairing region by an artificial chemical synthesis method. abcR1 The nucleic acid sequence is shown in SEQ ID NO: 1.
[0036] The DNA molecule for transcription to obtain the artificial non-coding RNA molecule has a nucleotide sequence shown in SEQ ID NO. 2.
[0037] The expression of the artificial non-coding RNA molecule is controlled by a symbiotic nitrogen fixation signal inducible promoter element, and the DNA molecule sequence of the artificial non-coding RNA and the promoter sequence are synthesized by an artificial synthesis method to obtain the gene expression cassette AbcR1 of the non-coding RNA molecule, which has a nucleotide sequence shown in SEQ ID NO. 3.
[0038] Then, the gene expression cassette AbcR1 of the artificial non-coding RNA and the expression vector pBBR1MCS-2 are respectively digested by Bam HI and Hind III, the gene expression cassette AbcR1 is inserted into the multiple cloning site of pBBR1MCS-2 by using the seamless cloning technology, and finally the recombinant E. coli strain DH5a3 (pAbcR1) of the expression functional module AbcR1 is obtained by PCR sequencing verification. Figure 1 The construction of the recombinant expression vector pAbcR1 is shown in Figure 2 The PCR verification result of the recombinant expression vector is shown in The present application can amplify the above-mentioned DNA fragment with a band size of 526 bp.
[0039] The functional module AbcR1 expression vector is transformed into Mesorhizobium huakuii Sinorhizobium frediiCCBAU45436) was introduced by triparental mating. First, centrifuge the overnight culture of the chassis strain CCBAU 45436, E. coli DH5a3 (pRK2013) expressing helper plasmid pRK2013 and recombinant E. coli DH5a3 (pAbcR1) expressing artificial non-coding RNA at 6000 rpm for 5 min, discard the supernatant and collect the bacterial cells; then wash twice with physiological saline, resuspend the cells of the three strains in 1 mL of physiological saline in an Ep tube, centrifuge at 6000 rpm for 5 min, discard the supernatant, resuspend the mixed bacterial cells with 60 μL of physiological saline again, and then spot on the TY solid medium without antibiotics; incubate at 30 °C for 2 d, pick the bacterial colonies, resuspend them in 1 mL of physiological saline, gradient dilute and plate on the corresponding double-antibiotic plates for 2 d, and finally obtain the recombinant rhizobium S. fredii (pAbcR1) by colony PCR and sequencing.
[0040] Example 2
[0041] This example is used to determine the carbon source utilization ability of the recombinant rhizobium provided by the present application. The carbon source utilization ability of the recombinant rhizobium is detected by using Biolog GN3 96-well identification plate, and the specific steps are as follows: The Sinorhizobium fredii CCBAU45436 (hereinafter referred to as chassis strain S. fredii ) and the recombinant rhizobium S. fredii (pAbcR1) are activated on YMA plates for two generations to maintain the viability of the strains; use a 1 mL pipette to scrape the fresh bacterial cells, resuspend and mix them in the inoculum, then use a turbidimeter to adjust the turbidity in the cuvette to 95% ± 2%; then pour the bacterial suspension into the reservoir, use an 8-channel pipette to take 100 μL of the bacterial suspension and add it to the Biolog GN3 96-well identification plate, with three replicates in each group; finally, place the micro-well identification plate directly into the Omnilog reading instrument box, set the Omnilog system program, incubate at 30 °C for 48 h, and scan the identification plate to analyze the substrate metabolism.
[0042] The results are shown in Table 2. Figure 3 Compared with the chassis strain S. fredii , the carbon source utilization ability of the recombinant rhizobium S. fredii (pAbcR1) is significantly improved, including the main carbon source malate during rhizobium symbiosis, which is 1.22 times that of the chassis strain.
[0043] This example demonstrates that the symbiotic signal-induced expression of the artificial non-coding RNA functional module AbcR1 can significantly improve the carbon source utilization ability of the chassis strain, especially the main carbon source malate during rhizobium symbiosis.
[0044] Example 3
[0045] This example is used to determine the symbiotic nitrogen fixation ability of the provided recombinant rhizobium with Jiandou 17: The vermiculite pot experiment is used to analyze the growth promoting ability, nodule formation ability and nitrogen fixation ability of the recombinant rhizobium on Jiandou 17, and the specific steps are as follows: Select uniform size, intact and smooth seed coat Jiandou 17 seeds and put them in a conical flask, sterilize in a clean bench: wash with anhydrous ethanol for 1 min; pour out the anhydrous ethanol and rinse once with sterile water; wash with 1:5 diluted sodium hypochlorite solution for 2 min; pour out the solution and rinse once with sterile water; rinse the seeds with sterile water containing mold inhibitor (PPM) for 5 times; rinse twice with sterile water; use sterile forceps to spread the seeds evenly on a large petri dish containing 0.6% water agar; finally, put the petri dish in a black plastic bag and germinate at 28 ℃ in the dark for 2-3 days.
[0046] During the seed germination period, sterilize the water tank, upper cup filled with vermiculite, and water absorption rope; stir the vermiculite with low-nitrogen plant nutrient solution (1 kg of vermiculite with 1.5 L of low-nitrogen plant nutrient solution, can be divided into 25 pots), then sterilize at 121 ℃ for 90 min.
[0047] After the soybean germinates, select seeds with uniform germination, good growth condition and uniformity on the large petri dish for transplanting. Burry the seed roots into the upper cup filled with vermiculite, and fill the lower water tank with water, then place it in an artificial climate chamber for culture (humidity 60%, light 16 h, dark 8 h; temperature: 26 ℃ during the day, 22 ℃ at night).
[0048] During the seedling growth period, inoculate the chassis bacteria S. fredii and the recombinant rhizobium S. fredii (pAbcR1) in YMA liquid medium and culture at 30 ℃ for two days; when the seedlings grow the first true leaf, centrifuge the cultured bacterial solution, discard the supernatant, then resuspend the bacterial cells with 0.85% physiological saline for two times, centrifuge at 6000 rpm for 10 min, discard the supernatant, finally resuspend with PBS liquid, adjust the OD 600 of the bacterial solution to 0.2, inoculate 1 ml of bacterial solution to the soybean roots, culture for 3 weeks, regularly supplement water every week, and set 8 parallels for each group.
[0049] Finally, detect the symbiotic indexes of soybean such as aboveground plant height, nodule number, nodule fresh weight and nitrogenase activity.
[0050] The results are shown in Table 1. Compared with the chassis bacteria, the growth promoting effect, nodule number and nitrogenase activity of the recombinant rhizobium when symbiotic with Jiandou 17 are significantly improved, which are 1.12 times, 1.32 times and 1.23 times of the chassis bacteria, respectively.
[0051] Table 1. Symbiotic nitrogen fixation phenotype analysis of soybean inoculated with basal flora and recombinant rhizobia.
[0052] This embodiment demonstrates that the artificial non-coding RNA functional module AbcR1, expressed in response to symbiotic signals, can significantly enhance the symbiotic nitrogen fixation capacity of Chameleonella.
[0053] Example 4
[0054] This embodiment uses a micro-thermal surge experiment to identify the artificial non-coding RNA gene expression cassette and the phosphoenolpyruvate carboxylkinase-encoding gene provided by this invention. pckA The binding ability of mRNA is determined through the following steps: The 30 bp 5' FAM fluorescently labeled material required for this experiment was synthesized by Shanghai Sangon Biotech Co., Ltd. pckA mRNA sequences were used as probes; and 120 bp full-length artificial non-coding RNA sequences were obtained through in vitro transcription as ligands. The concentration of AbcR1 used was 6 μM, and the concentration of the labeled probe mRNA was 200 nM. Then, the AbcR1 was serially diluted by half concentration, and 10 μL was taken and mixed with the same volume of target. The mixed sample was added to 16 standard capillary tubes and left to stand for 5 min. The artificial noncoding RNA gene expression cassette AbcR1 and... (The sentence is incomplete and requires more context to be translated accurately.) pckA The binding ability between mRNAs was analyzed and the dissociation constant Kd was calculated.
[0055] Kd = [A] × [L] / [AL], Where [A] is the concentration of free fluorescent molecules, [L] is the concentration of free ligands, and [AL] is the concentration of the A and L complex.
[0056] The results are as follows Figure 4 As shown, the artificial non-coding RNA gene expression cassette AbcR1 and pckA The micro-thermophoretic fitting curves between mRNAs were all typical "S"-shaped curves, and the K-axis binding coefficients of the two were... d The value is 53.52 ± 81.65 nM. pckA After a 6-base mutation in the mRNA, AbcR1 binds to PckAm-m1 mRNA with a Kd value of 233.75 ± 116.84 nM, and the binding ability is [missing information]. pckA The percentage of unmutated mRNA was 22.90%. After further mutation of 3 bases, AbcR1 and... pckAmRNA no longer binds. It is shown that the artificial non-coding RNA functional module AbcR1 has a good binding trend with pckA mRNA.
[0057] This embodiment proves that the artificial non-coding RNA functional module AbcR1 can interact with the phosphoenolpyruvate carboxykinase-encoding gene pckA mRNA through base complementary pairing, and further regulates the carbon source utilization ability of the host chassis from the post-transcriptional level.
[0058] From the above embodiments, it can be seen that the artificial non-coding RNA molecule provided by the present application can significantly improve the utilization ability of rhizobium to malate, enhance the symbiotic nitrogen fixation ability of rhizobium, and improve the yield and quality of legume crops. It has important theoretical significance for promoting the innovative development of biological nitrogen fixation technology, and important practical value for reducing the dependence of agricultural production on chemical nitrogen fertilizer and realizing green and sustainable development of agriculture.
[0059] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, several improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. An artificial non-coding RNA molecule, characterized in that, The nucleotide sequence is shown in SEQ ID NO.
1.
2. A DNA molecule, characterized in that, The DNA molecule is transcribed to obtain the artificial non-coding RNA molecule of claim 1, wherein the nucleotide sequence of the DNA molecule is shown in SEQ ID NO.
2.
3. A gene expression cassette AbcR1, characterized in that, It includes a promoter that responds to symbiotic nitrogen fixation signals and the DNA molecule of claim 2; the nucleotide sequence of the gene expression cassette is shown in SEQ ID NO.
3.
4. A recombinant vector, characterized in that, Includes the initial vector and the gene expression cassette AbcR1 as described in claim 3.
5. The recombinant vector according to claim 4, characterized in that, The gene expression cassette AbcR1 is inserted into the multiple cloning site of the initial vector.
6. The application of the artificial non-coding RNA molecule of claim 1, the DNA molecule of claim 2, the gene expression cassette AbcR1 of claim 3, and the recombinant vector of claim 4 or 5 in improving the carbon and nitrogen metabolism utilization of rhizobia.
7. A recombinant rhizobium with highly efficient carbon and nitrogen metabolism capabilities, characterized in that, The recombinant vector of claim 4 or 5 is introduced into the host rhizobium.
8. The recombinant rhizobium according to claim 7, characterized in that, The host rhizobium is *Rhizobium fischeri*.
9. The application of the recombinant rhizobium according to claim 7 or 8 in improving the yield and quality of leguminous crops.
10. The application of the recombinant rhizobium as described in claim 7 or 8 in soil improvement.
Citation Information
Patent Citations
Artificial non-coding RNA module for enhancing nitrogen fixation capacity of microorganisms
CN111926008A
Artificial non-coding RNA molecule CsiX for regulating and controlling synthesis yield of carotene compounds and application of artificial non-coding RNA molecule CsiX
CN114921464A
Artificial non-coding RNA (Ribonucleic Acid) molecule and application of artificial non-coding RNA molecule in regulation and control of ammonium secreting capacity of nitrogen-fixing bacteria
CN117327692A