Genetically engineered bacterium for producing L-homoserine as well as construction method and application of genetically engineered bacterium
By performing multiple gene editing and modification on the Escherichia coli genome, optimizing the amino acid synthesis pathway and sugar-acid conversion rate, and constructing a highly efficient genetically engineered strain, the problems of low yield and complex fermentation process in the biological production of L-homoserine were solved, achieving high yield and efficient sugar-acid conversion, suitable for industrial production.
Patent Information
- Application Number
- CN202510931336.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-07
- Publication Date
- 2025-11-07
AI Technical Summary
Existing biological methods for producing L-homoserine suffer from low fermentation yields and the need to add essential amino acids during fermentation, resulting in high production costs and complex operations, making industrial-scale production difficult.
By performing various gene editing and modification on the Escherichia coli genome, including integrating self-regulating promoters, weakening start codons, inserting strong promoters, and constructing quorum sensing regulatory circuits, the amino acid synthesis pathway and sugar-acid conversion rate were optimized, and a highly efficient genetically engineered strain was constructed to achieve high-yield L-homoserine production without the addition of exogenous amino acids.
In shake flasks, the yield of L-homoserine increased from 7.62 g/L to 9.90 g/L, while in fermenters it reached 142.15 g/L. The sugar-acid conversion rate was increased to 0.45 g/g glucose, which significantly improved the yield of L-homoserine and the sugar-acid conversion efficiency, while reducing fermentation costs and operational difficulty.
Smart Images

Figure BDA0005486422630000041 
Figure BDA0005486422630000051 
Figure BDA0005486422630000052
Abstract
Description
(I)TECHNICAL FIELD
[0001] The present application belongs to the technical field of microbial metabolic engineering, and particularly relates to a genetically engineered bacterium with high L-homoserine yield, a construction method thereof and application. (II)BACKGROUND
[0002] Homoserine, also known as 2-amino-4-hydroxybutyric acid, is divided into two isomers, L-homoserine and D-homoserine, and is an important non-protein amino acid. It is also a precursor of essential amino acids such as L-methionine, L-threonine and L-isoleucine, and is also an intermediate for synthesizing herbicide L-glufosinate and various C4 compounds (such as gamma-butyrolactone, isobutanol), and has the ability to improve plant resistance to diseases and support the growth of young chicks. It can also be efficiently converted into methionine by enzymes, which is an attractive method for large-scale production of methionine. Therefore, homoserine is widely used in the pesticide, feed additive, pharmaceutical and chemical industries.
[0003] Traditional methods for producing L-homoserine mainly include chemical synthesis and enzyme catalysis. However, chemical synthesis has the problems of complicated purification steps, long reaction time, high production cost, complex process and environmental pollution, and is not suitable for large-scale production. In recent years, with the development of metabolic engineering and synthetic biology, microbial fermentation method using cheap and environmentally friendly biomass as raw material to produce target chemicals through microbial metabolism has attracted more attention. Microbial fermentation method for producing L-homoserine uses microbial cells to metabolize substrates into target products, which has the advantages of green environmental protection and conforms to the current industrial development trend. However, it has not yet reached the level of industrial production, so microbial fermentation for producing L-homoserine has become a current research hotspot.
[0004] The biosynthesis of L-homoserine was first obtained through the fermentation of L-threonine and L-lysine by Corynebacterium glutamicum. The strain was fermented in a medium containing 80 g / L corn syrup and 150 g / L sucrose for 72 h, and finally 14.5 g / L of L-homoserine was obtained. In 2021, Mu et al. designed a redox balance route for the fermentation of L-homoserine from glucose: since L-aspartate lacks reducing power for the production of L-homoserine through the reduction of oxaloacetate, an intermediate of the tricarboxylic acid cycle, this defect can be corrected by activating the glyoxylate shunt and driving the flux of fumarate to L-aspartate. This redox balance route adjusts the flux of fumarate to L-aspartate, and subsequently enhances the efflux of L-homoserine, and in fed-batch fermentation, 84.1 g / L of L-homoserine is obtained. In 2022, Cai et al. first obtained an initial strain of L-homoserine in Escherichia coli by adjusting the L-homoserine degradation pathway and enhancing the synthesis process. In order to promote the production of L-homoserine, the gene expression was enhanced by optimizing the copy number on the chromosome, and the transport system was improved to promote the efflux of L-homoserine; subsequently, the strategy of synergistic utilization of cofactors was proposed and successfully applied to realize the production of L-homoserine, and finally the yield of L-homoserine of the engineering strain reached 85.29 g / L. Chen et al. provided a strategy of replacing the 5' untranslated region (5'UTR) of the citrate synthase gene gltA to weaken the transcription level. When the transcription is reduced to 56.1% of the original strain, the yield is increased by 38%, and finally 125.07 g / L of L-homoserine is obtained in a 5L bioreactor, which is the highest yield reported so far without plasmid, antibiotic and inducer.
[0005] However, there are still some deficiencies in the process of producing L-homoserine and its derivatives by biological method at present, such as low fermentation yield or low sugar acid conversion rate, which makes it difficult to carry out industrial production. Therefore, it is still a challenge to construct an efficient microbial cell factory for the production of L-homoserine and its derivatives. (III) SUMMARY
[0006] The purpose of the present application is to provide a genetically engineered strain for high-yield L-homoserine and its construction method and application, which overcomes the problems of low yield of L-homoserine production strain in fermentation production of L-homoserine, the need to add essential amino acids in the fermentation process, and the difficulty in industrial production in the prior art.
[0007] The technical scheme adopted by the present application is:
[0008] In a first aspect, the present invention provides a genetically engineered bacterium that produces high levels of L-homoserine. The engineered bacterium uses strain E. coli W3110ΔmetJΔmetIΔmetBΔthrBΔmetAΔlysAΔlacI::Ptrc-rhtAΔiclRΔptsGΔgalR Ptrc-metL Ptrc-thrA Ptrc-rhtA Ptrc-eamA Ptrc-glk Ptrc-gltB as the starting strain, and performs one or more of the following genome edits: (1) The genome of the bacterium produced by the self-regulating promoter P fliA (2) The lysA gene, whose original start codon is replaced with the GTG start codon, is integrated into the ycdN gene site. (3) The metA gene, whose original start codon is replaced with the GTG start codon, is integrated into the original site of the metA gene in its genome. The metB gene, whose original start codon is replaced with the GTG start codon, is integrated into the ydeU gene site. (4) The T7 RNA polymerase gene from T7 phage and the dCas9 gene from plasmid pdCas9 are integrated with the promoter P from the endogenous quorum sensing system of Escherichia coli. lsr Linked and integrated into the ompT gene site in the genome, (5) the promoter is replaced with the strong promoter P. trc (6) Integrate the lysC gene into the yegP gene site; (7) Integrate the thrA gene into the ygaY gene site; (8) Integrate the thrA gene into the rpnD gene site after mutating the G at the 1024th base to A; (9) Replace the promoter of the aspC gene with the strong promoter P. T7 (9) The 1024th base G of the thrA gene was mutated to A and then integrated into the yjiT gene site. (10) The 1024th base G of the thrA gene was mutated to A and then integrated with the sgRNA carrying the 20bp sequence of the target sthA gene into the yeeJ gene site. (11) The promoter of the pntAB gene was replaced with the strong promoter P. trc (12) Knock out the LsrFG gene, (13) Replace the original promoter of the ptsG gene with the strong promoter P. trc (14) Replace the promoter with a strong promoter P trc The pyc gene is integrated into the yeeP gene site, (15) and the promoter is replaced with the strong promoter P. trc The ppc gene is integrated into the yjh gene site, (16) and the promoter is replaced with the strong promoter P. trc The pyc gene is integrated into the yjgX gene locus.
[0009] The present application mainly surrounds the strain modification for improving the fermentation level of L-homoserine, but the starting strain E.coli W3110ΔmetJΔmetIΔmetBΔthrBΔmetAΔlysAΔlacI::Ptrc-rhtAΔiclRΔptsGΔgalR Ptrc-metL Ptrc-thrA Ptrc-rhtA Ptrc-eamA Ptrc-glk Ptrc-gltB is auxotrophic, and the key genes thrB, lysA, metA and metB in the L-lysine, L-threonine and L-methionine synthesis pathway are deleted in the genome, which leads to the inevitable need for exogenous addition of essential amino acids in the fermentation process, causing slow growth of the strain, and the fermentation process is not easy to control, and the additional required amino acids not only increase the fermentation cost of the process but also increase the operation complexity. The present application weakens the protein expression level, such as using a self-regulating promoter or replacing a relatively weak initiation codon (such as GTG initiation codon) to replace the static knockout, so that the strain is more suitable for industrial production. The construction process includes: expression weakening and complementation of the key genes thrB, lysA, metA and metB in the genome of the starting strain for synthesizing essential amino acids threonine, lysine and methionine; integration of the genomic ompT gene site into the promoter P lsr and the T7 RNA polymerase gene derived from T7 phage and the dCas9 gene derived from plasmid pdCas9; integration of 1 aspartate kinase III gene lysC at the yegP gene site; insertion of thrA at the ygaY gene site, and insertion of 1 anti-feedback inhibition gene thrA fbr at the rpnD, yjiT and yeeJ gene sites; replacing the in-situ promoter of the aspartate transaminase gene aspC with a strong promoter P T7 ; replacing the in-situ promoter of the pyridine nucleotide transhydrogenase gene pntAB, ptsG with a strong promoter P trc ; knocking out the LsrFG gene; replacing the promoter of the pyc gene with a strong promoter P trc ; integrating the ppc gene with a strong promoter P trc at the yjh gene site; integrating the pyc gene with a strong promoter P trc at the yjgX gene site, to finally obtain a recombinant genetically engineered strain of non-induction, plasmid-free and high-yield L-homoserine.
[0010] The genetically engineered strain of high-yield L-homoserine of the present application is preferably constructed according to the following steps: in the genome of the starting strain, first introduce the self-regulating promoter P fliAThe expression of the key gene of by-product amino acid L-threonine synthesis, homoserine kinase encoding gene thrB, is dynamically regulated and integrated into the yjiV gene site. The original start codon of diaminopimelic acid decarboxylase encoding gene lysA is replaced by a relatively weak GTG start codon, so that the translation level of the gene is weakened to express protein, and the gene is integrated into the ycdN gene site to produce lysine that can be utilized by itself. The original start codon of metA and metB genes is replaced by a relatively weak GTG start codon, and the metA gene with the replaced start codon is integrated into the original site of the metA gene in the genome, while the metB gene with the replaced start codon is integrated into the ydeU gene site in the genome, so that methionine that can be utilized by itself is produced. The original site promoter of pyridine nucleotide transhydrogenase encoding gene pntAB is replaced by a strong promoter, and an sgRNA carrying a 20bp sequence of target sthA gene is integrated into the yeeJ site to increase the content of intracellular NADPH. The original promoter of aspartate transaminase gene aspC is replaced by T7 promoter to increase the content of aspartate in the exponential phase. The ygaY, rpnD, yjiT and yeeJ genes are knocked out, and a copy number of genes encoding anti-feedback inhibition aspartate kinase I and homoserine dehydrogenase I thrA or thrA fbr is inserted into the knockout ygaY, rpnD, yjiT and yeeJ gene sites to increase the carbon flow of the main synthesis pathway; the original promoter of the ptsG gene is replaced by a strong promoter P trc to increase the sugar uptake capacity; a promoter P lsr derived from the regulation of the endogenous quorum sensing system of Escherichia coli and T7 RNA polymerase gene derived from T7 phage and dCas9 gene derived from plasmid pdCas9 are integrated into the ompT gene site to construct a dual-function gene regulation circuit regulated by quorum sensing; the LsrFG gene is knocked out to improve the sensitivity of the dual-function gene regulation circuit; the yeeP, yjh and yjgX genes are knocked out, and a copy number of pyruvate carboxylase pyc, phosphoenolpyruvate carboxylase ppc and pyruvate carboxylase pyc are inserted into the knockout yeeP, yjh and yjgX gene sites to improve the supply of precursor oxaloacetate.
[0011] The initial strain E. coli W3110ΔmetJΔmetIΔmetBΔthrBΔmetAΔlysAΔlacI::Ptrc-rhtAΔiclRΔptsGΔgalR Ptrc-metL Ptrc-thrA Ptrc-rhtA Ptrc-eamA Ptrc-glk Ptrc-gltB has been disclosed in the paper Liu P, Zhang B, Yao Z H, et al. Multiplex design of metabolic network for production of L-homoserine in Escherichia coli [J]. Applied and Environmental Microbiology, 2020, 86(20).
[0012] As preferred, the P fliA The nucleotide sequence of the promoter is shown as SEQ ID NO. 1.
[0013] As preferred, the strong promoter P trc The nucleotide sequence is shown as SEQ ID NO. 2.
[0014] As preferred, the strong promoter P T7 The nucleotide sequence is shown as SEQ ID NO. 3.
[0015] As preferred, the nucleotide sequence of the quorum sensing promoter Lsr gene promoter is shown as SEQ ID NO. 4.
[0016] As preferred, the nucleotide sequence of the 20bp sgRNA of the target sthA gene is shown as SEQ ID NO. 5.
[0017] As preferred, the nucleotide sequence of the pyc gene is shown as SEQ ID NO. 6.
[0018] As preferred, the nucleotide sequence of the thrB gene is shown as Gene ID: 7068, the nucleotide sequence of the lysA gene is shown as Gene ID: 947313, the nucleotide sequence of the metA gene is shown as Gene ID: 948513, and the nucleotide sequence of the metB gene is shown as Gene ID: 948434.
[0019] As preferred, the nucleotide sequence of the dCas9 gene is as shown in Gene ID: 69900935, the nucleotide sequence of the T7 RNA polymerase gene is as shown in Gene ID: 1261050, the nucleotide sequence of the lysC gene is as shown in Gene ID: 948531, the nucleotide sequence of the thrA gene is as shown in Gene ID: 945803, the nucleotide sequence of the pntAB gene is as shown in Gene ID: 946628, the nucleotide sequence of the ptsG gene is as shown in Gene ID: 945651, the nucleotide sequence of the LsrFG gene is as shown in Gene ID: 946071, Gene ID: 946073, and the nucleotide sequence of the ppc gene is as shown in Gene ID: 948457.
[0020] In a second aspect, the present application provides a method for constructing the genetically engineered bacteria with high L-homoserine production, which uses the strain E. coli W3110ΔmetJΔmetIΔmetBΔthrBΔmetAΔlysAΔlacI::Ptrc-rhtAΔiclRΔptsGΔgalR Ptrc-metL Ptrc-thrA Ptrc-rhtA Ptrc-eamA Ptrc-glk Ptrc-gltB as the starting strain and is constructed according to the following steps:
[0021] (1) using the CRISPR-Cas9 system, the thrB gene started by the promoter P fliA is integrated into the yjiV gene site in the genome of the starting strain, and the engineered bacteria thus obtained are recorded as strain H1;
[0022] (2) using the CRISPR-Cas9 system, the original start codon of the lysA gene is replaced with the GTG start codon, and the lysA gene is integrated into the ycdN gene site in the genome of the strain H51, and the engineered bacteria thus obtained are recorded as strain H2;
[0023] (3) using the CRISPR-Cas9 system, the original start codon of the metA gene is replaced with the GTG start codon, the original start codon of the metB gene is replaced with the GTG start codon, and the metA gene and the metB gene with the replaced start codon are integrated into the original site of the metA gene and the ydeU gene site in the genome of the strain H52, respectively, and the engineered bacteria thus obtained are recorded as strain H3;
[0024] (4) using the CRISPR-Cas9 system, the T7 RNA polymerase gene and the dCas9 gene are integrated into the yddG gene site in the genome of the strain H53, and the engineered bacteria thus obtained are recorded as strain H4; lsrFusion, and integrate the fusion gene fragment into the ompT gene site of the genome of strain HS3, and the obtained engineering strain is recorded as strain H4;
[0025] (5) Insert lysC gene into yegP gene site of the genome of strain H4 by using CRISPR-Cas9 system, and the obtained engineering strain is recorded as strain H5;
[0026] (6) Insert thrA gene into ygaY gene site of the genome of strain H5 by using CRISPR-Cas9 system, and the obtained engineering strain is recorded as strain H6;
[0027] (7) Insert thrA gene after mutating the 1024th base G to A in rpnD gene site of the genome of strain H6 by using CRISPR-Cas9 system, and the obtained engineering strain is recorded as strain H7;
[0028] (8) Replace the promoter of aspC gene in the genome of strain H7 with strong promoter P T7 , and the obtained engineering strain is recorded as strain H8;
[0029] (9) Replace yjiT gene in the genome of strain H8 with thrA gene after mutating the 1024th base G to A by using CRISPR-Cas9 system, and the obtained engineering strain is recorded as strain H9;
[0030] (10) Insert thrA gene after mutating the 1024th base G to A and an sgRNA carrying 20bp sequence of target sthA gene into yeeJ gene site of the genome of strain H9 by using CRISPR-Cas9 system, and the obtained engineering strain is recorded as strain H10;
[0031] (11) Replace the promoter of pntAB gene in the genome of strain H10 with strong promoter P trc , and the obtained engineering strain is recorded as strain HS11;
[0032] (12) Knock out LsrFG gene in the genome of strain HS11 by using CRISPR-Cas9 system, and the obtained engineering strain is recorded as strain HS12;
[0033] (13) Complementally integrate strong promoter P trc regulated ptsG gene into the site where ptsG gene has been knocked out in the genome of strain HS12 by using CRISPR-Cas9 system, and the obtained engineering strain is recorded as strain HS13;
[0034] (14) The yeeP gene in the genome of strain HS13 is replaced by the strong promoter P trc regulated pyc gene, and the obtained engineering strain is recorded as strain HS14.
[0035] (15) The yjh gene in the genome of strain HS14 is replaced by the strong promoter P trc regulated ppc gene, and the obtained engineering strain is recorded as strain HS15.
[0036] (16) The yjgX gene in the genome of strain HS15 is replaced by the strong promoter P trc regulated pyc gene, and the obtained engineering strain is recorded as strain HS16.
[0037] In a third aspect, the present application provides the use of the genetically engineered strain for producing L-homoserine by fermentation.
[0038] As a preferred embodiment, the genetically engineered strain is streaked on a LB solid plate and incubated at 37℃ for 12 hours; a single colony on the plate is picked and inoculated into a LB liquid medium and incubated at 37℃ in a constant temperature shaking incubator at 200 rpm for 10 hours as a seed liquid for shake flask fermentation; the seed liquid is inoculated into a flask containing a fermentation medium at a volume concentration of 5%, and the fermentation is carried out at 25-35℃, 100-200 rpm (preferably 30℃, 180 rpm), and the culture solution is separated and purified to obtain L-homoserine.
[0039] As a preferred embodiment, the fermentation medium is composed of glucose 40 g / L, (NH4)2SO4 16 g / L, yeast extract 4 g / L, KH2PO4 1 g / L, MgSO4 1 g / L, FeSO4·7H2O 0.005 g / L, MnSO4·7H2O 0.005 g / L, ZnSO4 0.005 g / L, CaCO3 25 g / L, and deionized water as a solvent, and the pH value is 6.8.
[0040] As preferred, the fermentation is carried out in a fermenter by the following steps: the genetically engineered bacteria are streaked on LB plates, and after overnight culture at 37℃ until colonies grow, a single colony with uniform cell morphology is picked and inoculated into a test tube containing LB liquid medium, and cultured overnight at 37℃ and 180 rpm; the test tube seed liquid is inoculated into a flask containing LB liquid medium at a volume concentration of 0.5%, and cultured at 37℃ and 180 rpm for 8-10 h; the flask seed liquid is inoculated into a fermenter containing fermentation medium at a volume concentration of 10%; and the culture is carried out at 33℃ and an initial aeration amount of 4 VVM, when the pH is greater than 6.82, the temperature is adjusted to 30℃, the aeration amount is 8 VVM, automatic feeding is started, and the pH is maintained at 6.80, to obtain a fermentation liquid containing L-homoserine;
[0041] The formula of the fermentation medium in the fermenter is: glucose 20 g / L, (NH4)2SO4 17 g / L, yeast extract 4 g / L, KH2PO4 1 g / L, MgSO4 1 g / L, betaine 2 g / L, metal mixed solution 1 mL / L, and defoaming agent 1 mL / L; the metal mixed solution is composed of FeSO4·7H2O 0.005 g / L, MnSO4·8H2O 0.0025 g / L, and ZnSO4 0.005 g / L, and the solvent is water; and the formula of the feeding medium is: glucose 500 g / L, KH2PO4 12.5 g / L, betaine 2 g / L, and NaHCO3 10 g / L, and the solvent is water.
[0042] Compared with the prior art, the present application has the following beneficial effects:
[0043] The present application uses a dual-function gene regulation circuit regulated by quorum sensing, thereby dynamically balancing the carbon flow of bacterial growth and product production, achieving efficient utilization of carbon sources, and improving the sugar acid conversion rate of L-homoserine synthesis. When the genetically engineered bacteria HS3 in the present application is used to produce L-homoserine by fermentation, there is no need to add essential amino acids exogenously, which reduces the fermentation cost, solves the uncertainty of the timing of essential amino acid addition in the fermentation process, reduces the operation difficulty of fermentation regulation, and increases the L-homoserine yield in the flask from 7.62 g / L obtained by adding three essential amino acids to 9.90 g / L without adding exogenous amino acids. On the basis of the non-nutritional auxotrophic strain, the key gene is overexpressed to obtain strain HS16, and the yield of strain HS16 reaches 18.65 g / L in flask fermentation, which is increased by 144.75%. The product concentration reaches 142.15 g / L in 5L fermenter fermentation of the engineering strain HS16 for 88 h, and the sugar acid conversion rate is 0.45 g / g glucose, which is increased by 278.36% compared with 37.57 g / L of the initial strain HS33. The L-homoserine yield is significantly improved, and has good application prospect. (IV) DESCRIPTION OF DRAWINGS
[0044] Figure 1 Biomass OD for strain HS1-HS16 600 and L-homoserine concentration.
[0045] Figure 2 Biomass OD for strain HS33 in 5-L fed-batch fermentation 600 and L-homoserine concentration.
[0046] Figure 3 Biomass OD for strain HS16 in 5-L fed-batch fermentation 600 and L-homoserine concentration.
[0047] Figure 4 Biomass OD for strain HS12 in 5-L fed-batch fermentation 600 and L-homoserine concentration. (V) DETAILED DESCRIPTION
[0048] The application will be further described below in connection with specific embodiments, but the scope of the application is not limited to only these embodiments:
[0049] Those of ordinary skill in the art will be able to implement the application based on these descriptions. In addition, the embodiments of the application involved in the following descriptions are generally only embodiments of a part of the application, rather than all embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art based on the embodiments in the application without making creative efforts should belong to the scope of protection of the application. The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The experimental materials used in the following embodiments are all conventional biochemical reagents unless otherwise specified.
[0050] The chassis strain of the application is recombinant E. coli W3110ΔmetJΔmetIΔmetBΔthrBΔmetAΔlysAΔlacI::Ptrc-rhtAΔiclRΔptsGΔgalR Ptrc-metL Ptrc-thrA Ptrc-rhtA Ptrc-eamA Ptrc-glk Ptrc-gltB, denoted as strain HS33, which has been disclosed in the paper Liu P, Zhang B, Yao ZH, et al. Multiplex design of metabolic network for production of L-homoserine in Escherichia coli [J]. Applied and Environmental Microbiology, 2020, 86 (20).
[0051] The genes involved in the strain modification process and the corresponding pathways are shown in Table 1, and the primer sequences are shown in Table 2.
[0052] Table 1 Genes involved in strain modification and corresponding pathways
[0053]
[0054]
[0055] Table 2 Primer sequences
[0056]
[0057]
[0058]
[0059]
[0060] Example 1, construction of strain HS1
[0061] Since the chassis strain HS33 knocks out the key gene thrB encoding threonine synthesis, it is inevitable to add additional threonine during the fermentation process of the strain, which increases the production cost and operational complexity, therefore the key gene thrB of strain HS33 is back-supplemented, and the P fliA promoter is expressed to dynamically regulate the synthesis of threonine, so that more carbon flow can flow to the synthesis of target products.
[0062] A copy of thrB gene is inserted into the yjiV site in the genome of strain HS33 through CRISPR-Cas9 system, and the specific operation is as follows:
[0063] (1) Connecting fragment U yjiV -P fliA -thrB-D yjiV
[0064] Using the E. coli W3110 genome as a template, the upstream and downstream homologous arms of the gene yjiV were amplified using primers yjiV-dof-f and yjiV-dof-r, yjiV-dor-f and yjiV-dor-r, respectively. The upstream and downstream homologous arms of the gene yjiV were amplified using primers thrB-F and thrB-R, P... fliA -F and P fliA -R amplifies thrB and promoter P, respectively. fliA The gene fragment (nucleotide sequence as shown in SEQ ID NO. 1) was analyzed by PCR product by 1.0% agarose gel electrophoresis. The fragment was then treated with DpnI at 37°C for 1 h. Finally, the purified fragment was recovered using a Clean Up kit. The purified fragment was then subjected to fusion PCR using primers yjiV-dof-f and yjiV-dor-r to obtain the ligation fragment U. yjiV -P fliA -thrB-D yjiV The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 1.5 min, repeated for 30 cycles; extension at 72℃ for 10 min.
[0065] (2) Constructing the pTarget-thrB(yjiV)-sg vector
[0066] Using pTarget plasmid as a template and yjiV-F and yjiV-R as primers, the pTarget-thrB(yjiV)-sg mutant vector expressing the sgRNA (nucleotide sequence shown in SEQ ID NO.7) of the target gene yjiV was amplified. Then, the pTarget-thrB(yjiV)-sg plasmid was linearized using pTarget-line-F and pTarget-line-R as primers. The PCR reaction conditions were as follows: 95℃ for 5 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 2.5 min, repeated for 30 cycles; extension at 72℃ for 10 min.
[0067] SEQ ID NO.1:cccctcatttcacccactaatcgtccgattaaaaaccctgcagaaacggataatcatgccgataactcatataacgcagggctgtttatc
[0068] SEQ ID NO. 7: GAAGTGTTTAATGAAAACGGGTTTTAGAGCTAGAAATAGCAAGTTAAAA
[0069] TAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0070] (3) Construction of pTarget-P fliA -thrB(yjiV) plasmid
[0071] The ligated fragment U yjiV -P fliA -thrB-D yjiV and the linearized mutant vector pTarget-thrB(yjiV)-sg in step (2) were subjected to one-step cloning, and the reaction procedure was as follows: 37 °C for 30 min; the cloning product was transformed into E. coli DH5a recipient bacteria, and was coated on LB solid plates containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance, and was cultured at 37 °C for 12 h. Positive clone strains were picked and transferred to LB liquid medium containing a final concentration of 50 mg / L spectinomycin hydrochloride resistance, and was cultured at 37 °C for 12 h. The pTarget-P fliA -thrB(yjiV) plasmid was obtained using a plasmid extraction kit.
[0072] (4) Construction of strain HS1
[0073] Strain HS33 transformed with pCas9 vector (purchased from Youzhe Biological Technology Co., Ltd.) was inoculated in 10 mL of LB liquid medium (containing 50 mg / L of kanamycin and 10 mM of L-arabinose), and was cultured at 30 °C, 180 rpm overnight as a seed liquid; 1 mL of the seed liquid was taken from the test tube and added to a 250 mL flask containing 50 mL of LB liquid medium, and was cultured at 30 °C, 180 rpm until the OD 600 value was about 0.6; the bacterial liquid was transferred from the flask to a 50 mL centrifuge tube precooled at 4 °C, and was centrifuged at 5000 rpm for 5 min at 4 °C, and the supernatant was discarded; 40 mL of sterile water precooled in advance was added, and the bacterial cells were gently blown and suspended, and were centrifuged at 5000 rpm for 5 min at 4 °C, and the supernatant was discarded; the above step was repeated; 40 mL of 10% (v:v) glycerol solution precooled in advance was added, and the bacterial cells were gently blown and suspended, and were centrifuged at 5000 rpm for 5 min at 4 °C, and the supernatant was discarded; 1 mL of 10% (v:v) glycerol solution precooled in advance was added, and the suspended bacterial cells were gently blown.
[0074] The prepared electrotransformation competent cells were placed on ice until they were melted, and 5 μL of plasmid pTarget-P fliA- thrB (yjiV), the mixed plasmid competent cells were added into the pre-cooled 2 mm electric shock cup, the working parameters of the electric transfection instrument were adjusted to 2500 V, 25 pF, 200 W for electric shock, 800 mL LB medium was quickly added, and the culture was carried out at 30°C, 180 rpm for 3 h; the bacteria liquid after electric transformation was coated on the LB plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin resistance, and cultured at 30°C for 24 h. A single colony was picked as a template, and primers thrB-VF and thrB-VR were used for PCR. The PCR product had a 1800 bp DNA band in 1.0% agarose gel, indicating that the successful insertion of P fliA - thrB of the positive clone strain HS1.
[0075] The correct strain was verified and picked into LB medium containing 50 mg / L kanamycin and 5 mM IPTG (isopropyl thiogalactoside) and cultured at 30°C for 12 h to eliminate the pTarget plasmid. A single colony that successfully verified the elimination of the pTarget plasmid was picked into a test tube containing 10 mL LB medium and cultured overnight at 42°C to eliminate the pCas plasmid (the pCas plasmid is temperature-sensitive and is easily lost when cultured above 37°C); finally, a plasmid-free strain was obtained and recorded as strain HS1.
[0076] Example 2, construction of strain HS2
[0077] Similarly, the key gene lysA for synthesizing the essential amino acid lysine was also complemented, further reducing the fermentation cost, and the relatively weak start codon GTG was used to reduce the expression level of the protein. A copy of the lysA gene was inserted into the ycdN gene site in the genome of strain HS1 by the CRISPR-Cas9 system, and the specific operation was as follows:
[0078] (1) Linker fragment U ycdN - lysA-D ycdN
[0079] Using the E. coli W3110 genome as a template, the upstream and downstream homologous arms of the ycdN gene were amplified using primers ycdN-dof-f and ycdN-dof-r, ycdN-dor-f and ycdN-dor-r, respectively, and the lysA gene fragment was amplified using primers lysA-F and lysA-R. After the PCR products were detected by 1.0% agarose gel electrophoresis, they were treated with DpnI at 37°C for 1 h, and finally the fragments were purified using a Clean Up kit. The purified fragments were fused by PCR using primers ycdN-dof-f and ycdN-dor-r to obtain linker fragment U ycdN -(GTG)lysA-D ycdNPCR reaction conditions: 95°C 5 min; 95°C 30 s, 58°C 30 s, 72°C 1.5 min, repeat 30 cycles; 72°C continue extension 10 min.
[0080] (2) Construction of pTarget-lysA(ycdN)-sg vector
[0081] The pTarget-lysA(ycdN)-sg mutant vector capable of expressing the sgRNA (nucleotide sequence as shown in SEQ ID NO. 8) of the target gene ycdN was amplified using the pTarget plasmid as a template and ycdN-F and ycdN-R as primers, and then the pTarget-lysA(ycdN)-sg plasmid was linearized using pTarget-line-F and pTarget-line-R as primers; PCR reaction conditions: 95°C 5 min; 95°C 30 s, 58°C 30 s, 72°C 2.5 min, repeat 30 cycles; 72°C continue extension 10 min.
[0082] SEQ ID NO. 8: tatcttaagcgtacccagcgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG
[0083] TCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0084] (3) Construction of pTarget-(GTG)lysA(ycdN) plasmid
[0085] The ligation fragment U in step (1) ycdN -lysA-D ycdNThe linearized mutant vector pTarget-lysA(ycdN)-sg in step (2) was used for one-step cloning, and the reaction procedure was as follows: 37 °C for 30 min. The cloning product was transformed into E. coli DH5a recipient bacteria, and then coated on LB solid plates containing 50 mg / L of final concentration of spectinomycin hydrochloride resistance and cultured at 37 °C for 12 h. Positive clone strains were picked and transferred to LB liquid medium containing 50 mg / L of final concentration of spectinomycin hydrochloride resistance and cultured at 37 °C for 12 h. The pTarget-lysA(ycdN) plasmid was obtained using a plasmid extraction kit. Finally, the pTarget-lysA(ycdN) plasmid was used as a template, and primers lysA(G)-F and lysA(G)-R were used for PCR to mutate the start codon of lysA to GTG. The PCR product was transformed into E. coli DH5a recipient bacteria, and then coated on LB solid plates containing 50 mg / L of final concentration of spectinomycin hydrochloride resistance and cultured at 37 °C for 12 h. Positive clone strains were picked and transferred to LB liquid medium containing 50 mg / L of final concentration of spectinomycin hydrochloride resistance and cultured at 37 °C for 12 h. The pTarget-(GTG)lysA(ycdN) plasmid was obtained using a plasmid extraction kit.
[0086] (4) Construction of strain HS2
[0087] The strain HS1 transformed with the pCas9 vector was inoculated in 10 mL of LB liquid medium (containing 50 mg / L of kanamycin and 10 mM of L-arabinose) and cultured at 30 °C and 180 rpm overnight as a seed liquid. 1 mL of the seed liquid was taken from a test tube and added to a 250 mL flask containing 50 mL of LB medium, which was then cultured at 30 °C and 180 rpm until the OD 600 The bacterial liquid was transferred from the flask to a 50 mL centrifuge tube precooled at 4 °C, centrifuged at 5000 rpm for 5 min, and the supernatant was discarded. 40 mL of sterile water precooled in advance was added, and the bacterial liquid was gently blown and suspended. The bacterial liquid was centrifuged at 5000 rpm for 5 min at 4 °C, and the supernatant was discarded. The above step was repeated. 40 mL of 10% (v:v) glycerol solution precooled in advance was added, and the bacterial liquid was gently blown and suspended. The bacterial liquid was centrifuged at 5000 rpm for 5 min at 4 °C, and the supernatant was discarded. 1 mL of 10% (v:v) glycerol solution precooled in advance was added, and the bacterial liquid was gently blown and suspended.
[0088] The prepared electrocompetent cells were placed on ice, and after thawing, 5 μL of plasmid pTarget-(GTG)lysA(ycdN) was added. The competent cells mixed with the plasmid were added to a pre-cooled 2 mm electroporation cup, and the working parameters of the electroporator were adjusted to 2500 V, 25 μF, and 200 Ω for electroporation. Then, 800 mL of LB medium was quickly added, and the mixture was incubated at 30 °C and 180 rpm for 3 h. The electrotransformed bacterial solution was spread on an LB plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin resistance, and incubated at 30 °C for 24 h. A single colony was picked as a template for PCR using primers lysA-VF and lysA-VR. The PCR product showed a 2000 bp DNA band on a 1.0% agarose gel, confirming that the positive clone strain HS2 successfully inserted (GTG)lysA.
[0089] The correct strain was verified by picking a single colony into LB medium containing 50 mg / L kanamycin and 5 mM IPTG (isopropyl thiogalactoside) and incubating at 30 °C for 12 h to eliminate the pTarget plasmid. A single colony that successfully verified the elimination of the pTarget plasmid was picked into a test tube containing 10 mL of LB medium and incubated at 42 °C overnight to eliminate the pCas plasmid (the pCas plasmid is temperature-sensitive and is easily lost when incubated at more than 37 °C). Finally, the plasmid-free strain was obtained and denoted as strain HS2.
[0090] Example 3, Construction of Strain HS3
[0091] To further optimize the fermentation conditions, the key genes metA and metB for synthesizing methionine were also complemented, and a non-nutritional auxotrophic strain without exogenous addition of amino acids was constructed. The GTG-initiated metA gene was successfully replaced into the metA original gene site using CRISPR / Cas9 gene editing technology, and the GTG-initiated metB gene was successfully replaced into the ydeU gene site. The specific operation is as follows:
[0092] 1. The complementation process of the key gene metA is as follows:
[0093] (1) Linker fragment U 原 -metA-D 原
[0094] The genomic DNA of E. coli W3110 was used as a template, and the upstream and downstream homologous arms at the metA original site were amplified using primers metA-dof-f and metA-dof-r, and metA-dor-f and metA-dor-r, respectively. The metA gene fragment was amplified using primers metA-F and metA-R. The PCR products were detected by 1.0% agarose gel electrophoresis and then treated with DpnI at 37°C for 1 h. Finally, the purified fragments were recovered using a Clean Up kit, and the ligation fragments U were obtained using the method of Example 1. 原 -metA-D 原 .
[0095] (2) Construction of pTarget-metA (original)-sg vector
[0096] The Target-metA (original)-sg mutant vector capable of expressing sgRNA (SEQ ID NO. 9) targeting the metA original site was amplified using the pTarget plasmid as a template and primers original metA-F and original metA-R. Then, the pTarget-metA (original)-sg plasmid was linearized using primers pTarget-line-F and pTarget-line-R.
[0097] SEQ ID NO. 9: GCGATTCAGCACCTTACCTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG
[0098] CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0099] (3) Construction of pTarget-(GTG)metA (original) plasmid
[0100] The ligation fragments U in step (1) 原 -metA-D 原 and the linearized mutant vector pTarget-metA (original)-sg in step (2) were subjected to one-step cloning, and the pTarget-metA (original) plasmid was obtained using the method of Example 1. Finally, the start codon of the mutant gene metA was changed to GTG using primers metA (G)-F and metA (G)-R for PCR amplification with the pTarget-metA (original) plasmid as a template, and the pTarget-(GTG)metA (original) plasmid was obtained using the method of Example 2.
[0101] (4) Construction of strain
[0102] The pTarget-(GTG)metA (original) plasmid was electroporated into the strain HS2 containing the pCas9 vector, and the method of Example 1 was used for the operation steps. PCR was performed using primer metA-VF and primer metA-VR, and a 1600 bp DNA band was present in the 1.0% agarose gel, confirming that the positive clone strain with successful insertion of (GTG)metA was obtained.
[0103] 2. On the basis of complementing metA, the key gene metB was complemented as follows:
[0104] (1) Linker U ydeU -metB-D ydeU
[0105] Using the E. coli W3110 genome as a template, the upstream and downstream homologous arms of the gene ydeU were amplified using primers ydeU-dof-f and ydeU-dof-r, and ydeU-dor-f and ydeU-dor-r, respectively, and the metB gene fragment was amplified using primers metB-F and metB-R. The PCR products were detected by 1.0% agarose gel electrophoresis and then treated with DpnI at 37°C for 1 h. Finally, the fragments were recovered and purified using a Clean Up kit, and the linker U was obtained using the method of Example 1. ydeU -metB-D ydeU .
[0106] (2) Construction of pTarget-metB (ydeU)-sg vector
[0107] The pTarget-metB (ydeU)-sg mutant vector capable of expressing the sgRNA (SEQ ID NO. 10) of the target gene ydeU was amplified using the pTarget plasmid as a template and primers ydeU-F and ydeU-R, and then the pTarget-metB (ydeU)-sg plasmid was linearized using primers pTarget-line-F and pTarget-line-R.
[0108] SEQ ID NO. 10: AACTTCATCACATGACGCGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG
[0109] CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0110] (3) Construction of pTarget-(GTG)metB (ydeU) plasmid
[0111] The ligation fragment U in step (1) ydeU -metB-D ydeU and step (2) linearized mutant vector pTarget-metB(ydeU)-sg, using the method of Example 1 to obtain the pTarget-metB(ydeU) plasmid; finally using the pTarget-metB(ydeU) plasmid as a template, using primers metB(G)-F and metB(G)-R to PCR amplify the start codon of the mutant gene metB as GTG, using the method of Example 2 to obtain the pTarget-(GTG)metB(ydeU) plasmid.
[0112] (4) Construction of strain HS3
[0113] The pTarget-(GTG)metB(ydeU) plasmid was electroporated into the strain of step 1 above containing the pCas9 vector, and the method of Example 1 was used to perform PCR with primers metB-VF and metB-VR. A 2000 bp DNA band was present in the 1.0% agarose gel, confirming that the positive clone strain HS3 with (GTG)metA and (GTG)metB successfully inserted was obtained.
[0114] Example 4, Construction of strain HS4
[0115] The dCas9 gene encodes a Cas9 protein without cleavage activity, only with the ability to bind to double-stranded DNA, without the ability to cut double-stranded DNA; the T7 RNA polymerase gene is an RNA polymerase from T7 phage, which has a 5-fold transcription speed improvement compared to the endogenous RNA polymerase of E. coli, and specifically recognizes the T7 promoter; the Lsr promoter is a bidirectional promoter of the endogenous quorum sensing Lsr system of E. coli, with the characteristics of low transcription level in the low cell density period (growth period) and high transcription level in the high cell density period (production period). In order to modularize the carbon flow in the growth and production periods, the dCas9 protein and T7 RNA polymerase are connected to the bidirectional quorum sensing promoter P lsr double-end, integrated into the ompT gene site of strain HS3 by CRISPR-Cas9 system, the specific operation is as follows:
[0116] (1) Ligation fragment T7RNA-P lsr -dCas9
[0117] The promoter lsr (nucleotide sequence as shown in SEQ ID NO. 4), gene T7 RNA polymerase and gene dCas9 were amplified using primers T7-QS-F and T7-QS-R, QS-f and QS-r, and lsr-f and lsr-r, respectively, with E. coli W3110 genome and plasmid dCas9 as templates, and fusion PCR was performed using primers T7-QS-F and QS-r, and the ligation fragment T7RNA-P was obtained using the method of Example 1. lsr -dCas9.
[0118] (2) Construction of pTarget-ompT-sg vector
[0119] The sgRNA (SEQ ID NO. 11) of the Target-ompT-sg mutant vector capable of expressing the target gene ompT was amplified using pTarget plasmid as a template and ompT-F and ompT-R as primers, and then pTarget-ompT-sg plasmid was linearized using pTarget-line-F and pTarget-line-R as primers.
[0120] SEQ ID NO. 4:
[0121] AATTCATTCTTCACTTTGAACATATTTAAATCTTTAATGCAATTGTTCAGTTCTTGTTCATTTATATCTGTGATGGCAACCACATTTTGACTCTACGAGCATGAACAAACGCAACCGTGAAAATCAAAATAGCATAAATTGTGATCTATTCGTCAGAAATATGTACAATGTCCACCTAAGGTTATGAACAAATTAAAAGCAGAAATACATTTGTTCAAAACTCACCTGCAAAACTGAACGGGGGAAAT
[0122] SEQ ID NO. 11: TACTCCTGACAACATAAATGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT
[0123] AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0124] (3) Construction of pTarget-T7RNA-P lsr -dCas9 plasmid
[0125] The ligation fragment T7RNA-P in step (1)lsr - dCas9 and linearized mutant vector pTarget-ompT-sg in step (2) for one-step cloning, and pTarget-T7RNA-P was obtained using the method of Example 1. lsr - dCas9 plasmid.
[0126] (4) Construction of strain HS4
[0127] pTarget-T7RNA-P lsr - dCas9 plasmid was electroporated into strain HS3 containing pCas9 vector, PCR was performed using primers ompT-VF and primers ompT-VR, and a 8501 bp DNA band was present in the 1.0% agarose gel, confirming that T7RNA-P lsr - dCas9 successfully replaced the positive clone strain HS4.
[0128] Example 5, Construction of strain HS5
[0129] Currently, there are three aspartate kinases in E. coli, aspartate kinase I (encoded by thrA), aspartate kinase II (encoded by metL), and aspartate kinase III (encoded by lysC) involved in the synthesis of L-homoserine, in order to accumulate the precursor 4-phosphohomoserine of L-homoserine and promote the accumulation of carbon flow in the synthesis pathway, a copy of lysC gene was introduced at the genomic yegP site by CRISPR-Cas9 system, and the specific operation was as follows:
[0130] (1) Ligation fragment U yegP - lysC-D yegP
[0131] Using E. coli W3110 genome as template, using primers yegP-lysC-dof-f and yegP-lysC-dof-r, yegP-lysC-dor-f and yegP-lysC-dor-r to amplify the upstream and downstream homologous arms of gene yegP, using primers yegP-lysC-F and using primers yegP-lysC-R to amplify the gene lysC, using primers yegP-lysC-dof-f and yegP-lysC-dor-r for fusion PCR, and the method of Example 1 was used to obtain the ligation fragment U yegP - lysC-D yegP .
[0132] (2) Construction of pTarget-yegP-sg vector
[0133] Using pTarget plasmid as a template, and with yegp-lysC-F and yepg-lysC-R primers, the pTarget-yegP-sg mutant vector, which can express the sgRNA (SEQ ID NO.12) of the target gene yegP, was amplified. Then, the pTarget-yegP-sg plasmid was linearized using pTarget-line-F and pTarget-line-R primers.
[0134] SEQ ID NO.12: tgcggaaaagggcatcgcgtGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT
[0135] ATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0136] (3) Constructing the pTarget-yegP-lysC plasmid
[0137] Connect the fragment U in step (1) yegP -lysC-D yegP The linearized mutant vector pTarget-yegP-sg from step (2) was cloned in one step to obtain the pTarget-yegP-lysC plasmid using the method described in Example 1.
[0138] (4) Construction of strain HS5
[0139] The pTarget-yegP-lysC plasmid was electroporated into the HS4 strain containing the pCas9 vector. PCR was performed using the method described in Example 1 with primers yegP-lysC-VF and yegP-lysC-VR. The PCR product showed a 2833bp DNA band on a 1.0% agarose gel, confirming the successful acquisition of a positive clone strain HS5 that integrates lysC at the yegP gene site.
[0140] Example 6: Construction of strain HS6
[0141] To increase the carbon flux from L-aspartate to L-homoserine, a copy of the thrA gene was introduced into the ygaY site of the genome using the CRISPR-Cas9 system. The specific steps are as follows:
[0142] (1) Connecting fragment U ygaY -thrA-D ygaY
[0143] The upstream and downstream homologous arms of the gene ygaY were amplified using primers ygaY-thrA-F and ygaY-thrA-R, respectively, using the E. coli W3110 genome as the template, and a fusion PCR was performed using primers ygaY-thrA-F and ygaY-thrA-R. The ligation fragment U was obtained using the method of Example 1. ygaY -thrA-D ygaY .
[0144] (2) Construction of pTarget-ygaY-sg vector
[0145] The pTarget-ygaY-sg mutant vector expressing sgRNA (SEQ ID NO. 13) of the target gene ygaY was amplified using the pTarget plasmid as the template and ygaY-thrA-F and ygaY-thrA-R as the primers, and then the pTarget-ygaY-sg plasmid was linearized using pTarget-line-F and pTarget-line-R as the primers.
[0146] SEQ ID NO. 13: GTGCTGATGTCTATCGCCACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT
[0147] AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0148] (3) Construction of pTarget-ygaY-thrA plasmid
[0149] The ligation fragment U in step (1) ygaY -thrA-D ygaY and the linearized mutant vector pTarget-ygaY-sg in step (2) were subjected to one-step cloning, and the pTarget-ygaY-thrA plasmid was obtained using the method of Example 1.
[0150] (4) Construction of strain HS6
[0151] The pTarget-ygaY-thrA plasmid was electroporated into the HS5 strain containing the pCas9 vector, and PCR was performed using the method of Example 1 using primers ygaY-thrA-VF and primers ygaY-thrA-VR. A 3962 bp DNA band was present in the 1.0% agarose gel, and it was confirmed that the positive clone strain HS6 in which thrA was successfully integrated at the ygaY gene site was obtained.
[0152] Example 7, Construction of Strain HS7
[0153] In order to improve the carbon flux from L-aspartate to L-homoserine, a copy of thrA gene was introduced at the rpnD site in the genome, but because the thrA gene is subject to feedback inhibition by L-threonine and L-isoleucine, a feedback inhibition-resistant thrA was obtained by site-directed mutagenesis fbr gene. The feedback inhibition-resistant thrA gene was inserted at the rpnD site in the HS6 genome by the CRISPR-Cas9 system, and the specific operations were as follows: fbr
[0154] (1) Linking fragment U rpnD -thrA-D rpnD
[0155] Using the E. coli W3110 genome as a template, the upstream and downstream homologous arms of the rpnD gene were amplified using primers rpnD-thrA-dof-f and rpnD-thrA-dof-r, and rpnD-thrA-dor-f and rpnD-thrA-dor-r, respectively, and the thrA gene fragment was amplified using primers rpnD-thrA-F and rpnD-thrA-R. The PCR products were detected by 1.0% agarose gel electrophoresis and then treated with DpnI at 37°C for 1 h, and finally the fragments were recovered and purified using a Clean Up kit. The linking fragment U was obtained using the method of Example 1. rpnD -thrA-D rpnD .
[0156] (2) Construction of pTarget-thrA(rpnD)-sg vector
[0157] Using the pTarget plasmid as a template, the pTarget-thrA(rpnD)-sg mutant vector capable of expressing sgRNA (SEQ ID NO. 14) of the target gene rpnD was amplified using primers rpnD-thrA-F and rpnD-thrA-R, and then the pTarget-thrA(rpnD)-sg plasmid was linearized using primers pTarget-line-F and pTarget-line-R.
[0158] GCTTTGTCGATGAAAAATTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
[0159] GCTTTGTCGATGAAAAATTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
[0160] (3) Construction of pTarget-thrA fbr (rpnD) plasmid
[0161] The ligation fragment U rpnD -thrA-D rpnD and the linearized mutant vector pTarget-thrA(rpnD)-sg in step (2) to obtain the pTarget-thrA(rpnD) plasmid by using the method of Example 1; finally, using the pTarget-thrA(rpnD) plasmid as a template, the 1024th base G of the gene thrA is mutated to A by using primers thrA(G)-F and thrA(G)-R for PCR amplification, and the pTarget-thrA fbr (rpnD) plasmid is obtained by using the method of Example 1.
[0162] (4) Construction of strain HS7
[0163] The pTarget-thrA fbr (rpnD) plasmid is electroporated into the HS6 strain containing the pCas9 vector, and PCR is performed by using primers rpn-thrA-vf and primers rpn-thrA-vf by using the method of Example 1. A 4051 bp DNA band is present in the 1.0% agarose gel, and it is confirmed that the positive clone strain HS7 successfully inserts the gene thrA at the rpnD site. fbr
[0164] Example 8, Construction of strain HS8
[0165] Further improve the carbon flux from L-aspartate to L-homoserine, realize the modularization of carbon flux in different periods of growth and production, replace the promoter of the aspC gene in the genome of HS7 by the T7 promoter through the CRISPR-Cas9 system, and the specific operation is as follows:
[0166] (1) Ligation fragment U aspC -P T7 -D aspC
[0167] Using the E. coli W3110 genome as a template, the upstream and downstream homologous arms of the promoter of the gene aspC are amplified by using primers ASPC-T7-DOF-F and ASPC-T7-DOF-R, ASPC-T7-DOR-F and ASPC-T7-DOR-R, respectively, P T7 The sequence (SEQ ID NO. 3) is contained in the above primer sequence; the PCR product is detected by 1.0% agarose gel electrophoresis, then treated with DpnI at 37°C for 1 h, and finally the purified fragment is recovered by Clean Up kit, and the ligation fragment U is obtained by the method of Example 1 aspC -P T7 -D aspC .
[0168] SEQ ID NO. 3: TAATACGACTCACTATAGG
[0169] (2) Construction of pTarget-aspC(P T7 )-sg vector
[0170] The sgRNA (SEQ ID NO. 15) of the Target-aspC(P T7 )-sg mutant vector capable of expressing the target gene aspC is amplified by using the pTarget plasmid as a template and using ASPC-T7-PM-F and ASPC-T7-PM-R as primers, and then the pTarget-aspC(P T7 )-sg plasmid is linearized by using pTarget-line-F and pTarget-line-R as primers.
[0171] SEQ ID NO. 15: GTGCTGATGTCTATCGCCACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG
[0172] TCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0173] (3) Construction of pTarget-aspC(P T7 ) plasmid
[0174] The ligation fragment U aspC -P T7 -D aspC in step (1) and the linearized mutant vector pTarget-aspC(P T7 )-sg in step (2) are subjected to one-step cloning, and the pTarget-aspC(P T7 ) plasmid is obtained by the method of Example 1.
[0175] (4) Construction of strain HS8
[0176] The pTarget-aspC(P T7) The plasmid was electroporated into the HS7 strain containing the pCas9 vector, and PCR was performed using the primer t7-aspc-vf and the primer t7-aspc-vr according to the method of Example 1. A 1710 bp DNA band was present in the 1.0% agarose gel, and a positive clone strain HS8 in which the aspC promoter was successfully replaced with the T7 promoter was confirmed.
[0177] Example 9, Construction of Strain HS9
[0178] To further improve the carbon flux from L-aspartate to L-homoserine, a copy of thrA fbr gene was introduced at the yjiT site in the genome of strain HS8 by the CRISPR-Cas9 system, according to the following specific operations:
[0179] (1) Ligation fragment U yjiT -thrA fbr -D yjiT
[0180] The upstream and downstream homologous arms of the gene yjiT were amplified using the primers yjiT-thrA-dof-f and yjiT-thrA-dof-r, and yjiT-thrA-dor-f and yjiT-thrA-dor-r, respectively, using the E. coli W3110 genome as the template; the thrA fbr gene fragment was amplified using the primers yjiT-thrA-f and yjiT-thrA-r using the pTarget-thrA fbr (rpnD) plasmid constructed in Example 7 as the template, and the PCR product was detected by 1.0% agarose gel electrophoresis and then treated with DpnI at 37°C for 1 h. Finally, the purified fragment was recovered using a Clean Up kit, and the ligation fragment U yjiT -thrA fbr -D yjiT .
[0181] (2) Construction of pTarget-thrA(yjiT)-sg vector
[0182] The pTarget-thrA(yjiT)-sg mutant vector capable of expressing sgRNA (SEQ ID NO. 16) of the target gene yjiT was amplified using the pTarget plasmid as the template and the primers yjiT-thrA-f and yjiT-thrA-r, and then the pTarget-thrA(yjiT)-sg plasmid was linearized using the primers pTarget-line-F and pTarget-line-R.
[0183] SEQ ID NO. 16: aaaacagcattacagccagcGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT
[0184] ATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0185] (3) Construction of pTarget-thrA fbr (yjiT) plasmid
[0186] The ligation fragment U in step (1) yjiT -thrA fbr -D yjiT and the linearized mutant vector pTarget-thrA (yjiT)-sg in step (2) were subjected to one-step cloning, and pTarget-thrA fbr (yjiT) plasmid was obtained using the method of Example 1.
[0187] (4) Construction of strain HS9
[0188] The pTarget-thrA fbr (yjiT) plasmid was electroporated into the HS8 strain containing the pCas9 vector, and PCR was performed using the primer yjiT-thrA-vf and the primer yjiT-thrA-vr using the method of Example 1. A 3379 bp DNA band was present in the 1.0% agarose gel, confirming that the positive clone strain HS9 was successfully inserted with the thrA gene at the yjiT site. fbr
[0189] Example 10, Construction of strain HS10
[0190] To further improve the carbon flux from L-aspartate to L-homoserine and increase the intracellular NADPH content, a copy of the thrA gene and an sgRNA carrying a 20 bp sequence of the target sthA gene were introduced at the yeeJ site in the genome of the strain HS9 by the CRISPR-Cas9 system, according to the following procedures: fbr
[0191] (1) Ligation fragment U yeeJ -sgRNA(sthA)-thrA fbr -D yeeJ
[0192] The genome of E. coli W3110 was used as a template, and the upstream and downstream homologous arms of gene yeeJ were amplified using primers yeeJ-thrA-dof-f and yeeJ-thrA-dof-r, and yeeJ-thrA-dor-f and yeeJ-thrA-dor-r, respectively; the pTarget-thrA fbr (rpnD) plasmid as a template, and the sgRNA (sthA) (nucleotide sequence as shown in SEQ ID NO. 5) and thrA fbr gene fragment were amplified using primers yeeJ-thrA-f and yeeJ-thrA-r. After the PCR product was detected by 1.0% agarose gel electrophoresis, it was treated with DpnI at 37°C for 1 h, and finally the purified fragment was recovered using a Clean Up kit. The ligation fragment U yeeJ -sgRNA (sthA) -thrA fbr -D yeeJ .
[0193] (2) Construction of pTarget-thrA (yeeJ)-sg vector
[0194] The pTarget plasmid was used as a template, and yeeJ-sgrna-f and yeeJ-sgrna-r were used as primers to amplify the Target-thrA (yeeJ)-sg mutant vector capable of expressing the sgRNA of the target gene yeeJ (SEQ ID NO. 17), and then pTarget-line-F and pTarget-line-R were used as primers to linearize the pTarget-thrA (yeeJ)-sg plasmid.
[0195] SEQ ID NO. 5
[0196] GAAAAATTTGTTATTGCCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC TTGAAAAAGTGGCACCGAGTCGGTGC
[0197] SEQ ID NO. 17
[0198] gagcgtacgcagattaacaaGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGC.
[0199] (3) Construction of pTarget-thrA fbrPlasmid of (yeeJ)
[0200] The ligation fragment U in step (1) yeeJ -sgRNA (sthA) -thrA fbr -D yeeJ One-step cloning was performed with the linearized mutant vector pTarget-thrA (yeeJ)-sg in step (2), and pTarget-thrA was obtained using the method of Example 1. fbr (yeeJ) plasmid.
[0201] (4) Construction of strain HS10
[0202] The pTarget-thrA fbr (yeeJ) plasmid was electroporated into the HS9 strain containing the pCas9 vector, and PCR was performed using the primer yeeJ-VF and the primer yeeJ-VR using the method of Example 1. The PCR product had a 2927 bp DNA band in a 1.0% agarose gel, confirming that the yeeJ site was successfully inserted into the gene thrA fbr and a positive clone strain HS10 carrying an sgRNA of a 20 bp sequence of the target sthA gene.
[0203] Example 11, Construction of strain HS11
[0204] Further improve the intracellular NADPH content, by CRISPR-Cas9 system with P trc The original promoter of the pntAB gene in the genome of the HS10 strain was replaced with the P promoter to enhance the expression of the pntAB gene, and the specific operation was as follows:
[0205] (1) Ligation fragment U pntAB -P trc -D pntAB
[0206] Using the E. coli W3110 genome as a template, the upstream and downstream homologous arms of the gene pntAB were amplified using primers pntAB-dof-f and pntAB-dof-r, pntAB-dor-f and pntAB-dor-r, respectively. The Ptrc promoter sequence (SEQ ID NO. 2) was included in the above primer sequences. Fusion PCR was performed using primers pntAB-dof-f and pntAB-dor-r, and the ligation fragment U was obtained using the method of Example 1. pntAB -P trc -D pntAB .
[0207] SEQ ID NO. 2: TTGACAATTAATCATCCGGCTCGTATAATG
[0208] (2) Construction of pTarget-pntAB-sg vector
[0209] The pTarget-pntAB-sg mutant vector capable of expressing sgRNA (SEQ ID NO. 18) of the target gene pntAB was amplified using the pTarget plasmid as a template and primers pntAB-sgrna-F and pntAB-sgrna-R, and then the pTarget-pntAB-sg plasmid was linearized using primers pTarget-line-F and pTarget-line-R.
[0210] SEQ ID NO. 18: TCGTACATGAGCAGCTTGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC
[0211] TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0212] (3) Construction of pTarget-P trc -pntAB plasmid
[0213] The ligation fragment U pntAB -P trc -D pntAB in step (1) and the linearized mutant vector pTarget-pntAB-sg in step (2) were subjected to one-step cloning, and the pTarget-P trc -pntAB plasmid was obtained using the method of Example 1.
[0214] (4) Construction of strain HS11
[0215] The pTarget-P trc -pntAB plasmid was electroporated into the HS10 strain containing the pCas9 vector, and the operation was performed using the method of Example 1. PCR was performed using primer pntAB-VF and primer pntAB-VR, and a 1412 bp DNA band was present in the 1.0% agarose gel, confirming that the positive clone strain HS11 successfully replaced the original promoter of pntAB.
[0216] Example 12, Construction of strain HS12
[0217] Further improve the sensitivity of the dual-function gene regulation circuit, through the CRISPR-Cas9 system to knock out the lsrgF gene of strain HS11 to enhance the sensitivity of the dual-function gene regulation circuit, the specific operation is as follows:
[0218] (1) Linking fragment U lsrFG -D lsrFG
[0219] Using the genome of E. coli W3110 as a template, the upstream and downstream homologous arms of the gene lsrgF were amplified using primers lsrgF-dof-f and lsrgF-dof-r, lsrgF-dor-f and lsrgF-dor-r, respectively, and a fusion PCR was performed using primers lsrgF-dof-f and lsrgF-dor-r. The linking fragment U was obtained using the method of Example 1. lsrFGc -D lsrFG .
[0220] (2) Construction of pTarget-lsrFG-sg vector
[0221] Using the pTarget plasmid as a template and using lsrgF-sgrna-F and lsrgF-sgrna-R as primers, a pTarget-lsrFG-sg mutant vector capable of expressing sgRNA (SEQ ID NO. 19) targeting the gene lsrgF was amplified, and then pTarget-line-F and pTarget-line-R were used as primers to linearize the pTarget-lsrFG-sg plasmid.
[0222] SEQ ID NO. 19: GTGGCGGCGCAGGTTTATATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT
[0223] AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0224] (3) Construction of pTarget-lsrFG plasmid
[0225] The linking fragment U lsrFG -D lsrF G in step (1) and the linearized mutant vector pTarget-lsrFG-sg in step (2) were subjected to one-step cloning, and the pTarget-lsrFG plasmid was obtained using the method of Example 1.
[0226] (4) Construction of strain HS12
[0227] The pTarget-lsrFG plasmid was electroporated into the HS11 strain containing the pCas9 vector, and PCR was performed using the primer lsrFG-VF and the primer lsrFG-VR according to the method of Example 1. A 1619 bp DNA band was present in the 1.0% agarose gel, and a positive clone strain HS12 in which the lsrFG gene was successfully knocked out was confirmed.
[0228] Example 13, Construction of Strain HS13
[0229] Further improve the sugar uptake rate, by CRISPR-Cas9 system to replace the original promoter of ptsG gene in the genome of strain HS12 to strong P trc Promoter, the specific operation is as follows:
[0230] (1) Connection fragment U ptsG -P trc -DptsG
[0231] Using the genome of E. coli W3110 as a template, the upstream and downstream homologous arms of the gene ptsG were amplified using the primers ptsG-dof-f and ptsG-dof-r, ptsG-dor-f and ptsG-dor-r, respectively. The Ptrc promoter sequence (SEQ ID NO. 2) was included in the above primer sequences. Fusion PCR was performed using the primers ptsG-dof-f and ptsG-dor-r, and the connection fragment U was obtained according to the method of Example 1. ptsG -P trc -D pntAB .
[0232] (2) Construction of pTarget-ptsG-sg vector
[0233] The pTarget-ptsG-sg mutant vector capable of expressing sgRNA (SEQ ID NO. 20) targeting the target gene ptsG was amplified using the pTarget plasmid as a template and the primers ptsG-sgrna-F and ptsG-sgrna-R. Then, the pTarget-ptsG-sg plasmid was linearized using the primers pTarget-line-F and pTarget-line-R.
[0234] SEQ ID NO. 20: GTAAGACGTTGGGGAGACTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
[0235] GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTG.
[0236] (3) Construction of pTarget-P trc -ptsG plasmid
[0237] The ligation fragment U ptsG -P trc -D ptsG and the linearized mutant vector pTarget-ptsG-sg in step (2) to obtain pTarget-P trc -ptsG plasmid by the method of Example 1.
[0238] (4) Construction of strain HS13
[0239] The pTarget-P trc -ptsG plasmid was electroporated into the HS12 strain containing the pCas9 vector, and PCR was performed using the primers ptsG-VF and ptsG-VR by the method of Example 1. A 1878 bp DNA band was present in the 1.0% agarose gel, and a positive clone strain HS13 with successful replacement of the ptsG gene promoter was confirmed.
[0240] Example 14, Construction of strain HS14
[0241] To further improve the intracellular content of oxaloacetate, a copy of P trc promoter expressed pyc gene to achieve the purpose of enhancing the expression of pyc gene, the specific operation is as follows:
[0242] (1) Ligation fragment U pyc -P trc -D pyc
[0243] The upstream and downstream homologous arms of the yeeP gene were amplified using the primers pyc-yeeP-dof-f and pyc-yeeP-dof-r, and pyc-yeeP-dor-f and pyc-yeeP-dor-r, respectively, using the E. coli W3110 genome as a template. The Ptrc promoter sequence (SEQ ID NO. 2) is included in the above primer sequences. Fusion PCR was performed using primers pyc-yeeP-dof-f and pyc-yeeP-dor-r, and the ligation fragment U pyc -P trc -D pyc .
[0244] (2) Construction of pTarget-pyc-sg vector
[0245] The sgRNA (SEQ ID NO. 21) capable of expressing the target gene pyc was amplified by using the pTarget plasmid as a template and yeeP-sgrna-F and yeeP-sgrna-R as primers, and then the pTarget-pyc-sg mutant vector was constructed. Then, the pTarget-pyc-sg plasmid was linearized by using pTarget-line-F and pTarget-line-R as primers.
[0246] GGACCGGATATTTGACACGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA
[0247] GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0248] (3) Construction of pTarget-P trc -pyc plasmid
[0249] The ligation fragment U pyc -P trc -D pyc and the linearized mutant vector pTarget-pyc-sg in step (2) were subjected to one-step cloning, and the pTarget-P trc -pyc plasmid was obtained by using the method in Example 1.
[0250] (4) Construction of strain HS14
[0251] The pTarget-P trc -pyc plasmid was electroporated into the HS13 strain containing the pCas9 vector, and PCR was performed by using primer pyc-yeeP-VF and primer pyc-yeeP-VR by using the method in Example 1. The 4769 bp DNA band was present in the 1.0% agarose gel, and it was confirmed that the P trc promoter was successfully introduced into the yeeP site of the pyc gene in the positive clone strain HS14.
[0252] Example 15, Construction of strain HS15
[0253] To further improve the content of intracellular oxaloacetate, one copy of P trc promoter was integrated into the yjh site of the genome of the strain HS14 by using the CRISPR-Cas9 system to achieve the purpose of enhancing the expression of the ppc gene. The specific operation was as follows:
[0254] (1) Ligation fragment U ppc -P trc-D ppc
[0255] The upstream and downstream homologous arms of the gene yjh were amplified using primers ppc-yjh-dof-f and ppc-yjh-dof-r, ppc-yjh-dor-f and ppc-yjh-dor-r, respectively, with the E. coli W3110 genome as the template, and the Ptrc promoter sequence (SEQ ID NO. 2) was included in the above primer sequences. Fusion PCR was performed using primers ppc-yjh-dof-f and ppc-yjh-dor-r, and the ligation fragment U was obtained using the method of Example 1. ppc -P trc -D ppc .
[0256] (2) Construction of pTarget-ppc-sg vector
[0257] The pTarget-ppc-sg mutant vector capable of expressing sgRNA (SEQ ID NO. 22) targeting the gene ppc was amplified using the pTarget plasmid as the template and yjh-sgrna-F and yjh-sgrna-R as the primers, and then the pTarget-ppc-sg plasmid was linearized using pTarget-line-F and pTarget-line-R as the primers.
[0258] SEQ ID NO. 22: TGGCCGATGAGCTGACCATTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG
[0259] TCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0260] (3) Construction of pTarget-P trc -ppc plasmid
[0261] Step (1) ligation fragment U ppc -P trc -D ppc and the linearized mutant vector pTarget-ppc-sg in step (2) were subjected to one-step cloning, and the pTarget-P trc -ppc plasmid was obtained using the method of Example 1.
[0262] (4) Construction of strain HS15
[0263] pTarget-P trc- ppc plasmid was electroporated into HS14 strain containing pCas9 vector, and the operation steps were performed according to the method of Example 1. PCR was performed using primer ppc-yjh-VF and primer ppc-yjh-VR, and a 4408 bp DNA band was present in the 1.0% agarose gel, confirming that a copy of P trc The positive clone strain HS15 of ppc gene expressed by the promoter was constructed.
[0264] Example 16, Construction of Strain HS16
[0265] Further increase the intracellular content of oxaloacetate, by CRISPR-Cas9 system in the strain HS15 genome yjgX site integration of a copy of P trc The pyc gene expressed by the promoter was constructed to achieve the purpose of enhancing the expression of the pyc gene, and the specific operation was as follows:
[0266] (1) Linker U pyc -P trc -D pyc
[0267] Using the genome of E. coli W3110 as a template, the upstream and downstream homologous arms of the gene yjgX were amplified using primers pyc-yjgX-dof-f and pyc-yjgX-dof-r, pyc-yjgX-dor-f and pyc-yjgX-dor-r, respectively. The Ptrc promoter sequence (SEQ ID NO. 2) was included in the above primer sequences. Fusion PCR was performed using primers pyc-yjgX-dof-f and pyc-yjgX-dor-r, and linker U was obtained using the method of Example 1. pyc -P trc -D pyc .
[0268] (2) Construction of pTarget-pyc-sg vector
[0269] Using pTarget plasmid as a template, yjgX-sgrna-F and yjgX-sgrna-R as primers, sgRNA (SEQ ID NO. 23) capable of expressing the target gene pyc was amplified, and pTarget-pyc-sg mutant vector was constructed. Then pTarget-line-F and pTarget-line-R were used as primers to linearize the pTarget-pyc-sg plasmid.
[0270] SEQ ID NO. 23: TGATTCCGGCAACAATGTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.
[0271] (3) Construction of pTarget-P trc -pyc plasmid
[0272] The ligated fragment U pyc -P trc -D pyc and the linearized mutant vector pTarget-pyc-sg in step (2) were subjected to one-step cloning, and pTarget-P trc -pyc plasmid was obtained using the method of Example 1.
[0273] (4) Construction of strain HS14
[0274] pTarget-P trc -pyc plasmid was electroporated into the HS15 strain containing the pCas9 vector, and PCR was performed using the method of Example 1 with primer pyc-yjgX-VF and primer pyc-yjgX-VR, and a 5277 bp DNA band was present in the 1.0% agarose gel, confirming that a copy of P trc pyc expressed from the promoter was successfully integrated at the yjgX site.
[0275] Example 17, Shake Flask Fermentation Test of Strains HS1-HS16
[0276] Fermentation tests were performed in shake flasks for the chassis strain HS33 and the strains (HS1, HS2, HS3, HS4, HS5, HS6, HS7, HS8, HS9, HS10, HS11, HS12, HS13, HS14, HS15, HS16) constructed in Examples 1-16 above to compare the ability of each genotype strain to produce L-homoserine.
[0277] Each strain was streaked onto LB agar plates and incubated at 37°C for 12 h. Single colonies from the plates were transferred to 10 mL of LB liquid medium and incubated at 37°C and 200 rpm for 10 h as the seed culture for shake-flask fermentation. A 5% (v / v) inoculum was added to 500 mL shake flasks containing 20 mL of fermentation medium and incubated at 30°C and 180 rpm for 48 h. Three replicates were set up for each strain genotype. After fermentation, 2 mL of fermentation broth was transferred from the shake flask to a 2 mL centrifuge tube and centrifuged at 12000 rpm for 2 min at room temperature. The supernatant was transferred to a new 1.5 mL centrifuge tube for L-homoserine content detection. The remaining cells (containing CaCO3) were resuspended in 2 mL of ultrapure water and centrifuged again at 12000 rpm for 2 min at room temperature. The supernatant was discarded. The precipitate was resuspended again, centrifuged, and the supernatant was discarded. Finally, 1.6 mL of ultrapure water was added to resuspend the precipitate, and 400 μL of acetic acid was added to thoroughly dissolve the CaCO3. This CaCO3-dissolved bacterial solution was then diluted 20 times with ultrapure water, and its OD was measured using a spectrophotometer. 600 To ensure accuracy, each sample was measured three times to minimize operational errors. Biomass OD values for strains HS1–HS16. 600 and the content of L-homoserine, such as Figure 1 As shown.
[0278] from Figure 1 It can be seen that the non-auxotrophic strain HS3 increased the L-homoserine production from 7.62 g / L to 9.90 g / L compared to the original strain HS33, and did not require the addition of exogenous amino acids, thus solving the defect of HS33 requiring the addition of three essential amino acids; the recombinant Escherichia coli HS12 showed a significant improvement in the ability to produce L-homoserine compared to the initial strain HS33, with the yield increasing from 7.62 g / L to 24.10 g / L in shake flask fermentation, an increase of 216.27%.
[0279] LB medium composition: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, solvent: deionized water. Solid medium requires the addition of agar to a final concentration of 20 g / L.
[0280] The shake-flask fermentation medium consisted of: glucose 40 g / L, (NH4)2SO4 16 g / L, yeast extract 4 g / L, KH2PO4 1 g / L, MgSO4 1 g / L, FeSO4·7H2O 0.005 g / L, MnSO4·7H2O 0.005 g / L, ZnSO4 0.005 g / L, and CaCO3 25 g / L. The solvent was deionized water, and the pH was 6.8.
[0281] Determination of L-homoserine concentration:
[0282] Sample treatment: Dilute sample concentration with ultrapure water to between 0.1-1 g / L.
[0283] Standard dilution gradient: 0.1 g / L, 0.3 g / L, 0.5 g / L, 1 g / L, 1.5 g / L, 3 g / L, solvent ultrapure water.
[0284] CNBF (4-chloro-3,5-dinitrobenzotrifluoride) solution preparation: Take 0.27 g CNBF and dissolve in 10 mL acetonitrile (need to avoid light treatment).
[0285] Boric acid buffer preparation: 0.2 mol / L boric acid (HgBO3 and 0.05 mol / L borax (Na2B407), solvent water.
[0286] Sample reaction conditions: Take 100 μL of sample, 500 μL of boric acid buffer and 300 μL of CNBF solution, respectively, and react in a metal bath at 60°C, 300 rpm for 1 h, and filter (polyvinylidene fluoride, organic membrane, 0.22 μm) for standby.
[0287] Detection method: HPLC model: Thermo Scientific Utimate 3000, HPLC detection wavelength is 250 nm. Use the gradient elution program in Table 3 to separate L-homoserine, wherein the mobile phase A component is ultrapure water: acetonitrile: glacial acetic acid: triethylamine = 830: 170: 3: 2 (v:v:v:v); the mobile phase B component is pure acetonitrile.
[0288] Table 3 Gradient elution program
[0289] Time (min) A(%) B(%) Flow (ml / min) 0 82.0 18.0 0.800 2.5 80.0 20.0 0.800 4 65.0 35.0 0.800 8 65.0 35.0 0.800 12 50.0 50.0 0.800 15 30.0 70.0 0.800 18 82.0 18.0 0.800 23 82.0 18.0 0.800
[0290] Example 18, 5L fermenter fermentation verification of strains HS33, HS12 and HS16
[0291] Strains HS33, HS12 and HS16 were respectively streaked on LB plates and incubated at 37°C overnight until colonies grew. Uniformly cell-shaped single colonies were picked and inoculated in test tubes containing 10 mL of LB liquid medium, and incubated at 37°C, 180 rpm overnight. 1 mL of test tube seed liquid was inoculated in a 200 mL LB liquid medium shake flask and incubated at 37°C, 180 rpm for 8-10 h. The shake flask seed liquid was inoculated in a 5L fermenter containing 1.8 mL of fermentation medium.
[0292] Strain HS33 fermenter culture conditions: culture at 33°C, initial aeration 4 VVM, when pH is greater than 6.82, start automatic feeding, detect pH of the fermentation broth every 10 seconds, each time working for 9 seconds, with the addition of feeding medium, pH gradually decreases and maintains at 6.80, so that the glucose concentration in the culture medium is always maintained at a low level (<2 g / L), avoiding the inhibitory effect of high concentration of glucose on the growth of the strain cells.
[0293] Strain HS12 and HS16 fermenter culture conditions: culture at 33°C, initial aeration 4 VVM, when pH is greater than 6.82, glucose is basically consumed after 14 h of fermentation, at this time OD reaches the peak, reduce the temperature from 33°C to 30°C, increase the initial aeration from 4 VVM to 8 VVM, start automatic feeding, detect pH of the fermentation broth every 10 seconds, each time working for 9 seconds, with the addition of feeding medium, pH gradually decreases and maintains at 6.80, so that the glucose concentration in the culture medium is always maintained at a low level (<2 g / L), avoiding the inhibitory effect of high concentration of glucose on the growth of the strain cells.
[0294] During the fermentation process, sample every 4 h to detect residual sugar, biomass (OD 600 ) and L-homoserine yield, the results are shown in Figure 2 (strain HS33), Figure 3 (strain HS16) and Figure 4 (strain HS12).
[0295] The formula of the fermentation medium is: glucose 20 g / L, (NH4)2SO4 17 g / L, yeast extract 4 g / L, KH2PO4 1 g / L, MgSO4 1 g / L, betaine 2 g / L, metal mixed solution 1 mL / L, antifoam agent 1 mL / L; the composition of the metal mixed solution is: FeSO4·7H2O 0.005 g / L, MnSO4·8H2O 0.0025 g / L, ZnSO4 0.005 g / L, and the solvent is water. The formula of the feeding medium in the process is: glucose 500 g / L, KH2PO4 12.5 g / L, betaine 2 g / L, NaHCO3 10 g / L, and the solvent is water.
[0296] As can be seen from Figure 3 , the advantage of strain HS16 is that the fermentation operation is simple, without the need to add an inducer, and because of the uncoupling of growth and production, there is no need to avoid the carbon flow diversion caused by too high OD600, so that the feeding speed needs to be frequently adjusted and other operations, and the highest L-homoserine yield reaches 142.15 g / L at the end of 88 h of fermentation, and the sugar acid conversion rate is 0.45 g / g of glucose, compared with 37.57 g / L of the initial strain HS33 Figure 2), the strain HS16 increased the yield by 278.36%.
[0297] From Figure 4 It can be seen that the highest yield of L-homoserine of the strain HS12 at the end of fermentation reached 103.76 g / L, which was increased by 176.17% compared with the starting strain HS33, but the fermentation period was longer, reaching 130 h (88 h, compared with the strain HS16).
[0298] Figure 3 , Figure 4 It can be seen that although H12 has the highest yield in the shake flask, the production period of H16 in the 5L fermenter is 88 hours, which is much lower than the production period of H12 of 135 h, and the yield of H12 is 142.15 g / L, which is much higher than the yield of H12 of 102.72 g / L. Therefore, the strain HS16 is finally selected as the high-yield strain.
[0299] The genetically engineered strain HS16 of the present application does not need to add an inducer in the fermentation process, the fermentation cost is reduced, since the cell growth and product production are decoupled, the fermentation regulation is relatively simple, which lays a certain foundation for the industrial production of L-homoserine, and also provides a certain metabolic modification idea for the fermentation production of amino acids.
Claims
1. A genetically engineered bacterium for high production of L-homoserine, characterized by, The engineering bacteria take strain E. coli W3110ΔmetJΔmetIΔmetBΔthrBΔmetAΔlysAΔlacI::Ptrc-rhtAΔiclRΔptsGΔgalR Ptrc-metL Ptrc-thrA Ptrc-rhtA Ptrc-eamA Ptrc-glk Ptrc-gltB as a starting strain, and the genome is edited in one or more of the following manners: (1) the thrB gene started by the self-regulating P fliA promoter is integrated into the yjiV gene site, (2) the lysA gene with the original start codon replaced by the GTG start codon is integrated into the ycdN gene site, (3) the metA gene with the original start codon replaced by the GTG start codon is integrated into the original site of the metA gene in the genome, the metB gene with the original start codon replaced by the GTG start codon is integrated into the ydeU gene site, (4) the T7 RNA polymerase gene derived from T7 phage and the dCas9 gene derived from plasmid pdCas9 are connected and integrated into the genome ompT gene site, (5) the promoter of the lysC gene is replaced by the strong promoter P lsr , (6) the thrA gene is integrated into the ygaY gene site, (7) the thrA gene is integrated into the rpnD gene site after the 1024th base G is mutated to A, (8) the promoter of the aspC gene is replaced by the strong promoter P trc , (9) the thrA gene is integrated into the yjiT gene site after the 1024th base G is mutated to A, (10) the thrA gene is integrated into the yeeJ gene site after the 1024th base G is mutated to A and the sgRNA carrying the 20bp sequence of the target sthA gene is integrated, (11) the promoter of the pntAB gene is replaced by the strong promoter P T7 , (12) the LsrFG gene is knocked out, (13) the original promoter of the ptsG gene is replaced by the strong promoter P trc , (14) the promoter of the pyc gene is replaced by the strong promoter P trc , (15) the promoter of the ppc gene is replaced by the strong promoter P trc , (16) the promoter of the pyc gene is replaced by the strong promoter P trc , (17) the promoter of the ppc gene is replaced by the strong promoter P trc .
2. The genetically engineered bacterium of claim 1, wherein, The P fliA The nucleotide sequence of the promoter is shown as SEQ ID NO. 1; the strong promoter P T7 The nucleotide sequence is shown as SEQ ID NO. 3; the promoter P lsr The nucleotide sequence is shown as SEQ ID NO.
4.
3. The genetically engineered bacteria as described in claim 1, characterized in that, The strong promoter P trc The nucleotide sequence is shown as SEQ ID NO.
2.
4. The genetically engineered bacteria as described in claim 1, characterized in that, The nucleotide sequence of the sgRNA of the target sthA gene 20bp is shown as SEQ ID NO. 5, and the nucleotide sequence of the pyc gene is shown as SEQ ID NO.
6.
5. The method for constructing the genetically engineered L-homoserine high-yield producing bacteria according to claim 1, characterized in that, The method uses the strain E. coli W3110ΔmetJΔmetIΔmetBΔthrBΔmetAΔlysAΔlacI::Ptrc-rhtAΔiclRΔptsGΔgalR Ptrc-metL Ptrc-thrA Ptrc-rhtA Ptrc-eamA Ptrc-glk Ptrc-gltB as the starting strain, and is constructed by the following steps: (1) Using CRISPR-Cas9 system, the thrB gene driven by the promoter P fliA The thrB gene driven by the promoter P was integrated into the yjiV gene site in the genome of the starting strain, and the resulting engineering strain was recorded as strain H1. (2) The original start codon of the lysA gene is replaced with a GTG start codon by using the CRISPR-Cas9 system, and the lysA gene is integrated into the ycdN gene site in the genome of the strain HS1, and the resulting engineering bacteria are recorded as strain H2; (3) The original start codon of the metA gene is replaced with a GTG start codon by using the CRISPR-Cas9 system, the original start codon of the metB gene is replaced with a GTG start codon, and the metA gene and the metB gene with the replaced start codon are integrated into the original site of the metA gene and the ydeU gene site in the genome of the strain HS2, respectively, and the resulting engineering bacteria are recorded as strain H3; (4) using the CRISPR-Cas9 system, fusing the T7 RNA polymerase gene and the dCas9 gene with the quorum sensing promoter P lsr , and integrating the fusion gene fragment into the ompT gene site of the genome of the strain HS3, and recording the thus obtained engineered bacteria as strain H4; (5) The lysC gene is inserted into the yegP gene site in the genome of the strain H4 by using the CRISPR-Cas9 system, and the resulting engineering bacteria are recorded as strain H5; (6) The thrA gene is inserted into the ygaY gene site in the genome of the strain H5 by using the CRISPR-Cas9 system, and the resulting engineering bacteria are recorded as strain H6; (7) The thrA gene after the 1024th base G is mutated to A is inserted into the rpnD gene site in the genome of the strain H6 by using the CRISPR-Cas9 system, and the resulting engineering bacteria are recorded as strain H7; (8) The promoter of the aspC gene in the genome of strain H7 is replaced with a strong promoter P T7 The engineered bacteria thus obtained is denoted as strain H8; (9) The thrA gene after the 1024th base G is mutated to A is inserted into the yjiT gene in the genome of the strain H8 by using the CRISPR-Cas9 system, and the resulting engineering bacteria are recorded as strain H9; (10) The thrA gene after the 1024th base G is mutated to A and an sgRNA carrying a 20bp sequence of the target sthA gene are inserted into the yeeJ gene site in the genome of the strain H9 by using the CRISPR-Cas9 system, and the resulting engineering bacteria are recorded as strain H10; (11) The pntAB gene promoter in the genome of strain HS10 is replaced with a strong promoter P trc The engineered bacteria thus obtained is denoted as strain HS11; (12) The LsrFG gene is knocked out in the genome of the strain HS11 by using the CRISPR-Cas9 system, and the resulting engineering bacteria are recorded as strain HS12; (13) The ptsG gene site in the genome of strain HS12 has been knocked out by CRISPR-Cas9 system and a strong promoter P trc integrated at the site. The resulting engineered bacteria is denoted as strain HS13. (14) The ptsG gene site in the genome of strain HS13 has been knocked out by CRISPR-Cas9 system and a strong promoter P trc integrated at the site. The resulting engineered bacteria is denoted as strain HS14. (15) The ptsG gene site in the genome of strain HS14 has been knocked out by (14) The yeeP gene in the genome of strain HS13 is replaced with a strong promoter P trc regulated pyc gene. The resulting engineered bacteria is denoted as strain HS14; (15) The yjh gene in the genome of strain HS14 is replaced with a strong promoter P trc regulated ppc gene, and the resulting engineered bacteria are designated as strain HS15; (16) The yjgX gene in the genome of strain HS15 is replaced with a strong promoter P trc regulated pyc gene. The resulting engineered bacteria is designated as strain HS16.
6. The genetically engineered bacteria of claim 1 with high yield of L-homoserine for use in the fermentation production of L-homoserine.
7. Use according to claim 6, wherein The application is that the genetically engineered bacteria are streaked on LB solid plate, and cultured at 37 DEG C for 12 hours; a single colony on the plate is picked to LB liquid medium, and cultured in a constant temperature shaking incubator at 37 DEG C and 200 rpm for 10 hours as seed liquid for shake flask fermentation; the seed liquid is inoculated into a shake flask containing fermentation medium at a volume concentration of 5%, and the fermentation is carried out at 25-35 DEG C and 100-200 rpm, and the culture solution is separated and purified to obtain L-homoserine; The fermentation medium is composed of the following components: glucose 40 g / L, (NH4)2SO4 16 g / L, yeast extract 4 g / L, KH2PO4 1 g / L, MgSO4 1 g / L, FeSO4·7H2O 0.005 g / L, MnSO4·7H2O 0.005 g / L, ZnSO4 0.005 g / L, CaCO3 25 g / L, and deionized water is used as solvent, and the pH value is 6.
8.
8. The use according to claim 6, wherein the compound is ###0005### The fermentation is carried out in a fermenter by the following steps: the genetically engineered bacteria are streaked on LB plate, and cultured at 37 DEG C overnight until colonies grow; a single colony with uniform cell morphology is picked and inoculated into a test tube containing LB liquid medium, and cultured at 37 DEG C and 180 rpm overnight; the test tube seed liquid is inoculated into a shake flask containing LB liquid medium at a volume concentration of 0.5%, and cultured at 37 DEG C and 180 rpm for 8-10 hours; the shake flask seed liquid is inoculated into a fermenter containing fermentation medium at a volume concentration of 10%; the culture is carried out at 33 DEG C and an initial aeration amount of 4 VVM, when the pH value is greater than 6.82, the temperature is adjusted to 30 DEG C, the aeration amount is adjusted to 8 VVM, the automatic feeding of feeding medium is started, and the pH value is maintained at 6.80, so that a fermentation liquid containing L-homoserine is obtained; The fermentation medium in the fermenter is composed of the following components: glucose 20 g / L, (NH4)2SO4 17 g / L, yeast extract 4 g / L, KH2PO4 1 g / L, MgSO4 1 g / L, betaine 2 g / L, metal mixed solution 1 mL / L, and defoaming agent 1 mL / L; the metal mixed solution is composed of the following components: FeSO4·7H2O 0.005 g / L, MnSO4·8H2O 0.0025 g / L, and ZnSO4 0.005 g / L, and water is used as solvent; the feeding medium is composed of the following components: glucose 500 g / L, KH2PO4 12.5 g / L, betaine 2 g / L, and NaHCO3 10 g / L, and water is used as solvent.