Rice OsRbohB protein as well as coding gene and application thereof

Abstract

The invention discloses a rice OsRbohB protein as well as a coding gene and application thereof. The amino acid sequence of the OsRbohB protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the coding gene of the OsRbohB protein is as shown in SEQ ID NO.1. The invention provides a rice transformation overexpression vector for overexpressing an OsRbohB gene by using a ZmUbi promoter. And the plant height, the grain number per spike and the grain length of the overexpressed and transformed plant are obviously increased. It is proved for the first time that the rice OsRbohB is a functional gene for regulating and controlling the plant height, the grain number per spike and the grain length of rice, and cloning and biological function verification of the gene have important reference significance for molecular mechanism research of regulation and control of important agronomic traits of rice. Due to the fact that the characters are important characters related to the plant type and the yield of the rice, the function analysis of the OsRbohB increases a new alternative gene for design and breeding of the rice, and great potential utilization value is achieved.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering and genetic improvement, and particularly relates to a rice OsRbohB protein, a coding gene thereof and application thereof. BACKGROUND

[0002] NADPH oxidase / RBOH (Respiratory Burst Oxidase Homolog) is a key enzyme for ROS production and accumulation in cells, and its function is closely related to ROS, and it is widely involved in a series of important physiological processes such as plant response to pathogenic bacteria, drought, salt and heavy metal stress, cell differentiation, root hair development, pollen tube elongation, seed after-ripening, seed germination and the like. In the plant genome, RBOH exists in the form of a multi-gene family, such as 10 and 9 RBOH homologous genes identified in Arabidopsis and rice respectively, which encode between 727 and 1033 amino acids, with a predicted molecular weight of between 83.4 and 115.0 kDa, and all have four conserved functional domains of NADPH_Ox, Ferric_reduct, FAD_binding_8 and NAD_binding_6, a transmembrane domain and a Ca 2+ Combined with EF-hand structure, the protein structure is similar but the function is diverse. Compared with the wild type, AtrbohC the mutant, i.e. root hair defective 2 (RHD2), rhd2 has a significantly reduced number of root hairs and a 20% shortened length of root hairs; and AtrbohD / F the double mutant causes O2 •- accumulation in the main root, promotes the formation of lateral roots and increases the density of lateral roots. AtRbohE regulates the programmed death of the tapetum cells, and the mutation of the gene causes pollen abortion and reduced fertility; AtRbohH / J participates in the regulation of pollen tube growth and seed development, and the double mutation causes reduced fertility and inhibited pollen tube growth; and AtRbohB participates in the regulation of seed after-ripening, and the mutation of the gene causes blocked weakening of endosperm, delayed seed germination. In rice, OsRbohA participates in the regulation of rice development, and the mutation of the gene causes decreased plant biomass, reduced fertility and decreased seed germination rate; OsRbohB ROS production mediated by the gene plays a crucial role in rice drought resistance; and OsRbohH participates in the formation of the aerenchyma under ethylene induction.

[0003] CN105505984A discloses overexpression of the gene in rice, and the transgenic plants obtained have yellow leaf color, increased hydrogen peroxide content and reduced fertility. CN105462983A discloses silencing of the gene in rice, and the transgenic plants obtained have reduced fertility and reduced seed germination rate. OsRbohB OsRbohB ​The obtained transgenic plants have white leaves and reduced fertility. Therefore, it is found that, OsRbohB Overexpression or silencing of the gene in rice can cause changes in leaf color and reduced fertility of rice. SUMMARY

[0004] Based on the above problems, the present application provides a rice OsRbohB protein and its encoding gene and application, specifically, the application of OsRbohB protein or its encoding gene in regulating the plant height, stem thickness, grain number per panicle and grain length of rice, and relates to the seedling cultivation of rice in biological agriculture.

[0005] The first object of the present application is to provide a rice OsRbohB protein, and the amino acid sequence thereof is shown as SEQ ID NO. 2.

[0006] The second object of the present application is to provide the encoding gene of the above-mentioned OsRbohB protein, and the nucleotide sequence thereof is shown as SEQ ID NO. 1.

[0007] The third object of the present application is to provide the application of the above-mentioned OsRbohB protein or the above-mentioned encoding gene in regulating the plant height, stem thickness, grain number per panicle and / or grain length of rice.

[0008] Preferably, it is the application of the above-mentioned encoding gene in increasing the plant height, stem thickness, grain number per panicle and / or grain length of rice by overexpression in rice.

[0009] Preferably, the rice plant is a mature rice plant.

[0010] The fourth object of the present application is to provide a method for increasing the plant height, stem thickness, grain number per panicle and / or grain length of rice, which comprises the following steps: overexpressing the above-mentioned encoding gene in rice to increase the expression amount of the encoding gene of OsRbohB protein by 4-6 times.

[0011] Preferably, the encoding gene and the corn Ubi gene promoter and the multiple cloning site sequence are integrated into the pCAMBIA1380 vector, and the above-mentioned encoding gene is located at the 3' end of the Ubi promoter to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE, and the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE is transformed into rice to obtain the OsRbohB overexpression transgenic line.

[0012] Preferably, the construction method of the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE is as follows: taking pCAMBIA1380 as a backbone vector, using a homologous recombination method, and performing Eco RI andPml I double enzyme digestion, the maize Ubi gene promoter and the polylinker sequence are integrated into the backbone vector pCAMBIA1380 to obtain the pCAMBIA1380-Pubi-OE vector, and then the coding gene is integrated into the pCAMBIA1380-Pubi-OE vector through homologous recombination to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE. Kpn I and Bam H I double enzyme digestion of the pCAMBIA1380-Pubi-OE vector to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE.

[0013] Preferably, the maize Ubi gene promoter and the polylinker sequence are as shown in SEQ ID NO. 3.

[0014] Preferably, the rice is the japonica variety Nipponbare.

[0015] The present application clones the rice OsRbohB gene through RT-PCR and integrates the complete CDS coding sequence (SEQ ID No: 1) of the gene into the pCAMBIA1380-Pubi-OE overexpression intermediate vector through homologous recombination. Kpn I (NEB) and Bam H I (NEB) double enzyme digestion of the pCAMBIA1380-Pubi-OE overexpression intermediate vector, so that it is at the 3' end of the Ubi promoter and is driven by the Ubi promoter. Agrobacterium-mediated transformation is used to obtain the OsRbohB overexpression transgenic line with the japonica variety Nipponbare as the background.

[0016] The plant height, grain number per ear and other agronomic traits of the transgenic plants and non-transgenic wild type plants are determined, and the significance of the differences in plant height, stem diameter, grain number per ear and grain length between the wild type and the transgenic plants is statistically analyzed using T-TEST. Figure 3 and 4 ). At the same time, the plant height of the non-transgenic wild type plant is taken as 100%, and the overexpression OsRbohB The flag leaf blade of the transgenic plant is increased, the stem is thickened, the plant height is increased by 22.2%~31.9%, the grain number per ear is increased by 36.7%~40.5%, but the seed setting rate does not change significantly; the grain length is increased by 24%~25.1%, and the grain length-width ratio is increased by 51.1%~53.1%. These results show that OsRbohB Overexpression of the gene can lead to increased leaf blade, thickened stem, increased plant height, increased grain number per ear and elongated grain length of the mature rice plant.

[0017] Advantages of the present application: 1. The present application first proves that overexpression of the rice OsRbohB(Os01g0360200) is a functional gene for regulating the plant height, stem diameter, grain number per spike and grain length of rice. Cloning and biological function verification of the gene have important reference significance for the study of the molecular mechanism of the regulation of important agronomic traits of rice. 2. The application provides a rice transformed overexpression vector for overexpressing the OsRbohB gene by using a Ubi promoter. The plant height, stem diameter, grain number per spike and grain length of the overexpression transformed plant are obviously increased. Since the above-mentioned traits are important traits related to the plant type and yield of rice, the functional analysis of OsRbohB in the application increases a new alternative gene for the design and breeding of rice, and has great potential utilization value. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 It is a gene cloning, gene structure, protein structure and subcellular localization map of OsRbohB in Example 1, wherein A is the gene cloning of OsRbohB; B is the Exon-Intron structure and protein structure domain of the gene; and C is the subcellular localization map.

[0019] Figure 2 It is a gene cloning, gene structure, protein structure and subcellular localization map of OsRbohB in Example 1, wherein A is the gene cloning of OsRbohB; B is the Exon-Intron structure and protein structure domain of the gene; and C is the subcellular localization map. OsRbohB It is a gene cloning, gene structure, protein structure and subcellular localization map of OsRbohB in Example 1, wherein A is the gene cloning of OsRbohB; B is the Exon-Intron structure and protein structure domain of the gene; and C is the subcellular localization map. OsRbohB It is a gene cloning, gene structure, protein structure and subcellular localization map of OsRbohB in Example 1, wherein A is the gene cloning of OsRbohB; B is the Exon-Intron structure and protein structure domain of the gene; and C is the subcellular localization map.

[0020] Figure 3 It is a gene cloning, gene structure, protein structure and subcellular localization map of OsRbohB in Example 1, wherein A is the gene cloning of OsRbohB; B is the Exon-Intron structure and protein structure domain of the gene; and C is the subcellular localization map.

[0021] Figure 4 It is a gene cloning, gene structure, protein structure and subcellular localization map of OsRbohB in Example 1, wherein A is the gene cloning of OsRbohB; B is the Exon-Intron structure and protein structure domain of the gene; and C is the subcellular localization map. DETAILED DESCRIPTION

[0022] The following examples are further illustrations of the present application and are not intended to limit the present application. The specific experimental conditions and methods are not specified in the following examples, and the technical means used are generally conventional means known to those skilled in the art. The experimental materials used in the following examples, unless otherwise specified, can be purchased from conventional biochemical reagent companies.

[0023] Example 1: OsRbohB encodes a plasma membrane-localized NADPH oxidase (1) The leaf part of rice Nipponbare seedlings was taken, and total RNA of the leaf was extracted by TriZol Reagent (Invitrogen). Formaldehyde denatured gel electrophoresis and ultraviolet spectrophotometer were used to detect the purity and amount of the total RNA.

[0024] (2) 1 μg of the total RNA was taken to perform a reverse transcription reaction. The reverse transcriptase used was PrimeScript (TAKARA Company, item number RR047A), and the reverse transcription reaction steps were referred to the instruction manual of the reverse transcriptase. The reverse transcription product was used as a template, and PCR amplification was performed using OsRbohB-F / R primer pair (SEQ ID NO. 4 and SEQ ID NO. 5). The polymerase used in the PCR was KOD FX (Toyobo Company, KFX-101). The reaction system was 50 μL, and the PCR reaction system was prepared according to the instruction manual of KOD FX. The reaction conditions were: 94℃ 5 min; 94℃ 30 sec, 56℃ 30 sec, 68℃ 2 min, 35 cycles; 68℃ 10 min. A fragment of about 2983 bp was obtained by PCR amplification.

[0025] (3) After the fragment was recovered by the direct purification method of the PCR product, 40 μL of the recovered product, 2 μL of Ex Taq enzyme (TAKARA Company, RR001Q), 5 μL of Ex Taq Buffer, and 3 μL of dNTPs were added to a 50 μL reaction system, and the reaction was performed at 72℃ for 20 min to add an A tail to the 3' end of the PCR fragment. After the reaction, the end-tailed fragment was recovered, and the A-tailed fragment was connected with pMD18-T vector (which has a 3' end T tail). The whole connection product was transformed into E. coli DH5α by 42℃ heat shock method, and the transformation product was spread on LB solid medium containing 100 mg / L ampicillin resistance. After 37℃ culture overnight, 10 positive white single clones were selected for plasmid extraction, enzyme digestion identification, and two positive clones were selected for sequencing to obtain E. coli DH5α containing pMD18T-OsRbohB plasmid. The sequencing result showed that the full-length sequence was 2983 bases, containing an open reading frame, which was OsRbohB gene with a size of 2718 bases. OsRbohB Figure 1 ​A) in FIG. 1, the nucleotide sequence of which is shown as SEQ ID NO. 1, which encodes a protein having 905 amino acid residues, the amino acid sequence of which is shown as SEQ ID NO. 2. OsRbohB Exon-Intron structure of the gene and protein domain are shown as Figure 1 B) in FIG. 1.

[0026] (4) The pSAT6-2x35S::OsRbohB-GFP fusion vector was constructed, and the primer pair OsRbohB-sub_F / R (SEQ ID NO. 6 and SEQ ID NO. 7) was used to amplify the full-length sequence of OsRbohB CDS by PCR with the pMD18T-OsRbohB plasmid as the template, which was homologously recombined into the pSAT6-2x35S::eYFP vector digested by Nco I and Bam H I double enzymes, thereby obtaining pSAT6-2x35S::OsRbohB-eYFP. pSAT6-2x35S::OsRbohB-eYFP and pSAT6-2x35S::eYFP (control) were transiently transformed into rice protoplast cells (referring to Jiang et al., 2018; Bio-101 e1010125) with WI solution [0.6 mol L −1 mannitol, 4 mmol L −1 KCl, and 4 mmol L -1 MES (pH 5.7)] at 28°C in the dark for 16-18 h. The eYFP yellow fluorescence signal was observed and photographed by Zeiss LSM 710 laser confocal scanning microscope. As shown in C) in FIG. 1, OsRbohB was localized on the cell membrane. Figure 1

[0027] Example 2: OsRbohB Construction of overexpression vector and obtaining of overexpression rice lines To construct the OsRbohB overexpression vector, the complete CDS coding sequence (SEQ ID NO. 1) was amplified by PCR with the primer pair OsRbohB-OE-F / R (SEQ ID NO. 8 and SEQ ID NO. 9) and the pMD18T-OsRbohB plasmid as the template. The amplified fragment verified by sequencing was integrated into the pSAT6-2x35S::eYFP vector digested by Kpn I (NEB) and Bam H​ I (NEB) double enzyme digestion of pCAMBIA1380-Pubi-OE vector [the vector takes pCAMBIA1380 as a skeleton, uses a homologous recombination kit, and is obtained by Eco R I and Pml I double enzyme digestion, and the maize Ubi gene promoter and the multi-cloning site (MCS) site sequence (SEQ ID NO. 3) are integrated into the skeleton vector to obtain the pCAMBIA1380-Pubi-OE vector ( Figure 2 A) in which A) is located at the 3' end of the Pubi promoter and is driven by the Pubi promoter, thereby obtaining the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE plasmid ( Figure 2 B).

[0028] The constructed overexpression vector was transformed into normal japonica rice variety Nipponbare by Agrobacterium EHA105-mediated genetic transformation method. The rice transformation was entrusted to Wuhan Boyuan Biotechnology Co., Ltd. The general process was as follows: Agrobacterium EHA105 containing pCAMBIA1380-Pubi::OsRbohB-OE plasmid infected japonica rice variety Nipponbare callus, and then was transferred to co-culture medium (the basic medium was N6 medium, and 0.6 g / L proline, 0.6 g / L hydrolyzed casein, 2.0 g / L 2,4-D, 30 g / L sucrose, 3.0 g / L phytagel, 100 μM acetyl-syringone, pH 5.7 were added), and was cultured at 26°C in dark for 2-4 days. The washed callus was transferred to selection medium containing hygromycin (the basic medium was N6 medium, and 1.4 g / L proline, 0.6 g / L hydrolyzed casein, 2.0 g / L 2,4-D, 30 g / L sucrose, 3.0 g / L phytagel, 300 mg / L thiabendazole, 60 mg / L hygromycin, pH 5.8 were added), and was subjected to resistance screening (28°C, 14 h light / 10 h dark). The selected resistant callus was transferred to pre-differentiation medium (the basic medium was MS medium, and 2.0 g / L hydrolyzed casein, 2.0 mg / L KT, 0.3 mg / L NAA, 30 g / L sucrose, 3.0 g / L phytagel, 60 mg / L hygromycin, pH 5.8 were added), and was cultured under light (28°C, 14 h light / 10 h dark) for 10-14 days. Then, the callus was transferred to differentiation medium (the basic medium was MS medium, and 3.0 mg / L KT, 0.5 mg / L NAA, 30 g / L sucrose, 3.0 g / L phytagel, 60 mg / L hygromycin, pH 5.8 were added), and was cultured under light (28°C, 14 h light / 10 h dark). When the seedlings grew to 2-4 cm, they were transferred to rooting medium (the basic medium was 1 / 2MS medium, and 0.5 mg / L NAA, 15 g / L sucrose, 2.5 g / L phytagel, 60 mg / L hygromycin, pH 5.8 were added, 1 / 2MS medium was MS medium with half of the concentration of macroelements, and the concentrations of other components were unchanged), and were grown for 3 weeks (28°C, 14 h light / 10 h dark). After the T0 generation seedlings were hardened (water covered the medium) for 3 days, they were transplanted into soil. The primary transformed (T0 generation) plants were detected by screening marker gene Hyg PCR (SEQ ID NO. 10 and SEQ ID NO. 11) and quantitative PCR of target gene OsRbohB (the steps of fluorescent quantitative PCR detection were as follows), and the positive transformed plants were identified at DNA and RNA levels, which proved that the target gene OsRbohB had been transformed into rice, and the expression amount of the target gene was increased. The PCR identification results of marker gene Hyg of T0 generation transgenic plants were as follows:Figure 2 C in the middle.

[0029] PCR amplification of the marker gene Hyg was performed using the EX Taq DNA Polymerase kit (TAKARA, catalog number RR001A). The reaction mixture consisted of: 2.5 μL 10×Ex Taq buffer, 1.0 μL dNTPs (10 μM), 1.0 μL Template DNA (approximately 50 ng), 1.0 μL Hyg-F primer (10 μM), 1.0 μL Hyg-R primer (10 μM), 0.5 μL Ex Taq DNA Polymerase (2.5 U), and 18 μL ddH2O. The reaction program was: 95℃ for 3 min; 95℃ for 15 sec, 60℃ for 15 sec, 72℃ for 30 sec, 35 cycles; 72℃ for 5 min; and stored at 4℃.

[0030] In a controlled greenhouse, transgenic positive plants were self-pollinated to obtain homozygous positive F1 (T1) lines. Ten plants from each line, testing positive by PCR, were selected for propagation to obtain T2 lines. The T2 lines were then subjected to further PCR testing to identify two homozygous T3 lines (OE-11 and OE-16) derived from different T0 lines. Quantitative real-time PCR was performed on the leaves of seedlings from both lines to detect the expression levels of the target gene, using the results from the wild-type (japonica rice variety Nipponbare) as a control. Figure 2 (D in the middle).

[0031] The procedure for identifying the overexpression effect of the OsRbohB gene in transgenic plants by quantitative real-time PCR is as follows: (1) Total RNA was extracted from spikelets at the initial heading stage of transgenic plants that tested positive by PCR. The reagent used was TriZol Reagent (Invitrogen, catalog number: 15596026). The procedure was performed according to the instructions of the reagent. The purity and amount of total RNA were detected by formaldehyde denaturing gel electrophoresis and ultraviolet spectrophotometer.

[0032] (2) Take 1 μg of total RNA to initiate the reverse transcription reaction. The reverse transcriptase used is PrimeScript (Takara, catalog number RR047A). Refer to the instructions for use of this reverse transcriptase for the reverse transcription reaction steps. Using the reverse transcription product as a template, the expression of the target gene was detected using primer pair OsRbohB-qF / qR (SEQ ID NO.12 and SEQ ID NO.13).

[0033] (3) The expression of rice GAPDH gene was detected by using primers of housekeeping gene GADPH, OsGAPDH-F / R (SEQ ID NO. 14 and SEQ ID NO. 15) as internal reference, and the quantitative PCR reagent was SYBR ® Premix Ex Taq™ (TAKARA, item number DRR420A), and the quantitative PCR instrument was CFX 96 (BIO-RAD company).

[0034] The results of the relative mRNA expression level of OsRbohB in two transgenic homozygous lines (OE-11# and OE-16#) and wild type plants (WT) are shown in Fig. D of Figure 2 The results show that the expression of the two lines is significantly increased by 4-6 times compared with the wild type. OsRbohB

[0035] Example 3: OsRbohB The overexpression of rice lines has significant differences in plant height, stem diameter, grain number per spike and grain length The seeds of two homozygous overexpression transgenic T3 generation lines (OsRbohB-OE-11# and OsRbohB-OE-16#) and wild type (WT, japonica variety Nipponbare) rice in Example 2 were surface sterilized with 70% ethanol for 1 minute, 2.5% (active chlorine content) NaClO solution for 20 minutes, and then washed with sterile water for 4-5 times, and then germinated at 30°C in the dark for 3 days. Then the seedlings were transferred to soil and grown to the three-leaf stage, and then transplanted to plastic trays and cultured to the mature stage (full maturity stage). The agronomic traits of transgenic plants and non-transgenic wild type plants, such as plant height, flag leaf, stem diameter, grain number per spike, and grain length, were measured and photographed, and the significance of the differences in plant height, stem diameter, grain number per spike, and grain length between wild type and transgenic plants was statistically analyzed by T-TEST (P<0.05) (Fig. 1). Figure 3 and Figure 4 ). At the same time, the plant height of non-transgenic wild type plants was taken as 100%, and the overexpression OsRbohB The flag leaf of the transgenic plants was enlarged, the stem was thickened, the plant height was increased by 22.2%-31.9%, the grain number per spike was increased by 36.7%-40.5%, but the seed setting rate did not change significantly; the grain length was increased by 24%-25.1%, and the grain length-width ratio was increased by 51.1%-53.1%. These results show that overexpression of OsRbohB gene can lead to enlargement of leaf, thickening of stem, increase of plant height, increase of grain number per spike, and elongation of grain length in mature rice plants.

[0036] ​The above-described embodiments only express several implementation manners of the present application, which are described in a more specific and detailed manner, but should not be understood as a limitation on the patent scope of the present application. It should be noted that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present application, which all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

[0037] SEQ ID NO.1 (nucleotide sequence of the 5' untranslated region of the OsRbohB ATGGCTGACCTGGAAGCA ​GACCCATTTCGCACGACCTA ATTGGCGAAGCGTCTTCAAGAAGGTTGCGGTCAGCCATGAGAACCAGCGCGTCGGTGTGTTCTACTGTGGTGAGCCTG TGCTGGTTCCCCAACTAAGG CAGTTGTCAGCAGATTTCACCCACAAGACAAACACAAG ATTTGATTTCCACAAGGAGAACTTC TAA SEQ ID NO. 2 (OsRbohB amino acid sequence) MADLEAGMVAAATDQGNSTRSQDDAATLIPNSGNLGSSNRSTKTARFKDDDELVEITLDVQRDSVAIQEVRGVDEGGSGHGTGFDGLPLVSPSSKSGKLTSKLRQVTNGLKMKSSSRKAPSPQAQQSAKRVRKRLDRTKSSAAVALKGLQFVTAKVGNDGWAAVEKRFNQLQVDGVLLRSRFGKCIGMDGSDEFAVQMFDSLARKRGIVKQVLTKDELKDFYEQLTDQGFDNRLRTFFDMVDKNADGRLTAEEVKEIIALSASANKLSKIKERADEYTALIMEELDPTNLGYIEMEDLEALLLQSPSEAAARSTTTHSSKLSKALSMKLASNKEMSPVRHYWQQFMYFLEENWKRSWVMTLWISICIALFIWKFIQYRNRAVFGIMGYCVTTAKGAAETLKFNMALVLLPVCRNTITWIRSKTQVGAVVPFNDNINFHKVIAAGVAVGVALHAGAHLTCDFPRLLHASDAQYELMKPFFGEKRPPNYWWFVKGTEGWTGVVMVVLMAIAFTLAQPWFRRNKLKDSNPLKKMTGFNAFWFTHHLFVIVYTLLFVHGTCLYLSRKWYKKTTWMYLAVPVVLYVSERILRLFRSHDAVGIQKVAVYPGNVLALYMSKPPGFRYRSGQYIFIKCTAVSPYEWHPFSITSAPGDDYLSVHIRTRGDWTSRLRTVFSEACRPPTEGESGLLRADLSKGITDEKARFPKLLVDGPYGAPAQDYREYDVLLLIGLGIGATPLISIVKDVLNHIQGEGSVGTTEPESSSKAKKKPFMTKRAYFYWVTREEGSFEWFRGVMNEVSEKDKDGVIELHNHCSSVYQEGDARSALIVMLQELQHAKKGVDILSGTSVKTHFARPNWRSVFKKVAVSHENQRVGVFYCGEPVLVPQLRQLSADFTHKTNTRFDFHKENF SEQ ID NO. 3 (ZmUbi promoter and multiple cloning site sequence, 2039 bp) SEQ ID NO. 4 (OsRbohB-F, gene cloning forward primer) ACATGGCTGACCTGGAAGCA SEQ ID NO. 5 (OsRbohB-R, gene cloning reverse primer) AGGCATCCTTTGGTCACAACA SEQ ID NO. 6 (OsRbohB-sub_F, subcellular localization vector construction forward primer) atttacgaacgatagccatggATGGCTGACCTGGAAGCAGG SEQ ID NO. 7 (OsRbohB-sub_R, subcellular localization vector construction reverse primer) ccttgctcaccatcaggatccGAAGTTCTCCTTGTGGAAATCAAAT SEQ ID NO. 8 (OsRbohB-OE_F, overexpression vector construction forward primer) gtgttacttctgcagggtaccATGGCTGACCTGGAAGCAGG SEQ ID NO. 9 (OsRbohB-OE_R, overexpression vector construction reverse primer) taattcacacttgtaggatccTTAGAAGTTCTCCTTGTGGAAATCAA SEQ ID NO. 10 (Hyg-F, overexpression transgenic plant identification forward primer) ACGGTGTCGTCCATCACAGTTTGCC SEQ ID NO. 11 (Hyg-R, overexpression transgenic plant identification reverse primer) TTCCGGAAGTGCTTGACATTGGGGA SEQ ID NO. 12 (OsRbohB-qF, quantitative PCR forward primer, spanning exons) GACCCATTTCGCACGACCTA SEQ ID NO. 13 (OsRbohB-qR, quantitative PCR reverse primer, spanning exons) CCTTAGTTGGGGAACCAGCA SEQ ID NO. 14 (OsGAPDH-qF, housekeeping gene quantitative PCR forward primer, spanning exons) GCAATCAAGGAGGAGGCTGA SEQ ID NO. 15 (OsGAPDH-qR, internal control gene quantitative PCR reverse primer, spanning exon) ACGTGTCGCTCAAAGCAATG.

Claims

1. Use of a rice OsRbohB protein or a coding gene thereof in regulating plant height, stem diameter, grain number per spike and / or grain length of a rice plant, wherein the amino acid sequence of the rice OsRbohB protein is shown as SEQ ID NO. 2, and the nucleotide sequence of the coding gene is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, Use of a coding gene of the rice OsRbohB protein in overexpressing the rice OsRbohB protein in a rice plant to increase plant height, stem diameter, grain number per spike and / or grain length of the rice plant, wherein the nucleotide sequence of the coding gene is shown as SEQ ID NO.

1.

3. Use according to claim 2, characterized in that, The rice plant is a mature rice plant.

4. A method for promoting increase in plant height, increase in stem diameter, increase in the number of grains per panicle, and / or increase in grain length in a rice plant, the method comprising introducing into the plant a polynucleotide encoding a polypeptide having an amino acid sequence of SEQ ID NO: 2, or a functional equivalent thereof. The method comprises the following step: overexpressing a coding gene of the rice OsRbohB protein in a rice plant to increase the expression of the coding gene of the rice OsRbohB protein by 4-6 times, wherein the nucleotide sequence of the coding gene is shown as SEQ ID NO.

1.

5. The method of claim 4, wherein, The method comprises the following steps: integrating a coding gene of the rice OsRbohB protein and a maize Ubi gene promoter and a multiple cloning site sequence into a pCAMBIA1380 vector, and placing the coding gene of the rice OsRbohB protein at the 3' end of the Ubi promoter to obtain an overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE, and transforming the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE into a rice plant to obtain an OsRbohB overexpression transgenic line, wherein the nucleotide sequence of the coding gene is shown as SEQ ID NO.

1.

6. The method of claim 5, wherein, The overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE is constructed as follows: using pCAMBIA1380 as a backbone vector, a maize Ubi gene promoter and a polylinker sequence are integrated into the backbone vector pCAMBIA1380 by homologous recombination to obtain a pCAMBIA1380-Pubi-OE vector, and then a coding gene of an OsRbohB protein is integrated into the pCAMBIA1380-Pubi-OE vector by homologous recombination to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE. Eco RI and Pml I double digestion, a maize Ubi gene promoter and a polylinker sequence are integrated into the backbone vector pCAMBIA1380 to obtain a pCAMBIA1380-Pubi-OE vector, and then a coding gene of an OsRbohB protein is integrated into the pCAMBIA1380-Pubi-OE vector by homologous recombination to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE. Kpn I and Bam H I double digestion to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE, and the nucleotide sequence of the coding gene is shown as SEQ ID NO.

1.

7. The method of claim 6, wherein, The maize Ubi gene promoter and the multiple cloning site sequence are shown as SEQ ID NO.

3.

8. The method of claim 7, wherein, The rice is japonica rice variety Nipponbare.

Images