An siRNA targeting the expression of the INHBE gene, conjugates and uses thereof
By designing siRNA targeting the INHBE gene, specifically binding to and inhibiting INHBE mRNA translation, the problems of muscle loss and side effects during weight loss caused by existing drugs are solved, achieving effective lipid breakdown and long-lasting weight loss.
Patent Information
- Application Number
- CN202511433388.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2024-12-24
- Filing Date
- 2025-10-09
- Publication Date
- 2026-04-14
- Estimated Expiration
- 2045-10-09
AI Technical Summary
Existing drugs may cause a significant reduction in muscle mass during weight loss, affecting food intake, and have side effects such as off-target effects, immune stimulation, and cytotoxicity. It is difficult to develop long-acting weight loss drugs that can maintain muscle mass and prevent rebound during the rapid weight loss phase.
A siRNA targeting the INHBE gene was designed to specifically bind to INHBE mRNA, preventing its translation and inhibiting the secretion of liver-derived INHBE protein. It contains a sense strand and an antisense strand with specific nucleotide sequences and uses modified nucleotides to improve stability and reduce cytotoxicity.
It effectively inhibits INHBE gene expression, increases lipid breakdown, and achieves the goal of treating obesity and related metabolic complications, while maintaining muscle mass, avoiding the influence of food intake, and has long-lasting effects and low cytotoxicity.
Smart Images

Figure CN120905229B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to an siRNA that inhibits the expression of the inhibin subunit βE (INHBE) gene, its conjugates, pharmaceutical compositions, and their use in the treatment of metabolic and / or cardiovascular diseases. Background Technology
[0002] Inhibin subunite βE (INHBE) is composed of INHBE The gene encodes a member of the transforming growth factor β (TGF-β) superprotein family. The proprotein, translated from the gene expression, undergoes proteolytic processing to produce the inhibin βE subunit. INHBE is closely related to lipid metabolism regulation. INHBE protein expression exhibits high tissue specificity; after expression in liver tissue, it is secreted into the bloodstream, where it binds to activin receptor-like kinase 7 (ALK7) on adipocytes, activating transcription factors Smad2 / 3 and initiating the expression of a series of genes, promoting lipid storage and accumulation.
[0003] Increasing evidence suggests that the biological function and high expression of INHBE play a driving role in diseases such as obesity, type 2 diabetes mellitus (T2DM), insulin resistance, and lipid metabolism disorders. A study that included exon sequences from 360,000 individuals and identified genetic variants associated with lower levels of abdominal obesity (Nat Commun 2022; 13, 4319) showed that loss-of-function mutations in INHBE were associated with improved fat distribution, manifested as a lower body mass index corrected for waist-to-hip ratio (WHRadjBMI). Elevated levels of 3-hydroxybutyrate and ketone bodies in the blood of individuals with loss-of-function mutations in INHBE indicated increased lipidolysis. Loss-of-function mutations in INHBE were associated with a reduced risk of T2DM and coronary heart disease (CHD), suggesting that INHBE inactivation contributes to improved glucose and lipid metabolism. Another study examining liver biopsy samples from humans with varying degrees of insulin resistance found that liver expression levels of INHBE mRNA were positively correlated with human insulin resistance and body mass index (PLos One 2018; 13(3): e0194798). Obese individuals have three times the blood INHBE protein level compared to normal individuals. Higher INHBE expression levels are also associated with elevated liver triglyceride levels. Furthermore, animal studies have shown that, compared to wild-type mice, systemic INHBE knockout mice are resistant to high-fat diet (HFD)-induced weight gain, exhibit significantly increased blood levels of the lipolysis product β-hydroxybutyrate, and show increased levels of lipidolysis-related genes (including...) in visceral adipose tissue. Atgl, Cgi-58INHBE expression levels were upregulated. Decreasing INHBE expression via siRNA also reduced body weight and increased muscle mass percentage in HFD-induced mice, while food intake remained unchanged. Therefore, INHBE is a potential therapeutic target for obesity and metabolic disorders such as type 2 diabetes mellitus (T2DM) and chronic diseases like CHD.
[0004] A statistical study covering 15.8 million Chinese adults showed that, according to the body mass index (BMI) classification criteria, overweight individuals (BMI=24-28) accounted for approximately 34.8%, and obese individuals (BMI≥28) accounted for approximately 14.1% (Diabetes Obes Metab. 2023; 25(11):3390-3399). Compared with people with normal BMI, overweight / obese individuals had a higher prevalence of metabolic complications, with common complications including fatty liver, prediabetes, dyslipidemia, and hypertension; body fat levels, especially visceral fat levels, were positively correlated with the risk of type 2 diabetes mellitus (T2DM) and coronary artery disease (CAD). In the elderly population, overweight and obesity also increase the risk of age-related diseases. Clinical recommendations include treatment of obesity through lifestyle modifications, drug therapy, and bariatric surgery. In recent years, newly approved incretin-based drugs for the treatment of type 2 diabetes mellitus (T2DM) and obesity, such as semaglutide, have shown clear efficacy in weight loss and blood glucose control, while also providing multiple metabolic-related clinical benefits such as reduced liver lipids and improvement of hepatic steatosis. They have increasingly become cornerstone drugs for the treatment of obesity and T2DM and other metabolic diseases. However, they also have drawbacks, including significant muscle loss during weight loss, restriction of central dopamine secretion, gastrointestinal adverse reactions, and even an increased risk of intestinal obstruction. Furthermore, there are reports of weight rebound after discontinuation of these drugs. These issues represent new unmet clinical needs in the treatment of obesity and related metabolic complications. Developing novel weight-loss drugs that can maintain muscle mass and prevent muscle loss during rapid weight loss, while maintaining nutritional support through food intake, and providing long-term, sustained weight loss to prevent rebound, will be key to the future clinical management of obesity and related metabolic complications.
[0005] This application provides a small interfering RNA (siRNA) preparation targeting INHBE, which can specifically bind to INHBE mRNA, disrupt the normal translation template function of INHBE mRNA, thereby preventing the translation of INHBE protein, inhibiting the secretion of liver-derived INHBE protein and its regulatory effect on lipid metabolism in adipose tissue, and thus achieving the purpose of treating obesity and related metabolic complications by increasing lipid breakdown.
[0006] Compared to traditional drugs, siRNAs exhibit poor stability and are easily degraded by nucleases when administered systemically. Furthermore, it is necessary to explore ways to further enhance activity while avoiding off-target effects, immune stimulation, cytotoxicity, and other side effects. Therefore, developing more candidate siRNAs that are stable in the blood, possess good biological activity, exhibit low cytotoxicity, and can effectively inhibit INHBE gene expression over a long period is an urgent problem to be solved. Simultaneously, developing highly effective and long-acting weight-loss drugs using these candidate siRNAs that inhibit INHBE gene expression is both necessary for clinical research and a realistic possibility for commercialization. Summary of the Invention
[0007] This invention provides an siRNA for inhibiting INHBE gene expression, the siRNA comprising a sense strand and an antisense strand; wherein the antisense strand comprises at least 17 consecutive nucleotides differing from the nucleotide sequences shown in any one of SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911 by no more than 4 nucleotides, the antisense strand being 17~30 nucleotides in length; the sense strand being 17~30 nucleotides in length and at least partially complementary to the antisense strand.
[0008] The phrase "at least partially complementary" means that the two sequences can be completely complementary, or have no more than 5, 4, 3, or 2 mismatched base pairs in total, while retaining the ability to hybridize under relevant conditions.
[0009] In some embodiments of the present invention, the antisense strand differs from any nucleotide sequence shown in SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, and SEQ ID NO: 909~SEQ ID NO: 911 by no more than 4 nucleotides; in some embodiments of the present invention, the antisense strand differs from any nucleotide sequence shown in SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, and SEQ ID NO: 909~SEQ ID NO: 911 by no more than 3 nucleotides; in some embodiments of the present invention, the antisense strand differs from any nucleotide sequence shown in SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, and SEQ ID NO: 909~SEQ ID NO: 911 by no more than 2 nucleotides; in some embodiments of the present invention, the antisense strand differs from any nucleotide sequence shown in SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, and SEQ ID NO: 909~SEQ ID NO: 911 by no more than 2 nucleotides; in some embodiments of the present invention, the antisense strand differs from SEQ ID NO: 299~SEQ ID NO: 911 by no more than 4 nucleotides; The nucleotide sequence shown in NO:595 differs by no more than one nucleotide; in some embodiments of the present invention, the antisense strand is any nucleotide sequence shown in SEQ ID NO: 299~SEQ ID NO:595, SEQ ID NO:751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911.
[0010] In some embodiments of the present invention, the sense strand and the antisense strand have a mismatch of no more than 3 nucleotides; in some embodiments of the present invention, the sense strand and the antisense strand have a mismatch of no more than 2 nucleotides; in some embodiments of the present invention, the sense strand and the antisense strand have a mismatch of no more than 1 nucleotide; in some embodiments of the present invention, the sense strand and the antisense strand are completely complementary.
[0011] Preferably, the sense strand and the antisense strand are complementary to each other by at least 15, 16, 17, 18, 19, 20 or 21 nucleotides.
[0012] In some embodiments of the present invention, the antisense strand is 19-27 nucleotides long; the sense strand is 19-25 nucleotides long.
[0013] In some embodiments of the present invention, the antisense strand is 19-23 nucleotides long; the sense strand is 19-21 nucleotides long.
[0014] In some embodiments of the present invention, the antisense strand is 23 nucleotides long and the sense strand is 21 nucleotides long. In some embodiments of the present invention, the antisense strand is 22 nucleotides long and the sense strand is 20 nucleotides long. In some embodiments of the present invention, the antisense strand is 21 nucleotides long and the sense strand is 21 nucleotides long. In some embodiments of the present invention, the antisense strand is 21 nucleotides long and the sense strand is 19 nucleotides long. In some embodiments of the present invention, the antisense strand is 19 nucleotides long and the sense strand is 19 nucleotides long.
[0015] In some embodiments of the invention, the siRNA comprises one or more single-stranded nucleotide overhangs, such as 1, 2, 3, or 4 nucleotide overhangs. In some embodiments of the invention, the overhangs may be on the sense strand, the antisense strand, or any combination thereof. In some embodiments of the invention, the overhangs are located at the 5' end, the 3' end, or both ends of the antisense strand or the sense strand of the siRNA.
[0016] In some embodiments of the present invention, the siRNA has a two-nucleotide overhang at the 3' end of the antisense strand.
[0017] In some embodiments of the present invention, the siRNA has a blunt end. In some embodiments of the present invention, the siRNA has at least one blunt end located at the 5' end of the antisense strand (or the 3' end of the sense strand).
[0018] In some embodiments of the present invention, the siRNA has two blunt ends.
[0019] In some embodiments of the present invention, the nucleotide sequence (5'→3') of the siRNA is selected from duplex 1 to duplex 297:
[0020] Table 1. Sensitive and antisense strand sequences of unmodified siRNA duplexes
[0021]
[0022] In some embodiments of the present invention, the siRNA contains at least one modifying nucleotide.
[0023] In some embodiments of the present invention, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs.
[0024] In some embodiments of the present invention, the modified nucleotide is selected from 2'-methoxynucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, 2',3'-cleaved nucleotide analogs, 2'-fluoroarabinonucleotides, 2'-methoxyethylnucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, 3'-methoxynucleotides, 2'-allyl-modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate groups, nucleotides containing 5'-phosphate mimics, diol-modified nucleotides, debased nucleotides, morpholinonucleotides, threonucleotides, locked nucleotides, unlocked nucleotides, glycerol nucleotides, or base-modified nucleotides.
[0025] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0026] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0027] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 2nd, 6th, 14th, and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 9th, 10th, and 11th positions of the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0028] In some embodiments of the invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0029] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, 11, and 15 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0030] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 3, 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0031] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0032] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 3, 4, 6, 8, 10, 14, 16, 18, 20, and 22 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein position 2 at the 5' end of the sense strand is a 2'-fluoronucleotide, and the remaining positions are 2'-methoxynucleotides.
[0033] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 4, 5, 6, 8, 10, 14, 16, 18, 20, and 22 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein position 2 at the 5' end of the sense strand is a 2'-fluoronucleotide, and the remaining positions are 2'-methoxynucleotides.
[0034] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 4, 6, 7, 8, 10, 14, 16, 18, 20, and 22 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein position 2 at the 5' end of the sense strand is a 2'-fluoronucleotide, and the remaining positions are 2'-methoxynucleotides.
[0035] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, 19, and 21 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0036] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 4, 6, 8, 10, 14, 16, 18, 20, and 22 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 1, 3, 5, 7, 9, 10, 11, 13, 15, 17, 19, and 21 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0037] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 5, 7, and 12 at the 5' end of the antisense strand are 2'-deoxynucleotides, position 14 is a 2'-fluoronucleotide, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0038] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 5, 7, and 12 at the 5' end of the antisense strand are 2'-deoxynucleotides, positions 6, 8, 9, 10, 14, and 16 are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0039] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 5, 8, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0040] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 5, 7, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0041] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 5, 8, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0042] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 5, 7, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0043] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 5, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0044] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 5, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0045] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 7, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0046] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 7, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0047] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, positions 5 and 7 are 2'-deoxynucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0048] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 14, and 16 of the 5' end of the antisense strand are 2'-fluoronucleotides, positions 5 and 7 are 2'-deoxynucleotides, and the remaining positions are 2'-methoxynucleotides. In some embodiments of the present invention, the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, and 11 of the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0049] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein the 2nd, 6th, 14th, and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 5th, 7th, and 9th positions of the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0050] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein the 2nd, 6th, 14th, and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 7th, 9th, 10th, and 11th positions of the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0051] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0052] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0053] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein the 2nd, 6th, 14th, and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein the 7th, 8th, and 9th positions of the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0054] In some embodiments of the present invention, the antisense strand of the siRNA is 19 nucleotides long, wherein positions 2, 4, 6, 8, 10, 12, 14, 16, and 18 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein positions 7, 8, and 9 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0055] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 14th position at the 5' end of the antisense strand is a 2'-fluoronucleotide, the 2nd, 5th, and 7th positions are 2'-deoxynucleotides, the 12th position is a threonucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 9th, 10th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0056] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 2nd, 6th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 9th, 10th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, the 1st position is a threonucleotide, and the remaining positions are 2'-methoxynucleotides.
[0057] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 22 is a threonucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0058] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 23 is a threonucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 10, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0059] In some embodiments of the present invention, the antisense strand of the siRNA is 22 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 20 nucleotides long, wherein positions 8, 9, and 10 at the 5' end of the sense strand are 2'-fluoronucleotides, position 1 is a threonucleotide, and the remaining positions are 2'-methoxynucleotides.
[0060] In some embodiments of the present invention, the antisense strand of the siRNA is 22 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 21 is a threonucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 20 nucleotides long, wherein positions 8, 9, and 10 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0061] In some embodiments of the present invention, the antisense strand of the siRNA is 22 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 22 is a threonucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 20 nucleotides long, wherein positions 8, 9, and 10 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0062] In some embodiments of the present invention, the antisense strand of the siRNA is 22 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 20 nucleotides long, wherein positions 8, 9, and 10 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0063] In some embodiments of the present invention, the antisense strand of the siRNA is 22 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 20 nucleotides long, wherein positions 6, 8, 9, and 10 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0064] In some embodiments of the present invention, the antisense strand of the siRNA is 22 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 20 nucleotides long, wherein positions 8, 9, and 10 at the 5' end of the sense strand are 2'-fluoronucleotides, position 6 is 2'-deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.
[0065] In some embodiments of the present invention, the antisense strand of the siRNA is 22 nucleotides long, wherein positions 2, 6, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 20 nucleotides long, wherein positions 6, 8, 9, and 10 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0066] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein the 2nd, 6th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein the 7th, 8th, and 9th positions at the 5' end of the sense strand are 2'-fluoronucleotides, the 1st position is a threonucleotide, and the remaining positions are 2'-methoxynucleotides.
[0067] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein the 2nd, 6th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 20th position is a threonucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein the 7th, 8th, and 9th positions at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0068] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein positions 2, 6, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 21 is a threonucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein positions 7, 8, and 9 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0069] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein positions 2, 6, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein positions 7, 8, and 9 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0070] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein positions 2, 5, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein positions 7, 8, and 9 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0071] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein positions 2, 7, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein positions 7, 8, and 9 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0072] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein the 2nd, 12th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 5th position is a 2'-deoxynucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein the 7th, 8th, and 9th positions at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0073] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein the 2nd, 12th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 7th position is a 2'-deoxynucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein the 7th, 8th, and 9th positions at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0074] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein the 2nd, 12th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 5th position is a 2'-deoxynucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein the 7th, 9th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0075] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein the 2nd, 12th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 7th position is a 2'-deoxynucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein the 7th, 9th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.
[0076] In some embodiments of the present invention, the modified nucleotide is a nucleotide in which the phosphate group is modified by a thiophosphate group. That is, a sulfur atom replaces the non-bridging oxygen atom in the phosphodiester bond, thereby replacing the phosphodiester bond with a thiophosphate diester bond.
[0077] In some embodiments of the present invention, the 5' end and 3' end of the sense chain each independently contain 0, 1, or 2 thiophosphate groups; and / or the 5' end and 3' end of the antisense chain each independently contain 1 or 2 thiophosphate groups.
[0078] In some embodiments of the present invention, at least one of the nucleotides at positions 1 and 2 of the 5' end of the sense strand, the nucleotides at positions 2 and 3 of the 5' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the sense strand, the nucleotides at positions 2 and 3 of the 3' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the antisense strand, the nucleotides at positions 2 and 3 of the 3' end of the antisense strand, the nucleotides at positions 1 and 2 of the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 of the 5' end of the antisense strand are linked by a thiophosphate group; preferably, at least four are linked by thiophosphate groups; in some embodiments of the present invention, at least six are linked by thiophosphate groups; in some embodiments of the present invention, all eight are linked by thiophosphate groups.
[0079] In some embodiments of the present invention, the nucleotides at positions 1 and 2, and at positions 2 and 3, of the 5' end of the positive strand are linked by phosphate thioester groups.
[0080] In some embodiments of the present invention, the nucleotides at positions 1 and 2, and positions 2 and 3 at the 5' end of the positive strand are linked by thiophosphate groups, and the nucleotides at positions 1 and 2, and positions 2 and 3 at the 3' end are linked by thiophosphate groups.
[0081] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand are linked by thiophosphate groups, and the nucleotides at positions 2 and 3 at the 5' end are linked by thiophosphate groups.
[0082] In some embodiments of the present invention, the nucleotides at positions 1 and 2 of the 5' end of the sense strand, the nucleotides at positions 2 and 3 of the 5' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the sense strand, the nucleotides at positions 2 and 3 of the 3' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the antisense strand, the nucleotides at positions 2 and 3 of the 3' end of the antisense strand, the nucleotides at positions 1 and 2 of the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 of the 5' end of the antisense strand are all linked by thiophosphate groups.
[0083] In some embodiments of the present invention, the positive strand may include one or more capping residues or portions, referred to as "capping residues". A "capping residue" is a non-nucleotide compound or other portion that can be incorporated into one or more ends of a nucleotide sequence of siRNA. In some embodiments of the present invention, the capping residues are present at the 5' end, the 3' end, or both the 5' end and the 3' end of the positive strand.
[0084] In some embodiments of the present invention, an inverse debasing residue (invAb) is added as a capping residue. See F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16. In some embodiments of the present invention, the 5' end and / or 3' end of the positive strand may contain more than one inverse debasing deoxyribose moiety as a capping residue.
[0085] In some embodiments of the invention, one or more inverse debase residues (invAb) are added to the 3' end of the positive strand. In some embodiments of the invention, one or more inverse debase residues (invAb) are added to the 5' end of the positive strand. In some embodiments of the invention, one or more inverse debase residues may be inserted between the target ligand and the nucleotide sequence of the siRNA positive strand. In some embodiments of the invention, one or more inverse debase residues are included at or near one or more ends of the siRNA positive strand.
[0086] In some embodiments of the invention, one or more inverse abase residues (invAb) are added to the 5' end of the sense strand. In some embodiments of the invention, one or more inverse abase residues may be inserted between the nucleotide sequence of the target ligand and the sense strand of the siRNA.
[0087] Reverse debasing residues can be linked to nucleic acids via phosphodiester bonds, thiophosphate diester bonds, etc.
[0088] In some embodiments of the present invention, the first nucleotide at the 5' end of the antisense strand is selected from the following structures:
[0089] Wherein, Base is a base A, U, G, C, T or other modified bases.
[0090] In some embodiments of the present invention, the first nucleotide at the 5' end of the antisense strand is a (E)-vinyl phosphate modified nucleotide.
[0091] In some embodiments of the present invention, the siRNA contains at least one base-modified nucleotide.
[0092] In some embodiments of the present invention, the bases of the base-modified nucleotide are selected from the following structures:
[0093] In some embodiments of the present invention, the base-modified nucleotide may be located at positions 5, 6, 7, and 8 of the siRNA antisense strand.
[0094] In some embodiments of the present invention, the base-modified nucleotide may be located at the overhang of a single-stranded nucleotide in the siRNA.
[0095] Preferably, the siRNA antisense strand contains two nucleotide overhangs, and the base-modified nucleotide is the first nucleotide of the siRNA antisense strand overhang.
[0096] Preferably, the siRNA antisense strand contains two nucleotide overhangs, and the base-modified nucleotide is the second nucleotide of the siRNA antisense strand overhang.
[0097] For the modified siRNA duplexes listed in the table below, the base sequence of the sense strand before modification corresponds to one of SEQ ID NO: 2 to SEQ ID NO: 298, SEQ ID NO: 596 to SEQ ID NO: 750, SEQ ID NO: 906 to SEQ ID NO: 908 listed above, and the base sequence of the antisense strand before modification corresponds to one of SEQ ID NO: 299 to SEQ ID NO: 595, SEQ ID NO: 751 to SEQ ID NO: 905, SEQ ID NO: 909 to SEQ ID NO: 911 listed above.
[0098] As used herein, "modified siRNA double strand" refers to a siRNA double strand containing modifications. It should be noted that there is no necessary correspondence between the number X in "modified siRNA double strand X" and "unmodified siRNA double strand X" in this invention. Correspondingly, unless otherwise specified herein, the modified siRNA double strands provided in this invention are selected from, for example, modified siRNA double strands 1 to 297 provided in Table 2, and the unmodified siRNA double strands of this invention are selected from, for example, double strands 1 to 297 and double strands 298 to 455 provided in Table 1.
[0099] In some embodiments of the present invention, the nucleotide sequence (5'→3') of the modified siRNA is selected from modified duplexes 1 to 297 in Table 2:
[0100] Table 2. Sensitive and antisense strand sequences of the modified siRNA duplex
[0101]
[0102] The present invention also provides siRNA conjugates obtained by conjugating the above-mentioned siRNA with conjugating molecules.
[0103] In this invention, unless otherwise specified, "conjugation" refers to the covalent connection between two or more chemical parts; "conjugated compound" refers to a compound formed by the covalent connection between various chemical parts; and "siRNA conjugated compound" refers to a compound formed by the covalent attachment of one or more chemical parts to siRNA. It should be noted that the chemical parts can be directly attached to the siRNA or attached to the siRNA via a linker.
[0104] In this invention, unless otherwise specified, the "-" in "connector-targeting ligand" refers to the covalent connection between the connector and the targeting ligand.
[0105] In some embodiments of the present invention, the targeting ligand is linked to siRNA via a linker to form a conjugate molecule.
[0106] In some embodiments of the present invention, the targeting ligand forms a conjugated molecule via a linker, which is independently or simultaneously attached to the 3' or 5' end of the siRNA's positive strand.
[0107] In some embodiments of the present invention, the siRNA of the present invention can be conjugated with a pharmaceutically acceptable conjugating molecule to obtain an siRNA conjugate. In some embodiments of the present invention, the siRNA is covalently conjugated to the conjugating molecule. To reduce the potential impact of conjugation on siRNA activity, the conjugation site between the siRNA and the conjugating molecule can be at the 3' or 5' end of the siRNA's sense strand, or at the 5' end of the antisense strand. In some embodiments, the conjugation site between the siRNA and the conjugating molecule can also be within the internal sequence of the siRNA.
[0108] The pharmaceutically acceptable targeting ligand may be a targeting ligand commonly used in the field of siRNA drug delivery, such as, but not limited to, one or more of the following targeting ligands or their derivatives: lipophilic molecules, such as cholesterol, bile acids, vitamins (e.g., vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as transmembrane peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid; or receptor ligands expressed by hepatocytes, such as desialyl glycoprotein, desialyl sugar residues, lipoproteins (e.g., high-density lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitters (e.g., adrenaline), growth factors, transferrin, etc.
[0109] In some embodiments of the present invention, the targeting ligand is N-acetylgalactosamine.
[0110] In some embodiments of the present invention, the targeting ligand is directly attached to the 3' end of the siRNA positive strand.
[0111] In some embodiments of the present invention, the targeting ligand is directly attached to the 5' end of the siRNA positive strand.
[0112] In some embodiments of the present invention, the targeting ligand is attached to the 3' end of the siRNA positive strand via a adapter.
[0113] In some embodiments of the present invention, the targeting ligand is attached to the 5' end of the siRNA positive strand via a adapter.
[0114] In some embodiments of the present invention, the targeting ligand is N-acetylgalactosamine, which is attached to the 3' end of the siRNA sense strand via a linker.
[0115] In some embodiments of the present invention, the targeting ligand is GalNAc(L96), having the following structure:
[0116] In some embodiments of the present invention, GalNAc(L96) is linked to the 3' end of the siRNA positive strand.
[0117] In some embodiments of the present invention, GalNAc(L96) is linked to the 5' end of the siRNA positive strand.
[0118] In some embodiments of the present invention, GalNAc(L96) is linked to the inverse ablation residue (invAb) at the 3' end of the siRNA positive strand.
[0119] In some embodiments of the present invention, GalNAc(L96) is linked to the inverse ablation residue (invAb) at the 5' end of the siRNA positive strand.
[0120] In some embodiments of the present invention, the targeting ligand is Ser(GN) and has the following structure:
[0121] In some embodiments of the present invention, Ser(GN) is attached to the 3' end of the siRNA positive strand. In some embodiments of the present invention, Ser(GN) is attached to the 5' end of the siRNA positive strand.
[0122] In some embodiments of the present invention, Ser(GN) is simultaneously linked to both the 3' and 5' ends of the siRNA positive strand.
[0123] In some embodiments of the present invention, the GalNAc targeting ligand LP-GalNAc structure (attached to the 5' end of the positive chain) is as follows:
[0124] In some embodiments of the present invention, the GalNAc targeting ligand structure XY-GalNAc (attached to the 3' end of the positive chain) is shown below: or
[0125] In some embodiments of the present invention, other GalNAc targeting ligand structures used (attached to the 5'-terminus of the positive chain) are as follows:
[0126] In some embodiments of the present invention, other GalNAc targeting ligand structures used (attached to the 3'-terminus of the positive chain) are as follows:
[0127] For the modified siRNA conjugates listed in the table below, the base sequence of the sense strand of each modified siRNA conjugate before modification corresponds to one of SEQ ID NO: 2 to SEQ ID NO: 298, SEQ ID NO: 596 to SEQ ID NO: 750, SEQ ID NO: 906 to SEQ ID NO: 908 listed above, and the base sequence of the antisense strand before modification corresponds to one of SEQ ID NO: 299 to SEQ ID NO: 595, SEQ ID NO: 751 to SEQ ID NO: 904, SEQ ID NO: 909 to SEQ ID NO: 911 listed above.
[0128] As used herein, "modified siRNA conjugate" (or "conjugate") refers to an siRNA conjugate obtained by conjugating a modified siRNA double strand with a conjugate molecule. It should be noted that there is no necessary correspondence between "modified siRNA conjugate X" (or "conjugate X") and the number X in "modified siRNA double strand X" or "unmodified siRNA double strand X". For example, "modified siRNA conjugate 237" (or "conjugate 237") does not necessarily correspond to "modified siRNA double strand 237" or "unmodified siRNA double strand 237". In other words, "modified siRNA conjugate 237" does not refer to a double strand obtained by modifying or conjugating "modified siRNA double strand 237" or "unmodified siRNA double strand 237". Correspondingly, unless otherwise specified, the modified siRNA conjugates provided in this invention are selected from, for example, modified siRNA conjugates 1 to 256 provided in Table 3.
[0129] In some embodiments of the present invention, the siRNA conjugate is selected from conjugate 1 to conjugate 256:
[0130] Table 3. Sequences of modified siRNA conjugates
[0131]
[0132] The structural characterization methods and results of modified double strands and conjugates are detailed in Tables 3b and 3c.
[0133] Representative LC-MS test method: When the test sample is subjected to denaturing IP·RP-LC detection, the complementary double strands are untied into single strands (sense and antisense strands). Then, the parent ions of the sense and antisense strands are fragmented by tandem mass spectrometry. All detected fragment ions are analyzed and resolved using the software CONFIRM Sequence. The sequence of the test sample is consistent with the theoretical sequence, that is, the deviation between the actual molecular weight (MW) and the theoretical molecular weight (MW) is less than 0.05%. The results are shown in Tables 3b and 3c.
[0134] Table 3b Molecular weight (MW) of modified double strands
[0135] Table 3c shows the molecular weight (MW) of the conjugates.
[0136] The present invention also provides a pharmaceutical composition comprising any of the above-described siRNAs and / or any of the above-described siRNA conjugates and a pharmaceutically acceptable carrier.
[0137] In some embodiments, the pharmaceutically acceptable carrier is a delivery carrier. A delivery carrier is a substance that improves the delivery of nucleic acids or oligonucleotides to cells or tissues. Such substances can be any delivery carrier known in the art suitable for the delivery of nucleic acids or oligonucleotides, including but not limited to: viruses (retroviruses, adenoviruses, lentiviruses, baculoviruses, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacteria (tkRNAi); lipid nanoparticles (LNP); neutral liposomes (NL); polymer nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs), etc.
[0138] In some implementations, the siRNA may be encapsulated by the delivery vector.
[0139] In some embodiments of the invention, the pharmaceutical composition contains one siRNA as described in the first aspect. In other embodiments of this disclosure, the pharmaceutical composition contains at least two siRNAs as described in the first aspect (e.g., but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) as active ingredients. Preferably, the at least two siRNAs as described in the first aspect each target different target sequences in the INHBE gene, thereby expecting to exert synergistic effects by acting simultaneously on different target sequences. Here, "different target sequences" means that there is no overlap between target sequences, or the number of overlapping consecutive nucleotides between target sequences is less than 5 (e.g., the number of overlapping consecutive nucleotides is 4, 3, 2, 1, or 0). In this case, the at least two siRNAs as described in the first aspect can be present in any different proportions. Preferably, the at least two siRNAs as described in the first aspect may exist in a molar ratio of 1:100 to 100:1; more preferably, the at least two siRNAs as described in the first aspect may exist in a molar ratio of 1:10 to 10:1, 1:5 to 5:1, or 1:2 to 2:1. In some embodiments of the present invention, the at least two siRNAs as described in the first aspect exist in the same molar ratio.
[0140] The present invention also provides the use of any of the above-described siRNAs and / or any of the above-described siRNA conjugates and / or the above-described pharmaceutical compositions in the preparation of a medicament for treating pathological conditions or diseases associated with INHBE gene expression.
[0141] Further, the pathological condition or disease is a metabolic disease and / or a cardiovascular disease. More preferably, the metabolic disease is obesity, type 2 diabetes mellitus (T2DM), insulin resistance, lipodystrophy, fatty liver disease, non-alcoholic fatty liver disease (NAFLD) or metabolic dysfunction-related fatty liver disease (MAFLD), non-alcoholic steatohepatitis (NASH) or metabolic dysfunction-related steatohepatitis (MASH); the cardiovascular disease is hyperlipidemia or dyslipidemia, atherosclerosis, cardiomyopathy, heart failure, or coronary heart disease (CHD).
[0142] The siRNA, siRNA conjugates, and pharmaceutical compositions provided by this invention have good stability, excellent INHBE gene inhibitory activity, satisfactory cytotoxicity and immunostimulatory properties, and can significantly reduce body fat levels, weight, and improve metabolic abnormalities.
[0143] The sequence of the INHBE gene targeted by siRNA in this invention is shown in SEQ ID NO: 1:
[0144] SEQ ID NO: 1 (INHBE gene)
[0145] 1 AGTAGCCAGA CATGAGCTGT GAGGGTCAAG CACAGCTATC CATCAGATGA TCTACTTTCA
[0146] 61 GCCTTCCTGA GTCCCAGACA ATAGAAGACA GGTGGCTGTA CCCTTGGCCA AGGGTAGGTG
[0147] 121 TGGCAGTGGT GTCTGCTGTC ACTGTGCCCT CATTGGCCCC CAGCAATCAG ACTCAACAGA
[0148] 181 CGGAGCAACT GCCATCCGAG GCTCCTGAAC CAGGGCCATT CACCAGGAGC ATGCGGCTCC
[0149] 241 CTGATGTCCA GCTCTGGCTG GTGCTGCTGT GGGCACTGGT GCGAGCACAG GGGACAGGGT
[0150] 301 CTGTGTGTCC CTCCTGTGGG GGCTCCAAAC TGGCACCCCA AGCAGAACGA GCTCTGGTGC
[0151] 361 TGGAGCTAGC CAAGCAGCAA ATCCTGGATG GGTTGCACCT GACCAGTCGT CCCAGAATAA
[0152] 421 CTCATCCTCC ACCCCAGGCA GCGCTGACCA GAGCCCTCCG GAGACTACAG CCAGGGAGTG
[0153] 481 TGGCTCCAGG GAATGGGGAG GAGGTCATCA GCTTTGCTAC TGTCACAGAC TCCACTTCAG
[0154] 541 CCTACAGCTC CCTGCTCACT TTTCACCTGT CCACTCCTCG GTCCCACCAC CTGTACCATG
[0155] 601 CCCGCCTGTG GCTGCACGTG CTCCCCACCC TTCCTGGCAC TCTTTGCTTG AGGATCTTCC
[0156] 661 GATGGGGACC AAGGAGGAGG CGCCAAGGGT CCCGCACTCT CCTGGCTGAG CACCACATCA
[0157] 721 CCAACCTGGG CTGGCATACC TTAACTCTGC CCTCTAGTGG CTTGAGGGGT GAGAAGTCTG
[0158] 781 GTGTCCTGAA ACTGCAACTA GACTGCAGAC CCCTAGAAGG CAACAGCACA GTTACTGGAC
[0159] 841 AACCGAGGCG GCTCTTGGAC ACAGCAGGAC ACCAGCAGCC CTTCCTAGAG CTTAAGATCC
[0160] 901 GAGCCAATGA GCCTGGAGCA GGCCGGGCCA GGAGGAGGAC CCCCACCTGT GAGCCTGCGA
[0161] 961 CCCCCTTATG TTGCAGGCGA GACCATTACG TAGACTTCCA GGAACTGGGA TGGCGGGACT
[0162] 1021 GGATACTGCA GCCCGAGGGG TACCAGCTGA ATTACTGCAG TGGGCAGTGCCCTCCCCACC
[0163] 1081 TGGCTGGCAG CCCAGGCATT GCTGCCTCTT TCCATTCTGC CGTCTTCAGCCTCCTCAAAG
[0164] 1141 CCAACAATCC TTGGCCTGCC AGTACCTCCT GTTGTGTCCC TACTGCCCGAAGGCCCCTCT
[0165] 1201 CTCTCCTCTA CCTGGATCAT AATGGCAATG TGGTCAAGAC GGATGTGCCAGATATGGTGG
[0166] 1261 TGGAGGCCTG TGGCTGCAGC TAGCAAGAGG ACCTGGGGCT TTGGAGTGAAGAGACCAAGA
[0167] 1321 TGAAGTTTCC CAGGCACAGG GCATCTGTGA CTGGAGGCAT CAGATTCCTGATCCACACCC
[0168] 1381 CAACCCAACA ACCACCTGGC AATATGACTC ACTTGACCCC TATGGGACCCAAATGGGCAC
[0169] 1441 TTTCTTGTCT GAGACTCTGG CTTATTCCAG GTTGGCTGAT GTGTTGGGAGATGGGTAAAG
[0170] 1501 CGTTTCTTCT AAAGGGGTCT ACCCAGAAAG CATGATTTCC TGCCCTAAGTCCTGTGAGAA
[0171] 1561 GATGTCAGGG ACTAGGGAGG GAGGGAGGGA AGGCAGAGAA AAATTACTTAGCCTCTCCCA
[0172] 1621 AGATGAGAAA GTCCTCAAGT GAGGGGAGGA GGAAGCAGAT AGATGGTCCAGCAGGCTTGA
[0173] 1681 AGCAGGGTAA GCAGGCTGGC CCAGGGTAAG GGCTGTTGAG GTACCTTAAGGGAAGGTCAA
[0174] 1741 GAGGGAGATG GGCAAGGCGC TGAGGGAGGA TGCTTAGGGG ACCCCCAGAAACAGGAGTCA
[0175] 1801 GGAAAATGAG GCACTAAGCC TAAGAAGTTC CCTGGTTTTT CCCAGGGGACAGGACCCACT
[0176] 1861 GGGAGACAAG CATTTATACT TTCTTTCTTC TTTTTTATTT TTTTGAGATCGAGTCTCGCT
[0177] 1921 CTGTCACCAG GCTGGAGTGC AGTGACACGA TCTTGGCTCA CTGCAACCTCCGTCTCCTGG
[0178] 1981 GTTCAAGTGA TTCTTCTGCC TCAGCCTCCC GAGCAGCTGG GATTACAGGCGCCCACTAAT
[0179] 2041 TTTTGTATTC TTAGTAGAAA CGAGGTTTCA ACATGTTGGC CAGGATGGTCTCAATCCTT
[0180] 2101 GACCTCTTGA TCCACCCGAC TTGGCCTCCC GAAGTGATGA GATTATAGGCGTGAGCCACC
[0181] 2161 GCGCCTGGCT TATACTTTCT TAATAAAAAG GAGAAAGAAA ATCAACAAATGTGAGTCATA
[0182] 2221 AAGAAGGGTT AGGGTGATGG TCCAGAGCAA CAGTTCTTCA AGTGTACTCTGTAGGCTTCT
[0183] 2281 GGGAGGTCCC TTTTCAGGGG TGTCCACAAA GTCAAAGCTA TTTTCATAATATACTAACA
[0184] 2341 TGTTATTTGC CTTTTGAATT CTCATTATCT TAAAATTGTA TTGTGGAGTTTTCCAGAGGC
[0185] 2401 CGTGTGACAT GTGATTACAT CATCTTTCTG ACATCATTGT TAATGGAATGTGTGCTTGTA
[0186] In this invention, "siRNA" refers to an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that contains the ability to reduce or inhibit the translation of messenger RNA (mRNA) in a sequence-specific manner. siRNA can function through RNA interference mechanisms (e.g., by interacting with the mRNA interference pathway mechanism in mammalian cells (RNA-induced silencing complex RISC)) or any other mechanism or pathway. While the term siRNA drug as used in this invention is considered to function primarily through RNA interference mechanisms, the siRNA drug is not limited to any particular pathway or mechanism of action. siRNA drugs include, but are not limited to, single-stranded antisense oligonucleotides, short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer enzyme substrates. The siRNA drug of this invention consists of an oligonucleotide chain having at least a partial complementarity to the mRNA that serves as the target. In some embodiments, the siRNA drug of this invention is double-stranded and consists of an antisense strand and a sense strand that is at least partially complementary to the antisense strand.
[0187] The term "sequence" or "nucleotide sequence" refers to the order or sequence of nucleobases or nucleotides, expressed alphabetically using standard nucleotide nomenclature.
[0188] In this invention, unless otherwise specified, uppercase letters C, G, U, A, and T represent the base composition of nucleotides: C (cytosine), G (guanine), U (uracil), A (adenine), and T (thymine), including modified and unmodified nucleotides; lowercase letter m indicates that the nucleotide adjacent to the right of the identifier m is a 2'-methoxynucleotide; lowercase letter f indicates that the nucleotide adjacent to the right of the identifier f is a 2'-fluoronucleotide; lowercase letter d indicates that the nucleotide adjacent to the right of the identifier d is a 2'-deoxynucleotide; the identifier * indicates that the two nucleotides adjacent to the identifier * on the left and right are linked by a thiophosphate group (or between a nucleotide and a target ligand); eVP indicates that the nucleotide adjacent to its right is a (E)-vinyl phosphate modified nucleotide; invAb indicates a reverse debase residue; L96 indicates that the target ligand GalNAc (L96) is conjugated at this location; Ser (GN) indicates that the target ligand Ser (GN) is conjugated at this location; A1GN indicates that the target ligand A1GN is conjugated at this location.
[0189] In this invention, unless otherwise specified, ln refers to locked nucleic acid (LNA), and cEt refers to 2'-O-ethyl-bridged nucleic acid, the structure of which is described below:
[0190] Wherein, Base is a base A, U, G, 5mC, T or other modified bases.
[0191] in" "" indicates that it is linked to the rest of the oligonucleotide via a phosphodiester bond or a thiophosphate diester bond.
[0192] In this invention, unless otherwise specified, the term "complementary" refers to the ability of an oligonucleotide of a first sequence to hybridize with an oligonucleotide of a second sequence under certain conditions and form a double-stranded structure. "At least partially complementary" means that the two sequences can be completely complementary, or have no more than 5, 4, 3, or 2 mismatched base pairs in total, while retaining the ability to hybridize under the relevant conditions. Furthermore, where the two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered mismatches for determining complementarity. In this invention, to satisfy the above hybridization ability requirements, the "complementary" sequence may also include or consist entirely of base pairs formed from non-Watson-Crick base pairs and / or from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U swing base pairs or Hoogstein base pairs. Correspondingly, in this invention, unless otherwise specified, "mismatch" means that in the siRNA double-stranded molecule, the bases at corresponding positions are not paired in a complementary manner.
[0193] In this invention, unless otherwise specified, "difference in nucleotide sequence" refers to a change in the type of bases of nucleotides at the same or corresponding positions compared to the original nucleotide sequence. For example, if a nucleotide base in the original nucleotide sequence is A, and the nucleotide base at the same or corresponding position is changed to U, C, G, or dT, dC, dG, etc., a difference in nucleotide sequence is considered to exist at that position. It should be noted that if, compared to the original nucleotide sequence, the nucleotides at the same or corresponding positions differ only in the presence or type of modification, a difference in nucleotide sequence is not considered to exist at that position. For example, if a nucleotide base in the original nucleotide sequence is U, and the nucleotide at the same or corresponding position is dT or a nucleotide modified with other bases (such as I, m6A, X, B), a difference in nucleotide sequence is not considered to exist at that position.
[0194] In this invention, unless otherwise specified, the term "pharmaceutical acceptable" means that the carrier, transporter, diluent, excipient and / or the salt / ester / hydrate formed therefrom is generally chemically or physically compatible with other components constituting a drug dosage form and physiologically compatible with the receptor.
[0195] In this invention, unless otherwise specified, the term "inhibition" refers to the down-regulation of target gene expression due to siRNA-mediated mRNA degradation. "Down-regulation" refers to a decrease in target gene expression level of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or more, or even 100%, compared to the absence of siRNA treatment. A 100% decrease in target gene expression level means that there is no detectable level of target gene expression.
[0196] In this invention, the siRNA may also contain modified nucleotides as needed, and the modified nucleotides will not cause a significant weakening or loss of the siRNA's function in inhibiting INHBE gene expression. Currently, there are various methods in the art for modifying siRNA, including, for example, backbone modification (such as phosphate group modification), ribose group modification, and base modification (Watts, JK, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55).
[0197] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0198] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention.
[0199] This application also relates to the following implementation schemes:
[0200] Implementation Scheme 1: A siRNA for inhibiting INHBE gene expression, characterized in that: the siRNA comprises a sense strand and an antisense strand; wherein, the antisense strand comprises at least 17 consecutive nucleotides differing from the nucleotide sequences shown in any one of SEQ ID NO: 299~SEQ ID NO: 595, SEQ ID NO: 751~SEQ ID NO: 904, SEQ ID NO: 909~SEQ ID NO: 911 by no more than 4 nucleotides, and the antisense strand is 17~30 nucleotides in length; the sense strand is 17~30 nucleotides in length and is at least partially complementary to the antisense strand.
[0201] Implementation Scheme 2: The siRNA according to Implementation Scheme 1 is characterized in that: the antisense strand is 19-27 nucleotides in length; and the sense strand is 19-25 nucleotides in length.
[0202] Implementation Scheme 3: The siRNA according to Implementation Scheme 1 is characterized in that: the antisense strand differs from any of the nucleotide sequences shown in SEQ ID NO:299~SEQ ID NO:595, SEQ ID NO:751~SEQ ID NO:904, SEQ ID NO:909~SEQ ID NO:911 by no more than 4 nucleotides.
[0203] Implementation Scheme 4: The siRNA according to Implementation Scheme 1 is characterized in that: the sense strand and the antisense strand have a mismatch of no more than 3 nucleotides.
[0204] Implementation Scheme 5: The siRNA according to Implementation Schemes 1-4 is characterized in that: the sequence of the siRNA is selected from double strand 1 to double strand 297 and double strand 298 to double strand 455 shown in Table 1.
[0205] Implementation Scheme 6: The siRNA according to any one of Implementation Schemes 1-5, characterized in that: the siRNA contains at least one modifying nucleotide.
[0206] Implementation Scheme 7: The siRNA according to Implementation Scheme 6 is characterized in that: all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs.
[0207] Implementation Scheme 8: The siRNA according to Implementation Scheme 7 is characterized in that: the modified nucleotide is selected from 2'-methoxynucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-cleaved nucleotide analog, 2'-fluoro-arabinonucleotide, 2'-methoxyethylnucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, 3'-methoxynucleotide, 2'-allyl-modified nucleotide, nucleotide containing a thiophosphate group, nucleotide containing a methylphosphonate group, nucleotide containing a 5'-phosphate group, nucleotide containing a 5'-phosphate mimic, diol-modified nucleotide, abase nucleotide, morpholinonucleotide, locked nucleotide, unlocked nucleotide, threonucleotide, or glycerol nucleotide.
[0208] Implementation Scheme 9: The siRNA according to any one of Implementation Schemes 1-8 is characterized in that: the 5' end and 3' end of the sense strand each independently contain 0, 1 or 2 thiophosphate groups linked together; and / or the 5' end and 3' end of the antisense strand each independently contain 1 or 2 thiophosphate groups linked together.
[0209] Implementation Scheme 10: The siRNA according to any one of Implementation Schemes 6-9, characterized in that: the siRNA is selected from modified double strand 1 to modified double strand 297 shown in Table 2.
[0210] Implementation Scheme 11: The siRNA according to any one of Implementation Schemes 1-10 is characterized in that: the first nucleotide at the 5' end of the antisense strand is a (E)-vinyl phosphate modified nucleotide, and / or the 5' end and / or 3' end of the sense strand optionally contain capping residues (e.g., invAb).
[0211] Implementation Scheme 12: The siRNA according to any one of Implementation Schemes 1-11 is characterized in that: the siRNA contains at least one base-modified nucleotide.
[0212] Implementation Scheme 13: siRNA conjugate obtained by conjugating the siRNA described in any one of Implementation Schemes 1-12 with a conjugating molecule.
[0213] Implementation Scheme 14: The siRNA conjugate according to Implementation Scheme 13 is characterized in that: the targeting ligand optionally forms a conjugate molecule through a linker, and is independently or simultaneously linked to the 3' end or 5' end of the siRNA sense strand.
[0214] Implementation Scheme 15: The siRNA conjugate according to Implementation Scheme 14, characterized in that: the targeting ligand is GalNAc (L96) or Ser (GN), or GalNAc (Ser1), GalNAc (Ser2), GalNAc (Ser3), GalNAc (Ser4), or LP-GalNAc, XY-GalNAc, GalNAc (A1GN), GalNAc (A1dGN), GalNAc (A3GN), GalNAc (A3dGN), GalNAc (A5GN), GAlNAc (NAG25), GAlNAc (NAG37).
[0215] GalNAc(L96) has the following structure:
[0216] Ser(GN) can have the following structure:
[0217] GalNAc(Ser1), GalNAc(Ser2), GalNAc(Ser3), and GalNAc(Ser4) have the following structures:
[0218] LP-GalNAc has the following structure:
[0219] XY-GalNAc has the following structure: or
[0220] GalNAc(A1GN), GalNAc(A1dGN), GalNAc(A3GN), GalNAc(A3dGN), GalNAc(A5GN), GAlNAc(NAG25), and GAlNAc(NAG37) have the following structures:
[0221] The aforementioned targeting ligand portion is attached to the 3' end of the siRNA positive strand, or to the 5' end of the siRNA positive strand, or to the inverse debasement residue (invAb) at the 3' end of the siRNA positive strand, or to the inverse debasement residue (invAb) at the 5' end of the siRNA positive strand, or one or more of the aforementioned targeting ligand portions are simultaneously attached to the 3' end of the siRNA positive strand, the 5' end of the siRNA positive strand, the inverse debasement residue (invAb) at the 3' end of the siRNA positive strand, or the inverse debasement residue (invAb) at the 5' end of the siRNA positive strand;
[0222] Preferably, the targeting ligand GalNAc (L96) or Ser (GN) is attached to the 3' end or the 5' end of the siRNA's positive strand; one or more Ser (GN) may be attached to both the 3' end and the 5' end of the siRNA's positive strand simultaneously.
[0223] More preferably, the targeting ligand GalNAc(L96) is attached to the 3' end of the siRNA's positive strand.
[0224] Implementation Scheme 16: The siRNA conjugate according to Implementation Schemes 14-15, characterized in that: the siRNA conjugate is selected from conjugate 1 to conjugate 256 shown in Table 3.
[0225] Implementation Scheme 17: A pharmaceutical composition characterized in that the pharmaceutical composition comprises siRNA as described in any one of Implementation Schemes 1-12 and / or siRNA conjugates as described in any one of Implementation Schemes 13-16 and a pharmaceutically acceptable carrier.
[0226] Implementation Scheme 18: Use of the siRNA described in any one of Implementation Schemes 1-12 and / or the siRNA conjugate described in any one of Implementation Schemes 13-16 and / or the pharmaceutical composition described in Implementation Scheme 17 in the preparation of a medicament for the treatment and / or prevention of pathological conditions or diseases associated with INHBE gene overexpression.
[0227] Implementation Scheme 19: According to the use described in Implementation Scheme 18, the pathological condition or disease is a metabolic disease and / or a cardiovascular disease; more preferably, the metabolic disease is obesity, type 2 diabetes mellitus (T2DM), insulin resistance, lipodystrophy, fatty liver disease, non-alcoholic fatty liver disease (NAFLD) or metabolic dysfunction-related fatty liver disease (MAFLD), non-alcoholic steatohepatitis (NASH) or metabolic dysfunction-related steatohepatitis (MASH); the cardiovascular disease is hyperlipidemia or dyslipidemia, atherosclerosis, cardiomyopathy, heart failure, or coronary heart disease (CHD).
[0228] Beneficial effects: The siRNA and its conjugates of the present invention have good to excellent in vitro INHBE gene expression inhibitory activity. They can effectively inhibit the level of INHBE mRNA in a variety of cell lines, have satisfactory immunostimulatory properties, no obvious off-target effects, and can significantly reduce the expression of INHBE mRNA in animal levels with good persistence. Attached Figure Description
[0229] Figure 1 The stability of conjugates 3 and 244 against 3' exonucleases was demonstrated.
[0230] Figure 2 Display using 100nM ( Figure 2 -A) and 10 nM ( Figure 2 -B) Volcano plot of differentially expressed genes (DEGs) between different groups in human primary hepatocytes (PHH) treated with conjugate 3. Detailed Implementation
[0231] Those skilled in the art will recognize that the siRNA described in this invention can be obtained using conventional siRNA preparation methods (e.g., solid-phase synthesis and liquid-phase synthesis), both of which are commercially available custom-made services. Those skilled in the art will also understand that modified nucleotide groups can be introduced into the siRNA described in this invention using appropriately modified nucleotide monomers. Methods for preparing appropriately modified nucleotide monomers are well known to those skilled in the art, and commercially available monomers are also available.
[0232] Example 1: siRNA Synthesis
[0233] For the sense and antisense strands of the siRNA sequence of the present invention, as well as the sense and antisense strands of the modified double strands, deoxynucleoside CPG is used as a solid support; the sense strand is synthesized using the solid support, and the antisense strand is synthesized using universal CPG.
[0234] Sequence synthesis was performed using a 48-channel synthesizer at a scale of 0.2 μmol. The phosphoramide monomer was used at a concentration of 0.05 M, and the activator was 0.3 M BTT.
[0235] Sequence cutting and deprotection were performed in 1.5 ml tubes. The first step used AMA, followed by deprotection of the second-position protecting group using triethylamine trifluoride. For sequences containing all modifications at the second position, ammonia hydrolysis was performed. The cut and deprotected sequences were precipitated using an acetone:ethanol (80:20) mixture and dissolved in RNase-free water. Sequence accuracy was determined by LC-MS, quantification by spectrophotometry, and purity was determined by HPLC.
[0236] After HPLC purification, lyophilization, and quality control, the salt was replaced by sodium acetate alcohol precipitation, and then desalted using a 3KD ultrafiltration tube. After desalting, the sense and antisense strands were quantitatively determined by spectrophotometer, and then mixed and annealed at a 1:1 ratio to form siRNA duplexes.
[0237] Example 2: In vitro activity assay - Hep3B cell transfection
[0238] Cell culture and transfection
[0239] Cell culture: Hep3B cells (ATCC) were cultured at 37°C and 5% CO2 in MEM complete medium (Gibco, with 10% FBS) until near confluence. Cells were then trypsinized and seeded into 12-well plates, with 2.0 × 10⁶ cells per well. 5 Hep3B cells were cultured in 1.0 mL of MEM complete medium (Gibco, with 10% FBS) at 37°C and 5% CO2 for 16-24 h before transfection.
[0240] Cell transfection: Add 1.5 μL of lipofectamine RNAiMax (Invitrogen) to each well of opti-MEM, then add 50 μL of siRNA and mix. Add this mixture to a PCR tube and incubate at room temperature for 5 minutes. Finally, add this siRNA mixture to the cells and continue culturing for 24 hours before RNA extraction. Experiments were performed using siRNA concentrations of 10 nM and 0.1 nM, or 5 nM, 1 nM and 0.2 nM, or 1 nM and 0.2 nM.
[0241] RNA extraction
[0242] Using the Total RNA Isolation Kit (Omega, CAT: R6834-02): Collect cells, wash with 1% PBS, then add 400 μL of lysis buffer (containing 2% β-mercaptoethanol) to lyse the cells. Follow the instructions for the RNA isolation kit. Finally, add 30 μL of RNase-free water, let stand for 2 minutes, and then centrifuge at 14000g for 2 minutes to collect RNA.
[0243] cDNA synthesis
[0244] cDNA synthesis was performed using TransGold's gDNA removal and cDNA synthesis kit (TransGold Biotechnology Co., Ltd., Beijing, China, Cat# AE311-03). 1 μg of total RNA was added to each sample, and cDNA synthesis was performed using a gradient thermal cycler (LongGene, A600) following the manufacturer's instructions.
[0245] Real-time quantitative PCR
[0246] Add the synthesized cDNA and the mixed stock solution (containing primers, qPCR premix and ultrapure water) to a 384-well plate (Bokcom Biosystems Cat# PC-0040-9U) to make the final real-time quantitative PCR system contain 0.25 μM each of upstream and downstream primers of the target gene (INHBE) or internal reference gene (GADPH) and 1×SYBR Green premix (Applied Biosystems Cat #A25742).
[0247] Real-time PCR was performed using the ΔΔCt assay on an ABI QuantStudio™ 6 real-time PCR system. Each duplex was subjected to 3-4 independent transfection assays, with 3-4 assays performed for each transfection.
[0248] The Pc mentioned therein is a compound with the following sequence:
[0249] Chain of Justice (5'→3'): c*u*gucafCafGfAfCuccacuucau(L96)
[0250] Antisense strand (5'→3'): a*fU*gadAggnTggagucfUgfUgacag*u*a
[0251] Table 4. Results of Hep3B transfection assay with modified double-stranded polymers
[0252]
[0253] Table 5. Results of Hep3B transfection assay with modified double-stranded polymers
[0254]
[0255] Table 6. Results of Hep3B transfection assay with modified double-stranded Hep3B
[0256]
[0257] Table 7. Results of Hep3B transfection assay with modified double-stranded Hep3B
[0258]
[0259] Table 8. Results of Hep3B transfection assay for the conjugate.
[0260]
[0261] Example 3: In vitro activity assay - free uptake by human primary hepatocytes
[0262] After resuscitation, human primary hepatocytes were diluted with culture medium to a density of 600,000 cells / mL. Different concentrations of conjugates were added to 96-well collagen plates at 10 μL / well, followed by 90 μL / well of human primary hepatocytes (54,000 cells / well). A PBS control group was also included. The plates were incubated at 37°C with 5% CO2 for 48 hours. After 48 hours, the culture medium was removed, and cells were collected for RNA extraction. Total RNA was extracted using the RNeasy 96 Kit (QIAGEN-74182) according to the kit instructions. cDNA was then synthesized using the HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme-R323-01) according to the kit instructions. Real-time PCR was performed using the ΔΔCt assay on an Applied Biosystems-QuantStudio 7 Flex real-time PCR system (Tables 9-10). Among them, the reference conjugate Pc, which is known to have INHBE gene inhibitory effects, was used as a positive control. The information of the reference conjugate Pc is as follows:
[0263] Chain of Justice (5'→3'): c*u*gucafCafGfAfCuccacuucau(L96)
[0264] Antisense strand (5'→3'): a*fU*gadAggnTggagucfUgfUgacag*u*a
[0265] Table 9. Results of Free Uptake Test in Human Primary Hepatocytes
[0266]
[0267] Table 10. Results of Free Uptake Test in Human Primary Hepatocytes
[0268]
[0269] Example 4: In vivo activity testing of hINHBE overexpressing mice constructed by high-pressure tail vein injection of HDI.
[0270] Six- to seven-week-old mice were randomly divided into groups of 3 to 5 mice each based on their body weight. On Day 1, mice were subcutaneously injected with either the conjugate at a dose of 1 mpk (mg / kg) or 3 mpk, with an equal volume of PBS injected as a control. On Day 4 or Day 21, all mice were injected intravenously via the tail vein with 8% of their body weight of hINHBE plasmid DNA solution within 5 seconds. On Day 5 or Day 22 (24 h after INHBE plasmid injection), all mice were euthanized by CO2 inhalation, and their livers were collected. The hINHBE mRNA level in the liver was detected by qPCR to evaluate the knockdown effect of different conjugates on the target gene (Tables 11-12).
[0271] Table 11. Inhibition of hepatic hINHBE mRNA by conjugates in HDI-hINHBE mice
[0272]
[0273] Table 12. Inhibition of hepatic hINHBE mRNA by conjugates in HDI-hINHBE mice
[0274]
[0275] Example 5: Stability test of 3' exonuclease
[0276] A solution of conjugate 3 and conjugate 244 with a concentration of 0.26 mg / mL was prepared. 1 μL of 3' exonuclease (PDEI, Sigma-Aldrich) was added to 19 μL of the conjugate solution to bring the final concentrations of conjugate 3 and conjugate 244 to 0.25 μg / μL, and the final concentration of the exonuclease to 10 mU / μL. The mixture was incubated at 25°C for 0, 24, and 48 hours, and the reaction was immediately terminated by adding 2.5 μL of 0.5M EDTA. At time 0 hours, 0.5M EDTA was added to the 3' exonuclease to terminate the reaction before adding it to the conjugate 3 and conjugate 244 solution. The reaction termination solutions from the three time points were subjected to electrophoresis using 10% Native PAGE. The gel was stained with TBE+Gel-red for 10 to 15 minutes. After staining, the gel was examined, and the results were normalized using the 0-hour sample. The results are shown in Table 13. Figure 1 As shown.
[0277] Table 13: Normalization analysis of each sequence 0h sample yielded the following results:
[0278]
[0279] Results: After 48 hours of incubation with 3' exonuclease, >60% of the siRNA conjugates remained in both conjugates 3 and 244. These conjugates 3 and 244 exhibited excellent stability.
[0280] Example 6: INHBE RNAi Immunogenicity Test
[0281] Following the instructions of the Lipofectamine® 3000 Transfection Kit (Thermo-L3000-015), siRNA and the control compound polyIC (polyinosinic-polycytidylic acid) were transfected into freshly isolated and mixed human PBMCs, resulting in a final cell count of 20,000 cells / well. After incubation at 37°C with 5% CO2 for 24 hours, the cell supernatant was collected to detect the levels of IFNalpha, IL-6, and TNFalpha (using the Thermo-PPX-04-MXRWG3K cytokine kit). By comparing the cytokine levels with those in the control wells, the fold change of each siRNA corresponding to different cytokines was calculated to assess the induction effect of siRNA on different cytokines in human PBMCs (Table 14).
[0282] Table 14. Results of in vitro immunogenicity tests of the conjugates
[0283]
[0284] The above results indicate that conjugates 3, 23, and 33 of the present invention all have very low immunostimulatory activity.
[0285] Example 7: INHBE RNAi Off-Target Analysis - Human Primary Hepatocytes Free RNA Take-Up RNAseq
[0286] After resuscitation, human primary hepatocytes were diluted with culture medium to a density of 670,000 cells / mL. Different concentrations of conjugates were added at 50 μL / well to 24-well collagen plates, followed by 450 μL / well of human primary hepatocytes. A PBS control group was also included. The plates were then incubated at 37 °C with 5% CO2 for 48 hours. After 48 hours, the culture medium was removed, and the cells were collected for RNA extraction. Total RNA was extracted using the RNeasy 96 Kit (QIAGEN-74182) according to the kit instructions. One μg of extracted total RNA was collected and processed using the Ribo-off rRNA Depletion Kit (Human / Mouse / Rat) (Vazyme N406-02), the VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina (Vazyme NR604-02), and the VAHTS RNA Multiplex Oligos Set1-Set2 for Illumina (Vazyme N323 / N324) kits for library construction. All samples were sequenced using a next-generation sequencer (NovaSeq6000, Illumina), and the sequencing results were compared with those of blank samples to identify genes significantly downregulated after RNAi treatment (log2FoldChange ≤ -1, p-adjust < 0.05). Subsequently, cDNA was synthesized using the HiScript III RTSuperMix for qPCR (+gDNA wiper) (Vazyme-R323-01) according to the manufacturer's instructions. The ΔΔCt assay was used to validate the significantly downregulated genes using real-time fluorescence PCR in the Applied Biosystems-QuantStudio 7 Flex real-time fluorescence PCR system.
[0287] In sequencing analysis of human primary hepatocyte RNA samples treated with conjugate 3, only INHBE mRNA levels were significantly reduced. Specifically, as follows... Figure 2 -A (100nM) and Figure 2 -B (10 nM) is shown. This indicates that conjugate 3 has no significant off-target effects in human primary hepatocytes, and its inhibition of INHBE is highly specific.
[0288] Example 8: Activity test of the conjugate in cynomolgus monkeys
[0289] Healthy male cynomolgus macaques were selected during their environmental acclimatization period based on body weight, hematology, and blood biochemistry levels. They were randomly divided into groups of three. Baseline (pre-drug administration) liver samples were collected via liver biopsy. After 1-2 weeks of recovery, the animals were administered the drug via subcutaneous injection. The single-drug groups (conjugate 3, conjugate 23, and conjugate 33) received subcutaneous administration on Day 0 at a dose of 4.5 mg / kg; the conjugate 3 QM*2 group received subcutaneous administration on Day 0 and Day 28 at a dose of 4.5 mg / kg, for a total of two administrations; and the PBS group received a single subcutaneous injection on Day 0. Liver samples were collected via liver biopsy on Day 14, Day 28, Day 42, Day 56, and Day 84. The relative expression level of hepatic INHBE mRNA at different time points was detected using qPCR (Table 15).
[0290] Table 15. Inhibition of hepatic INHBE mRNA by the conjugate in cynomolgus monkeys
[0291]
[0292] NA indicates that it was not detected.
[0293] The results showed that conjugate 3, when administered subcutaneously at a single dose of 4.5 mg / kg, significantly inhibited INHBE mRNA in the liver of cynomolgus monkeys, and this inhibition persisted until Day 56 post-administration, with a maximum inhibition rate of approximately 70% (Days 14–42). When conjugate 3 was administered at doses of 4.5 mg / kg on Day 0 and Day 28, the inhibition rate of INHBE mRNA in the liver of cynomolgus monkeys reached 74% on Day 84. With a single subcutaneous dose of 4.5 mg / kg, conjugate 23 showed an inhibition rate of approximately 80% of INHBE mRNA in the liver of cynomolgus monkeys from Day 28 to Day 42, and 75% on Day 56. With a single subcutaneous dose of 4.5 mg / kg, conjugate 33 showed an inhibition rate of 82% of INHBE mRNA in the liver of cynomolgus monkeys on Day 42, 84% on Day 56, and 62% on Day 84.
[0294] In summary, the siRNA and its conjugates of this invention exhibit good to excellent in vitro INHBE gene expression inhibitory activity, effectively inhibiting INHBE mRNA levels in various cell lines, demonstrating satisfactory immunostimulatory activity, no significant off-target effects, and significantly and persistently reducing INHBE mRNA expression at the animal level.
Claims
1. siRNA conjugate, characterized in that: The siRNA conjugate is selected from conjugate 3 or conjugate 244, wherein... The positive chain sequence of conjugate 3 from 5' to 3' is as follows: mC*mU*mGmGmCmUmUmAfUfAfCmUmUmUmCmUmUmAmAmUmA GalNAc(L96), The antisense chain sequence from 5' to 3' is as follows: eVPmU*fA*mUmUfAmAmGfAmAmAmGfUmAfUmAfAmGmCmCmAmG*mG*mC; The positive chain sequence of conjugate 244 from 5' to 3' is as follows: mC*mU*mGmGmCmUmUmAfUfAfCmUmUmUmCmUmUmAmAmUmA GalNAc(L96), The antisense chain sequence from 5' to 3' is as follows: mU*fA*mUmUfAmAmGfAmAmAmGfUmAfUmAfAmGmCmCmAmG*mG*mC; in, The capital letters C, G, U, and A represent the base composition of nucleotides: C, cytosine; G, guanine; U, uracil; A, adenine. The lowercase letter 'm' indicates that the nucleotide adjacent to the right of the identifier 'm' is a 2'-methoxynucleotide; The lowercase letter f indicates that the nucleotide adjacent to the right of the f symbol is a 2'-fluoronucleotide; The asterisk (*) indicates that the two nucleotides adjacent to the asterisk on the left and right are linked by phosphate thioester groups. eVP indicates that the nucleotide adjacent to it on its right is a (E)-vinyl phosphate modified nucleotide; GalNAc(L96) indicates that the targeting ligand GalNAc(L96) is conjugated at this site, and GalNAc(L96) has the following structure: 。 2. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the siRNA conjugate of claim 1 and a pharmaceutically acceptable carrier.
3. Use of the siRNA conjugate of claim 1 and / or the pharmaceutical composition of claim 2 in the preparation of a medicament for treating obesity and type 2 diabetes.
Citation Information
Patent Citations
Metabolic disorder related target gene iRNA compositions and methods of use thereof
CN117716032A