Synthetic gene of coumarin in black bamboos and application of synthetic gene

Abstract

The invention discloses a coumarin synthetic gene in black bamboo and application thereof, and belongs to the technical field of molecular biology. The invention provides transcription factors PnMYB4 and PnMYB4-1 for promoting synthesis of coumarin in black bamboos and application of the transcription factors PnMYB4 and PnMYB4-1. The PnMYB4 and the PnMYB4-1 belong to an MYB transcription factor family, the length of a complete coding frame of the PnMYB4 is 762 basic groups, and the coded protein contains 253 amino acids; the length of a complete coding frame of the PnMYB4-1 is 744 basic groups, and the coded protein contains 253 amino acids. The coumarin substances in arabidopsis thaliana, which are respectively overexpressed by PnMYB4 and PnMYB4-1, are obviously increased, and in addition, the expression levels of coumarin synthetic genes such as AtPAL1, At4CL1 and AtC4H in overexpressed plants are obviously increased.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology technology, and particularly relates to a coumarin synthesis gene in Phyllostachys nigra and application thereof. BACKGROUND

[0002] Coumarin is a large class of plant secondary metabolites. It is named after the fact that it was first extracted from the plant Dipteryx odorata by Vogel in 1820. The structural diversity of coumarin compounds mainly comes from the difference in the type and position of the substituents of the parent nucleus. Among them, the more common coumarin types include catechol, scopoletin, imperatorin, 7-hydroxycoumarin, and osthol. Coumarin compounds mainly exist in the roots, stems, leaves, flowers, and fruits of plants, with the highest concentration in flowers and fruits, and a small amount in root exudates. They are widely distributed in the secondary metabolites of higher plants such as Umbelliferae, Rutaceae, Leguminosae, and Asteraceae. Coumarin compounds have extremely high application value and are widely used in the fields of medicine, industry, and agriculture. In the field of medicine, coumarin compounds have various medicinal activities such as antibacterial, antiviral (including anti-HIV), anticancer, antidepressant, and antioxidant activities. In the industrial field, coumarin compounds can be used in daily cosmetics, fragrances, beverages, cigarettes, rubber, and plastic products, and also can be used as fluorescent materials. In the field of pesticides, coumarin compounds can be used as plant protectants and plant growth regulators, and also can effectively inhibit the invasion of pathogenic microorganisms, having strong insecticidal activity. In addition, studies have shown that coumarin and its derivatives are involved in the formation of plant melanin. For example, brown rice has strong antioxidant capacity, which is related to the rich phenolic compounds, including various coumarin and flavonoid compounds. In Ustilago maydis, a new type of melanin has been proved to be synthesized from coumarin and its derivatives. The melanin substrate in black sesame (Sesamum indicum) also has the structural characteristics of catechol-type coumarin, and the melanin in black radish (Raphanus sativus) and black oat is a homopolymer composed of p-coumaric acid monomers.

[0003] The biosynthesis of coumarins in higher plants originates from the phenylpropanoid pathway. L-phenylalanine ammonia-lyase (PAL) in plants can convert L-phenylalanine into trans-cinnamic acid, which undergoes ortho-hydroxylation and para-hydroxylation under the action of cinnamic acid 2-hydroxylase (C2H) and cinnamic acid 4-hydroxylase (C4H) to form o-coumaric acid and p-coumaric acid, respectively, and then further reactions to form coumarins and other secondary metabolites. Among them, the key enzymes include 4-coumaric acid, coenzyme A ligase (4CL), caffeoyl coenzyme A-O-methyltransferase (CCoAOMT), coumarin synthase (COSY), etc. At present, studies have shown that the known coumarin synthesis pathway related enzymes include PAL, C4H, 4CL, C3H, HCT, CCoAOMT, COMT and BGLU. The metabolic pathways of typical coumarin derivatives such as umbelliferone, scopoletin and catechol have been reported: phenylalanine is converted into cinnamic acid under the catalysis of PAL enzyme, and then hydroxylation is generated by C4H enzyme to form p-coumaric acid. This intermediate is catalyzed by 4CL and C2'H enzyme to form dihydroxycinnamoyl coenzyme A, and finally umbelliferone is generated. There is another branch path with coumaric acid as the substrate: after being catalyzed by 4CL to generate p-coumaroyl coenzyme A, it is sequentially converted into caffeic acid, caffeoyl coenzyme A, caffeic aldehyde and coffee alcohol and other coumarin precursor substances under the catalysis of C3H, 4CL, CCR and CAD enzymes. Caffeic acid is catalyzed by COMT, 4CL and F6'H enzyme to generate 6-hydroxyferuloyl coenzyme A, and finally scopoletin is formed under the mediation of COSY enzyme. Under the action of UGT enzyme, scopoletin can be converted into anoscopine. In addition, umbelliferone as a precursor molecule of esculin, its methylation modification process (catalyzed by OMT) can also produce scopoletin. Scopoletin can be catalyzed by S8H enzyme to generate quercetin, and then form catechol-type coumarin with significant antioxidant properties under the action of CYP450 enzyme.

[0004] In addition, transcription factors are also involved in the regulation of coumarin biosynthesis, for example, MYB, bHLH and WRKY transcription factors may play an important role in regulating the expression of genes involved in coumarin biosynthesis (PAL, C4H, 4CL, CSE, HCT, CAD and CCoAOMT). Among them, the MYB transcription factor family is widely concerned by the academic community because of its important role in the regulation of plant growth and development, primary and secondary metabolism, and biological and non-biological stress conditions. The R2R3-MYB subfamily is the subfamily with the most members in the MYB transcription factor family. The proteins of R2R3-MYB subfamily members not only have a highly conserved MYB domain, but also have a highly variable other region, which makes R2R3-MYB subfamily genes have a wide range of functions, such as participating in plant phenylpropanoid metabolism, biological and non-biological stress, hormone response and plant defense response. Studies on the molecular mechanism of coumarin synthesis show that R2R3 type MYB transcription factor MYB15 in Arabidopsis thaliana is involved in defensive induction and produces a large amount of soluble phenolic substances: hydroxycinnamic acid ester (HCAE), hydroxycinnamic acid amide (HCAA), scopolamine and coumarin. In rice, R2R3 type MYB transcription factor MYB4 activates the HCAA synthesis pathway, enhances the immunity of rice, and up-regulates the genes of the cinnamic acid synthesis pathway such as CCoAOMT-2, PAL1, 4CL3, etc.

[0005] Bamboo contains a large amount of coumarin and other substances. Studies have shown that 8 kinds of clumping bamboo contain 5 kinds of coumarin compounds, including scopolin, scopoletin, umbelliferone, coumarin and ostryolide, through HPLC analysis. The content of these substances is between 2.07-67.54 mg / kg. The analysis of coumarin compounds in the leaves of 10 species of Pleioblastus shows that 6 kinds of coumarin compounds, including scopoletin, umbelliferone, 6,7-dimethoxycoumarin, coumarin and ostryolide, are detected, and the content of these substances is between 2.2082-20 mg / kg. In addition, researchers have determined the content of coumarin in the leaves of 11 bamboo species, including Dendrocalamopsis oldhami, Phyllostachys reticulata, Phyllostachys nuda, Phyllostachys aurea and Phyllostachys nigra. The results show that 3 types of coumarin compounds are detected in the leaves of Phyllostachys nigra, and the contents of coumarin and scopoletin in Phyllostachys nigra are significantly higher than those in other bamboo species.

[0006] In summary, the study of MYB transcription factors that play an important regulatory role in coumarin synthesis can help understand the mechanism of coumarin synthesis in bamboo. SUMMARY

[0007] In view of the problems existing in the prior art, the purpose of the present application is to design a technical scheme of coumarin synthesis genes in Phyllostachys nigra and their application.

[0008] The present application specifically adopts the following technical scheme to achieve the above purposes:

[0009] The first aspect of the present application provides a Phyllostachys nigra coumarin synthesis gene, which comprises a PnMYB4 gene and a PnMYB4-1 gene, wherein the nucleotide sequence of the PnMYB4 gene is shown as SEQ ID NO. 1, and the nucleotide sequence of the PnMYB4-1 gene is shown as SEQ ID NO. 2.

[0010] The second aspect of the present application provides a coding protein of the above-mentioned Phyllostachys nigra coumarin synthesis gene, wherein the amino acid sequence of the coding protein of the PnMYB4 gene is shown as SEQ ID NO. 3, and the amino acid sequence of the coding protein of the PnMYB4-1 gene is shown as SEQ ID NO. 4.

[0011] The third aspect of the present application provides a recombinant vector containing the above-mentioned Phyllostachys nigra coumarin synthesis gene.

[0012] The fourth aspect of the present application provides an engineering bacterium containing the above-mentioned recombinant vector.

[0013] The fifth aspect of the present application provides an application of the above-mentioned Phyllostachys nigra coumarin synthesis gene, the above-mentioned coding protein, the above-mentioned recombinant vector or the above-mentioned engineering bacterium in any one of the following aspects:

[0014] (1) an application in regulating plant coumarin synthesis;

[0015] (2) an application in cultivating a transgenic plant with high coumarin content.

[0016] Further, in the application, the plant comprises Phyllostachys nigra and Arabidopsis.

[0017] The sixth aspect of the present application provides a method for increasing the coumarin content of a plant, which comprises: causing the plant to contain the above-mentioned Phyllostachys nigra coumarin synthesis gene or causing the plant to overexpress the above-mentioned Phyllostachys nigra coumarin synthesis gene.

[0018] Further, in the method, the plant comprises Phyllostachys nigra and Arabidopsis.

[0019] The seventh aspect of the present application provides a method for cultivating a transgenic plant with high coumarin content, which comprises the following steps: overexpressing the above-mentioned Phyllostachys nigra coumarin synthesis gene in a plant cell, then cultivating the plant cell, and regenerating a plant from the plant cell, thereby obtaining the transgenic plant with high coumarin content.

[0020] Further, in the method, the plant comprises Phyllostachys nigra and Arabidopsis.

[0021] The present application has the following beneficial effects:

[0022] 1. The PnMYB4 and PnMYB4-1 genes and the encoded proteins are obtained from Phyllostachys nigra for the first time, and the biological function of the genes in regulating coumarin synthesis is verified.

[0023] 2. The PnMYB4 and PnMYB4-1 genes of Phyllostachys nigra are overexpressed in Arabidopsis thaliana for the first time, and it is proved by PCR that the genes have been successfully integrated into the genome of Arabidopsis thaliana, that is, the positive strain.

[0024] 3. The content of the coumarin substances scopoletin and scopolin in the seedlings of the PnMYB4 and PnMYB4-1 overexpression strains is determined, and the results show that the content of scopolin in all overexpression strains is significantly higher than that of WT; the cDNA of the transgenic Arabidopsis thaliana leaf and the wild type Arabidopsis thaliana leaf tissue is used as a template for qRT-PCR analysis, and the results show that compared with the wild type, the expression levels of AtPAL1, At4CL1, AtC4H, AtCOMT1, AtHCT and AtF6'H genes in the overexpression plants are obviously up-regulated, and it is speculated from the above results that PnMYB4 and PnMYB4-1 promote the synthesis of coumarin by up-regulating the expression of genes in the phenylpropanoid pathway.

[0025] 4. The interaction proteins PnWRKY8 and PnWRKY72-2 of PnMYB4 and PnMYB4-1 of Phyllostachys nigra are identified for the first time. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 Expression levels of PnMYB4 and PnMYB4-1 in transgenic Arabidopsis thaliana.

[0027] Figure 2 Phenotypes of transgenic Arabidopsis thaliana, note: growth status and morphological indexes of the third week old Arabidopsis thaliana since transplanting. In the figure, A and B: growth status of PnMYB4 and PnMYB4-1 transgenic Arabidopsis thaliana. In the figure, C and D: morphological indexes of PnMYB4 and PnMYB4-1 transgenic Arabidopsis thaliana respectively. Ruler = 8 cm, *P<0.05, **P<0.01, ***P<0.001, and ns represents no significant difference compared with WT.

[0028] Figure 3 Coumarin substance content in transgenic Arabidopsis thaliana. In the figure, A: coumarin content in PnMYB4 transgenic Arabidopsis thaliana. B: coumarin content in PnMYB4-1 transgenic Arabidopsis thaliana. *P<0.05, **P<0.01, ***P<0.001, and ns represents no significant difference compared with WT.

[0029] Figure 4Expression of coumarin synthesis related genes in transgenic Arabidopsis. A: Expression of coumarin synthesis related genes in PnMYB4 transgenic Arabidopsis. B: Expression of coumarin synthesis related genes in PnMYB4-1 transgenic Arabidopsis. *P<0.05, **P<0.01, ***P<0.001.

[0030] Figure 5 Construction of gene interaction network.

[0031] Figure 6 Identification of protein interaction by yeast two-hybrid experiment. In the figure: EV: empty vector. QDO: SD / -Ade / -His / -Leu / -Trp yeast deficient medium.

[0032] Figure 7 Identification of protein interaction by BiFC experiment. In the figure: Bright: bright field. YFP: YFP fluorescence. Chl: chloroplast autofluorescence. Merged: merged image of Bright, YFP and Chl. EV: empty vector. Scale bar = 20 μm. DETAILED DESCRIPTION

[0033] The present application will be further described in conjunction with specific examples, which are an explanation rather than a limitation of the present application.

[0034] Example 1: Cloning of PnMYB4 and PnMYB4-1 genes of Phyllostachys nuda

[0035] 1. Preparation of materials

[0036] The leaves of annual Phyllostachys nuda from Zhejiang A&F University in Lin'an District, Hangzhou City, Zhejiang Province were collected and stored at -80℃ for subsequent experiments.

[0037] 2. RNA extraction

[0038] RNA extraction was performed according to the instructions of the RNA extraction kit of Hangzhou Xinjing Simgen Biotechnology Co., Ltd. The specific steps are as follows:

[0039] (1) Put the epidermis of Phyllostachys nuda culm into a sterilized mortar and grind it into powder. Weigh 300 mg of sample into a 1.5 mL RNA-free centrifuge tube, and add 600 μL of Buffer RCT containing β-mercaptoethanol. Vortex to dissolve thoroughly.

[0040] (2) Add 600 μL of Buffer EX to the 1.5 mL RNA-free centrifuge tube of step (1), shake thoroughly, and centrifuge at 12 000 rpm for 5 min.

[0041] (3) Take 400 μL supernatant from step (2) and transfer to a new 1.5 mL RNA-free centrifuge tube.

[0042] (4) Add 400 μL Buffer K to the supernatant from step (3) and mix well. Transfer the mixture to the filter column and cap the tube. Centrifuge at 13 500 rpm for 2 min.

[0043] (5) Discard the filter column from step (4) and add 700 μL 70% ethanol to the filtrate and mix well directly with the pipette tip.

[0044] (6) Take 700 μL of the mixture from step (5) and add to the nucleic acid purification column. Centrifuge at 13 000 rpm for 1 min.

[0045] (7) Discard the filtrate in the 2 mL centrifuge tube and place the nucleic acid purification column back into the 2 mL RNA-free centrifuge tube. Take the remaining mixture and add to the nucleic acid purification column. Centrifuge at 13 000 rpm for 1 min.

[0046] (8) Discard the filtrate in the 2 mL centrifuge tube and place the nucleic acid purification column back into the 2 mL RNA-free centrifuge tube. Add 500 μL Buffer WA (with the addition of anhydrous ethanol) to the nucleic acid purification column. Cap the tube and centrifuge at 13 000 rpm for 1 min.

[0047] (9) Discard the filtrate in the 2 mL centrifuge tube and place the nucleic acid purification column back into the 2 mL RNA-free centrifuge tube. Add 600 μL Buffer WBR (with the addition of anhydrous ethanol) to the nucleic acid purification column. Cap the tube and centrifuge at 13 000 rpm for 1 min.

[0048] (10) Discard the filtrate in the 2 mL centrifuge tube and place the nucleic acid purification column back into the 2 mL centrifuge tube. Centrifuge at 14 000 rpm for 1 min.

[0049] (11) Discard the 2 mL centrifuge tube and place the nucleic acid purification column in a clean 1.5 mL RNA-free centrifuge tube. Add 40 μL RNase-free Water to the center of the membrane of the purification column. Cap the tube and incubate at room temperature for 1 min. Centrifuge at 13 000 rpm for 1 min.

[0050] 3. RNA reverse transcription

[0051] Refer to the NovoScript v Plus All-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge) kit instructions. All reactions are performed on ice.

[0052] (1) Degenerate DNA. The following reagents were prepared on ice, mixed well and centrifuged, and then reacted at 42°C for 5 min.

[0053]

[0054] (2) RNA reverse transcription cDNA. The following reaction mixture was added to the PCR tube of step (1), mixed well, centrifuged, and then reacted at 50°C for 15 min, 75°C for 5 min, and cooled on ice.

[0055]

[0056] (3) After the reverse transcription of cDNA was completed, it was diluted 10 times and stored at -20°C for subsequent experiments.

[0057] 4. Gene cloning

[0058] (1) PnMYB4 and PnMYB4-1 specific PCR primers were designed using Oligo7.0 software, and the primers were synthesized by Hangzhou Yikang Biotechnology Co., Ltd., with the following sequences (SEQ ID NO. 5-8):

[0059] PnMYB4-cds-F: ATGGGGAGGGCTCCGTGCTGC;

[0060] PnMYB4-cds-R: CTAAATCTGCGGCAACTGTTG;

[0061] PnMYB4-1-cds-F: ATGGGGAGGGCTCCGTGCTG;

[0062] PnMYB4-1-cds-R: CTAAATCTGCGGCAAGTCTTGCACGT;

[0063] (2) PCR amplification

[0064] Using the cDNA of Phyllostachys nigra leaves as the template, the corresponding primers were used for PCR amplification, and the reaction program was as follows: 95°C for 5 min; 95°C for 5 s, 60°C for 30 s, 72°C for 60 s, 32 cycles; 72°C for 10 min. The amplification instrument was CFX96 Real-time PCR instrument, and the amplification system was as follows: TM

[0065]

[0066] ​(3) Prepare 1.0% agarose gel, perform agarose gel electrophoresis experiment, set the voltage to 125V, set the time to 20min, detect whether the fragment size of the target gene meets the expectation, and cut and recover the target fragment that meets the expectation for purification.

[0067] (4) Gel recovery and purification: use SanPrep column DNA gel recovery kit from Shanghai Shengong Biotechnology Co., Ltd. to purify the gel recovery product.

[0068] (5) Ligation reaction

[0069] Reference Takara pMD TM 18-T Vector Cloning Kit instruction manual, ligation time is 3-10h, and the ligation system is as follows:

[0070]

[0071] (6) Transformation of E. coli competent DH5a with ligation product

[0072] Reference Shanghai Weidi Biotechnology Co., Ltd. E. coli competent DH5a transformation instruction manual, the specific steps are as follows:

[0073] a. Freeze-thaw the purchased E. coli competent DH5a on ice for 5min, add 10μL ligation product, shake the tube bottom, mix evenly, and stand on ice for 30min.

[0074] b. After 42℃ for 45s, stand on ice for 2min.

[0075] c. Add 300μL of antibiotic-free LB medium, shake culture at 220rpm and 37℃ for 1h.

[0076] d. Take about 100μL of culture liquid and evenly spread on Luria-Bertani (LB) medium containing ampicillin, and culture at 37℃ for 12h.

[0077] e. Select single colony in 1mL liquid medium containing corresponding antibiotic centrifuge tube, shake culture at 37℃ and 220rpm for 6h until the bacterial solution is turbid, and perform bacterial solution PCR identification.

[0078] f. Send the positive bacterial solution identified correctly in step e to Shanghai Shengong Biotechnology Co., Ltd. for sequencing, select more than 3 single clones for each sequence to reduce the influence of mismatch in PCR process on gene sequence confirmation.

[0079] The nucleotide sequences of the cloned coumarin synthesis related genes PnMYB4 and PnMYB4-1 are shown as SEQ ID NO. 1 and SEQ ID NO. 2, and the amino acid sequences of the proteins encoded by the coumarin synthesis related genes PnMYB4 and PnMYB4-1 are shown as SEQ ID NO. 3 and SEQ ID NO. 4.

[0080] Example 2: Genetic transformation of Arabidopsis thaliana

[0081] (1) Vector construction

[0082] According to the CDS sequences of PnMYB4, PnMYB4-1 and the pCAMBIA1300-GFP (BamH I enzyme site) vector sequence, the SnapGene software was used to design the homologous arm primers as follows (SEQ ID NO. 21-24):

[0083] pCAMBIA1300-PnMYB4-F:

[0084] gagctcggtacccggggatccATGGGGAGGGCTCCGTGCTGC

[0085] pCAMBIA1300-PnMYB4-R:

[0086] caggtcgactctagaggatccCTAAATCTGCGGCAACTGTTG

[0087] pCAMBIA1300-PnMYB4-1-F:

[0088] gagctcggtacccggggatccATGGGGAGGGCTCCGTGCTG

[0089] pCAMBIA1300-PnMYB4-1-R:

[0090] caggtcgactctctagaggatccCTAAATCTGCGGCAAGTCTTGCACGT

[0091] PCR amplification was performed using the plasmids of PnMYB4 and PnMYB4-1 as templates, respectively, and the amplification system and amplification procedure were the same as above.

[0092] The enzyme digestion system is as follows:

[0093]

[0094] Enzyme digestion reaction: 30 min at 30°C

[0095] The gel was cut and the product was recovered. The target fragment was constructed into the digested vector according to the homologous recombination kit manual, and the E. coli competent DH5a was transformed. The positive clone with correct sequence was preserved.

[0096] (2) Agrobacterium transformation

[0097] The pCAMBIA1300-PnMYB4-GFP and pCAMBIA1300-PnMYB4-1-GFP recombinant plasmids were subjected to Agrobacterium transformation.

[0098] a. The Agrobacterium competent preserved at -80°C was partially thawed at room temperature or in the palm of the hand, and was inserted into ice when it was in the ice water mixed state.

[0099] b. 0.01-1 μg of plasmid DNA was added to 100 μL of competent cells (the transformation efficiency was higher, and the amount of plasmid added was preferably determined by pre-experiment before first use), and the bottom of the tube was mixed by hand. Then, it was sequentially placed on ice for 5 min, liquid nitrogen for 5 min, 37°C water bath for 5 min, and ice bath for 5 min.

[0100] c. 700 μL of LB or YEP liquid medium without antibiotics was added, and the mixture was cultured at 28°C for 2-3 hours.

[0101] d. The bacteria were centrifuged at 6000 rpm for 1 min, and about 100 μL of supernatant was taken to resuspend the bacterial pellet by gently blowing, and then it was plated on LB or YEP plates containing the corresponding antibiotics. After being cultured in a 28°C incubator for 2-3 days, single colonies were picked for PCR verification.

[0102] (3) Agrobacterium amplification

[0103] The colonies with correct detection results were inoculated into 50 mL of YEP liquid medium (containing 50 μg / mL Rif and 50 μg / mL Kan), and were cultured at 28°C until the OD value was 0.6-0.8.

[0104] (4) Bacteria collection

[0105] The bacteria were collected by centrifugation at 5000 rpm for 10 min, and the bacterial pellet was resuspended in an equal volume of 1 / 2MS solution (containing 0.02% Silwet L-77).

[0106] (5) Infection

[0107] Healthy Arabidopsis thaliana with more inflorescences were selected, and the siliques that had been set were removed. The inflorescences were immersed in the infection solution for about 30 s, and then were wrapped with plastic film. After being cultured in the dark for 24 h, the plants were normally cultured. The second infection was performed after one week to improve the transformation efficiency.

[0108] Example 3: Application of PnMYB4 and PnMYB4-1 gene heterologous transformation of Arabidopsis to improve the synthesis of coumarin

[0109] 1. Screening of positive transgenic Arabidopsis plants and determination of the expression level of PnMYB4 and PnMYB4-1 genes

[0110] (1) Screening of positive plants, RNA extraction and PCR identification of transgenic materials

[0111] a. Seed disinfection: Take an appropriate amount of T1 generation Arabidopsis seeds in an EP tube, add 1 mL of 75% ethanol and blow 4-6 times with a gun head, repeat 3 times, and then wash with anhydrous ethanol for 2 times.

[0112] b. Medium culture: After the seeds are absorbed on sterile filter paper, they are placed on 1 / 2MS solid medium (containing 50 μg / mL hygromycin) and transferred to an Arabidopsis chamber after 2 days of cold stratification at 4°C.

[0113] c. Transplanting of seedlings and screening of positive seedlings: After 2 weeks of medium culture, the normally growing T1 generation plants are transferred to nutrient soil, and when they grow to a certain size (after 3 weeks of transplanting), the rosette leaves are collected for RNA level detection (the RNA of positive plants is extracted according to the RNA extraction method in Example 1). The seeds of T1 generation plants (T2 generation seeds) are collected from each single plant, and the screening is also carried out by the above steps until the T3 generation seeds are harvested.

[0114] d. The RNA level of the screened transgenic seedlings is identified using PnMYB4 and PnMYB4-1 CDS primers, and the PCR reaction program is: 95°C for 5 s, 60°C for 30 s, 72°C for 60 s, 26 cycles.

[0115] (2) Detection of the expression level of PnMYB4 and PnMYB4-1 in transgenic Arabidopsis

[0116] Combined with the phenotype statistics of the overexpression lines of T3 generation homozygous Arabidopsis, the transgenic lines OE6, OE7, OE9, OE12, OE13 of PnMYB4 and OE2, OE5, OE9, OE10, OE13 of PnMYB4-1 were selected for qRT-PCR detection of overexpression, and each line was arranged from low to high according to the expression level, among which OE12 in the PnMYB4 line had the highest expression level, which was 11.2±0.88 times of WT, and OE9 in the PnMYB4-1 line had the highest expression level, which was 57.4±9.3 times of WT. Figure 1

[0117] 2. Data analysis and function verification of transgenic plants

[0118] ​(1) Growth status and morphological analysis of transgenic Arabidopsis thaliana PnMYB4 and PnMYB4-1

[0119] The length, width, and number of rosette leaves of T3 generation transgenic Arabidopsis thaliana were statistically analyzed 3 weeks after transplanting. At least three biological replicates were established for each Arabidopsis line. Rosette leaves were selected by arranging the basal leaves of Arabidopsis thaliana from largest to smallest up to the 15th leaf, and these 15 leaves were statistically analyzed. Figure 2 As shown, using 3-week-old wild-type and transgenic Arabidopsis plants as materials, the number of rosette leaves, leaf length and width, and plant crown width were measured. Regarding plant height, all three PnMYB4 overexpression lines were shorter than the WT line, and the OE2 and OE10 lines of the PnMYB4-1 overexpression line also showed inhibited growth in plant height. The top view shows that the growth of the PnMYB4 overexpression line OE12 was severely inhibited, with fewer rosette leaves. The PnMYB4-1 overexpression lines OE2 and OE13 both had fewer rosette leaves than the WT line. Figure 2 A, B). Among the PnMYB4 overexpression lines, the leaf length, leaf width, and crown width of OE12 and OE13 were all smaller than those of WT, while the crown width of OE7 was not significantly different from that of WT. OE12 had fewer rosette leaves than WT, OE13 and WT had no significant difference in the number of rosette leaves, while OE7 had more rosette leaves than WT. Figure 2 C). Among the PnMYB4-1 overexpression lines, the leaf length, leaf width, and crown width of OE2, OE10, and OE13 were all smaller than those of WT. Among them, OE2 had fewer rosette leaves than WT, OE10 had more rosette leaves than WT, and there was no significant difference in the number of rosette leaves between OE13 and WT. Figure 2 D). Based on the gene expression results of the positive plants above, it was found that the rosette leaf number, leaf length, leaf width and crown width of the PnMYB4 and PnMYB4-1 overexpression lines with higher expression levels were inhibited, indicating that the overexpression of PnMYB4 and PnMYB4-1 may inhibit the growth and development of Arabidopsis thaliana.

[0120] (2) Analysis of coumarin content and related synthetic gene expression in transgenic Arabidopsis thaliana PnMYB4 and PnMYB4-1

[0121] ① Analysis of coumarin content in transgenic Arabidopsis thaliana PnMYB4 and PnMYB4-1

[0122] The content of coumarin compounds was determined by liquid chromatography, with slight modifications to the method used by Stringlis et al., as follows:

[0123] Sample preparation: The seedlings at 14d after culture in medium were frozen and dried to constant weight in 10mL centrifuge tube, 4 steel balls with diameter of 4mm were added, and the sample was frozen in liquid nitrogen, then mixed by forceful vortex, the freezing and vortexing process was repeated several times until all the tissue was pulverized. 20mg of Arabidopsis powder was accurately weighed in a 1.5mL centrifuge tube, 1mL of methanol was added, vortexed for 2min, ultrasonic extraction for 20min, centrifuged at 12000g for 10min at 4℃, the supernatant was taken and filtered through a 0.22μm microporous filter, then transferred to a sample bottle for detection.

[0124] Standard preparation: 10mg of scopolamine and scopolin standard was accurately weighed, respectively, and dissolved in methanol to 20mL (500μg / mL). According to the experimental requirements, the standard solution was gradually diluted to different concentrations, and stored at 4℃ for later use.

[0125] Detection conditions: Agilent 1260infinity prime type ultra-high performance liquid chromatography system (Agilent, Germany) was used, equipped with Sepax Bio-C18 reversed-phase chromatographic column (250mm×4.6mm, 5μm). The mobile phase was 0.1% formic acid (A) and 0.1% formic acid acetonitrile (B), and the elution program was as shown in the table below. The column oven was constant temperature at 30℃, the detection wavelength was excitation wavelength 365nm and emission wavelength 462nm; the sample injector was set to 2μL.

[0126]

[0127] From Figure 3 It can be seen that the content of scopolin and scopolamine in PnMYB4 and PnMYB4-1 overexpression Arabidopsis seedlings was determined by HPLC, and the results showed that: compared with WT, the content of scopolin in all PnMYB4 overexpression lines was significantly higher than that in WT, and the content of scopolin in OE10 and OE13 of PnMYB4-1 overexpression lines was significantly higher than that in WT, while the content of scopolin in OE2 was not significantly different from that in WT. Figure 3 A, B). It is speculated that PnMYB4 and PnMYB4-1 have the biological function of improving the synthesis of coumarin substances: scopolin and scopolamine.

[0128] ②Determination of the expression amount of key genes for coumarin synthesis in transgenic PnMYB4 and PnMYB4-1 Arabidopsis

[0129] To further elucidate the regulatory mechanism of PnMYB4 and PnMYB4-1 in the coumarin synthesis process, the expression levels of coumarin synthesis key genes in PnMYB4 and PnMYB4-1 overexpressed Arabidopsis plants were determined. Total RNA was extracted from the leaves of transgenic Arabidopsis and reverse transcribed into cDNA as a template. The primers used in the qRT-PCR experiment were designed using NCBI Primer-BLAST (as shown in SEQ ID NO. 9-20). AtTIP41 was used as an internal reference gene. The reaction system is as follows. The qRT-PCR reaction program is as follows: 95°C for 30s; 95°C for 5s, 60°C for 30s, 40 cycles, 65°C for 5s, 95°C for 5s, and melting curve determination from 60°C to 95°C.

[0130]

[0131] The qRT-PCR results show that Figure 4 Compared with the wild type, the expression levels of AtPAL1, At4CL1 and AtC4H genes in the overexpression plants were significantly up-regulated, among which the expression level of AtPAL1 in PnMYB4 and PnMYB4-1 transgenic Arabidopsis reached 9.2±1.1 times and 237.7±21.8 times of the wild type, respectively. It is speculated that PnMYB4 and PnMYB4-1 promote the synthesis of coumarin by up-regulating the expression of genes in the phenylpropanoid pathway.

[0132] Example 4: Application of the molecular mechanism of PnMYB4 and PnMYB4-1 regulating coumarin synthesis

[0133] 1. Construction of gene co-expression network

[0134] The correlation of PnMYB4, PnMYB4-1 and the above 24 coumarin synthesis related genes was analyzed by Lianchuan cloud platform (https: / / www.omicstudio.cn / tool / 62), and the network relationship was visualized by cytoscape Figure 5 The correlation results show that PnMYB4 and PnMYB4-1 are highly positively correlated with 18 genes (rho>0.9, p<0.01). Including 12 structural genes PALs, 4CLs, etc., and another 6 transcription factors PnWRKY8, PnWRKY72-2, PnMNT5, etc. It is suggested that they can form an interaction network.

[0135] 2. Y2H experiment

[0136] In order to verify the protein interaction relationship of PnMYB4, PnMYB4-1 and PnWRKY8, PnWRKY72-2, yeast two-hybrid experiment was carried out.

[0137] The positive control (pGBKT7-53 and pGADT7-T), negative control (pGBKT7-Lam and pGADT7), pGBKT7-PnWRKY8 / PnWRKY72-2 and pGADT7-PnMYB4 / PnMYB4-1 / empty vector combination were respectively transformed into yeast cells (vector construction primer sequences are shown in SEQ ID NO. 29-36), and the transformation step was referred to the AH109 Competent Cell competent cell instruction. The colonies grown on SD / -Trp / -Leu medium were picked up in 50 μL ddH2O and diluted 10 times and 100 times respectively on SD / -Ade / -His / -Leu / -Trp, SD / -Ade / -His / -Leu / -Trp / x-α-gal) medium for further culture for 2-4 days.

[0138] The Y2H experiment results showed that the negative control, pGBKT7-PnWRKY8+pGADT7, pGBKT7-PnWRKY72-2+pGADT7 combination could not grow on the four-lacking plate, the positive control, pGBKT7-PnWRKY8+pGADT7-PnMYB4 / PnMYB4-1, pGBKT7-PnWRKY72-2+pGADT7-PnMYB4 / PnMYB4-1 combination could grow on the four-lacking plate, and the yeast colonies turned blue in the presence of X-α-gal. Figure 6 The results showed that PnWRKY8, PnWRKY72-2 did not have transcriptional activation activity, and PnMYB4, PnMYB4-1 could interact with PnWRKY8, PnWRKY72-2 in yeast cells.

[0139] 3. BiFC experiment

[0140] The BiFC was used to verify the protein interaction relationship between PnMYB4, PnMYB4-1 and PnWRKY8, PnWRKY72-2 again.

[0141] (1) Plasmid extraction

[0142] The constructed pSAT1-nEYFP-PnMYB4 / PnMYB4-1 and pSAT4-cEYFP-PnWRKY8 / PnWRKY72-2 vectors (vector construction primer sequences are shown in SEQ ID NO. 37-44) were subjected to plasmid extraction (endotoxin removal), and the concentration was preferably above 2000 ng / μL. The plasmid extraction step was performed according to the QIAGEN Plasmid Midi Kit instruction.

[0143] (2) Arabidopsis protoplast extraction

[0144] Protoplasts were extracted from Arabidopsis seedlings grown on 1 / 2MS medium for about 10 days, and the following steps were taken:

[0145] a. Prepare the enzyme solution in the table below, and filter through a 0.45 μm filter, and place in a 9 cm dish for use.

[0146]

[0147] b. Cut the Arabidopsis seedling leaves into 0.5-1.0 mm wide strips, and disperse them with a syringe tip, and then quickly pour the dispersed callus into the prepared enzyme solution.

[0148] c. Gently shake the dish or use a syringe tip to separate the strips that have clumped together in the enzyme solution, and completely immerse the strips in the enzyme solution, and incubate at 23°C in the dark for about 4 hours.

[0149] d. Filter the Arabidopsis leaves that have not been completely dissociated through a 70 μm cell strainer, and then rinse several times with an appropriate amount of W5 solution (see table below), and mix the filtered rinse with the enzyme solution.

[0150]

[0151] d. Place the mixture in a 10 mL round-bottom centrifuge tube, and centrifuge at 100 g for 2 minutes at 23°C.

[0152] e. Discard the supernatant, and leave the protoplasts in good condition, and resuspend the protoplasts in W5 solution, and centrifuge at 100 g at 23°C, and repeat this step twice.

[0153] f. Resuspend the protoplasts in 500 μL of MMg (see table below), and take a drop of the resuspension for microscopic examination, and observe under a microscope whether the protoplasts have been successfully extracted.

[0154]

[0155] (3) Plasmid transformation

[0156] a. Take 100 μL of the protoplast suspension in a 2 mL round-bottom centrifuge tube, and continue to gently flick the protoplasts during the pipetting to prevent them from settling. Divide the protoplasts into 2 mL round-bottom centrifuge tubes, 100 μL per tube, and add the plasmid (about 10 μg), and mix gently, and add an equal volume of freshly prepared PEG solution (see table below), and mix gently, and place in the dark for 20 minutes.

[0157]

[0158] Table)

[0159] b. Add 440 μL W5 solution to each reaction, mix gently, and terminate the transfection reaction.

[0160] c. 100 g at 23°C for 1 min, remove the supernatant, and add 50 μL W5 solution to resuspend the protoplasts.

[0161] d. 18 h of culture in the dark at 22°C, and observe the fluorescence signal and take pictures using a laser confocal microscope.

[0162] The BiFC experiment results show that the PnMYB4 / PnMYB4-1-YN+YC negative combination does not detect fluorescence signal in Arabidopsis protoplasts, and when PnWRKY8 / PnWRKY72-2-YC and PnMYB4 / PnMYB4-1-YN are transiently expressed, a strong fluorescence signal is observed in the nucleus Figure 7 ), indicating that PnMYB4 and PnMYB4-1 can interact with PnWRKY8 and PnWRKY72-2 in protoplasts, and the interaction relationship occurs in the nucleus.

[0163] The cloning primer sequences of PnWRKY72-2 and PnWRKY8 in this example are shown in SEQ ID NO. 25-28.

Claims

1. A Phyllostachys pubescens coumarin synthesis gene, characterized in that, The PnMYB4 gene and the PnMYB4-1 gene, wherein the nucleotide sequence of the PnMYB4 gene is shown as SEQ ID NO. 1, and the nucleotide sequence of the PnMYB4-1 gene is shown as SEQ ID NO.

2.

2. The protein encoded by the gene for the synthesis of pachmakoumarin in Pueraria montana var. lobata according to claim 1, wherein, The amino acid sequence of the encoded protein of the PnMYB4 gene is shown as SEQ ID NO. 3, and the amino acid sequence of the encoded protein of the PnMYB4-1 gene is shown as SEQ ID NO.

4.

3. A recombinant vector containing the Phyllostachys nigra coumarin synthesis gene according to claim 1.

4. An engineered bacterium containing the recombinant vector according to claim 3.

5. Use of the Phyllostachys nigra coumarin synthesis gene according to claim 1, the encoded protein according to claim 2, the recombinant vector according to claim 3, or the engineered bacterium according to claim 4 in any one of the following: (1) regulating coumarin synthesis in plants; (2) cultivating transgenic plants with high coumarin content.

6. The use according to claim 5, wherein the compound is ###0002### The plants include Phyllostachys nigra and Arabidopsis thaliana.

7. A method of increasing the coumarin content of a plant, characterized in that, The plants are made to contain the Phyllostachys nigra coumarin synthesis gene according to claim 1 or to overexpress the Phyllostachys nigra coumarin synthesis gene according to claim 1.

8. The method of claim 7, wherein, The plants include Phyllostachys nigra and Arabidopsis thaliana.

9. A method of breeding a transgenic plant with high coumarin content, comprising, The method comprises the following steps: overexpressing the Phyllostachys nigra coumarin synthesis gene according to claim 1 in plant cells, then cultivating the plant cells, and regenerating plants from the plant cells to obtain the transgenic plants with high coumarin content.

10. The method of claim 9, wherein, The plants include Phyllostachys nigra and Arabidopsis thaliana.

Images