Medicago sativa MsBAM41 gene as well as encoding protein and application thereof
By cloning and validating the MsBAM41 gene and its encoded protein in alfalfa, and using RNAi vectors to regulate starch metabolism and carbohydrate synthesis, the resistance of alfalfa to combined salt-alkali and low-temperature stress was enhanced. This solved the problem of unclear response mechanism to combined stress in existing technologies and achieved a significant improvement in stress resistance.
Patent Information
- Application Number
- CN202510985442.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2025-11-07
AI Technical Summary
The response mechanism of alfalfa under combined stress of salinity, alkalinity and low temperature is not clear in existing technologies, making it difficult to effectively improve its resistance in complex field environments.
The MsBAM41 gene, which is resistant to combined salt and low temperature stress in alfalfa, and its encoded protein were cloned and verified. The gene was expressed in alfalfa by Agrobacterium-mediated genetic transformation. An RNAi vector was constructed to regulate starch metabolism and carbohydrate synthesis, thereby enhancing the plant's stress resistance.
The expression of the MsBAM41 gene significantly affects the amylase activity and soluble sugar content of alfalfa, improving the plant's ability to resist growth inhibition and physiological damage under combined stress of salinity, alkalinity and low temperature, and maintaining cell membrane integrity.
Smart Images

Figure CN120905268A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to a Medicago sativa L. salt-alkali and low-temperature compound stress resistance gene MsBAM41 and an encoded protein and application thereof. BACKGROUND
[0002] Medicago sativa L. is a perennial herb of the Leguminosae genus Medicago, and is an excellent forage resource for animal husbandry and is known as the "king of forage". Medicago sativa L. planted in saline-alkali habitats in cold regions faces double challenges: it needs to adapt to the saline-alkali environment and survive in the severe winter season. These two problems are intertwined and jointly restrict the yield of Medicago sativa L.. However, current researches are mostly focused on the influence mechanism of single stress factors under laboratory conditions, and the response of plants to the compound effect of multiple stresses under complex field environment is less studied, and in-depth exploration is urgently needed. Therefore, it is of great significance to mine the key genes of Medicago sativa L. resistant to salt-alkali and low-temperature compound stress for cultivating Medicago sativa L. varieties resistant to salt-alkali and low-temperature compound stress by biotechnology and improving the comprehensive utilization rate of saline-alkali land.
[0003] Plants respond to salt-alkali stress mainly through mechanisms such as osmoregulation, active oxygen scavenging, and ion regulation. Osmoregulation is a key way for plants to reduce their osmotic potential and enhance stress resistance. Plants precisely control the concentration of intracellular osmotic substances by regulating the activity of transporters (such as amino acid and glucose transporters). These substances (including soluble sugars, amino acids, sugar alcohols, organic acids, etc.) accumulate under stress, can combine with water molecules to form a hydration layer, reduce the free energy of water molecules, avoid water loss, and maintain the stability of the cell internal environment. In terms of active oxygen scavenging, salt-alkali stress induces plants to increase the expression of antioxidant enzyme genes to reduce oxidative damage. Ion regulation involves selective ion absorption by roots and reduces Na + Low temperature stress includes chilling (0-15℃) and freezing (<0℃). Most plants acquire freezing resistance through cold acclimation. The main damage of freezing is due to cell dehydration and membrane damage. The formation of ice crystals between cells and outside cells leads to mechanical damage of cell membranes and reduces water supply, eventually causing dehydration. Under salt-alkali and low-temperature stress, multiple metabolic pathways work together to trigger cell signaling and synthesize defensive compounds (osmotic adjustment substances and antioxidants). These substances can stabilize proteins and cell structures. Soluble sugars can maintain water balance, increase cytoplasmic concentration, and lower freezing point, thereby preventing membrane mechanical damage caused by ice formation and enhancing cold resistance. Although the response to single stress has been well studied, the mechanism of how plants respond to salt-alkali and low-temperature compound stress is still unclear.
[0004] Beta-amylase (BAM) is the most important starch-hydrolyzing enzyme in plants. When beta-amylase degrades starch, it produces maltose, which can reduce the osmotic potential of cells and indirectly enhance membrane stability by being metabolized into other protective sugars. In addition, maltose can be transported from chloroplasts to the cytoplasm under the action of maltose transferase, and further participate in the synthesis of soluble sugars such as glucose in the cytoplasm to support plant growth and metabolism. Beta-amylase is a typical exohydrolase that hydrolyzes alternating alpha-1,4 bonds from the non-reducing end of the glucan chain to produce maltose. The increase of intracellular soluble sugar content can reduce the osmotic potential of cells and help plants resist low temperature and saline-alkali stress. SUMMARY
[0005] The present application aims to provide a Medicago sativa salt-alkali and low temperature compound stress resistance gene MsBAM41 and its encoded protein and application.
[0006] The present application is achieved by the following technical solutions: The present application discloses a Medicago sativa salt-alkali and low temperature compound stress resistance gene MsBAM41 The nucleotide sequence of the Medicago sativa gene MsBAM41 is shown as SEQ. ID. NO. 1, and the sequence length is 1722 bp.
[0007] The present application discloses a protein encoded by the above-mentioned Medicago sativa salt-alkali and low temperature compound stress resistance gene MsBAM41 The amino acid sequence of the protein is shown as SEQ. ID. NO. 2, and the sequence length is 574 amino acid residues.
[0008] The present application provides a plant interference vector pANDA35HK- MsBAM41 (RNAi), which comprises the MsBAM41 gene according to claim 1.
[0009] The present application discloses the above-mentioned Medicago sativa compound stress resistance gene MsBAM41 in the verification and application of the salt-alkali and low temperature compound stress resistance of Medicago sativa.
[0010] Compared with the prior art, the present application has the following beneficial technical effects: The present application first discloses a Medicago sativa salt-alkali and low temperature compound stress resistance gene MsBAM41 and obtains the amino acid sequence of the protein encoded by the gene, and uses molecular biology and genetic engineering technology to confirm that the Medicago sativa compound stress resistance gene MsBAM41 will affect the tolerance of Medicago sativa to compound stress. In this study, the MsBAM41The RNAi vector of the gene was introduced into Medicago sativa, and the transgenic plants were obtained MsBAM41 The transgenic Medicago sativa with significantly down-regulated expression level MsBAM41 RNAi. Under the combined stress of saline-alkali and low temperature, compared with the wild type, MsBAM41 RNAi Medicago sativa showed more serious growth inhibition and physiological damage, which was manifested as the aggravation of leaf wilting, the decrease of β-amylase activity and the significant decrease of soluble sugar content. At the same time, the cell membrane integrity of the transgenic plants was obviously damaged, which was manifested as the increase of electrolyte permeability and malondialdehyde concentration. These results showed that MsBAM41 The gene regulates the metabolism of starch and the synthesis of sugar substances, and plays an important role in the resistance of Medicago sativa to the combined stress of saline-alkali and low temperature. BRIEF DESCRIPTION OF DRAWINGS
[0011] Figure 1 To MsBAM41 the protein domain of the gene; Figure 2 To the plant expression vector pANDA35HK- MsBAM41 (RNAi) construction schematic diagram; Figure 3 To MsBAM41 PCR detection diagram of RNAi Medicago sativa; Figure 4 To qRT-PCR analysis MsBAM41 The relative expression amount results of RNAi Medicago sativa; Note: different lowercase letters represent significant differences (P<0.05). P <0.05) error bar is the standard error of each group (n=3).
[0012] Figure 5 To MsBAM41 The phenotype of RNAi Medicago sativa and wild type Medicago sativa WT after 7 days of combined stress treatment of saline-alkali and low temperature; Note: the ruler is 10 cm.
[0013] Figure 6 To MsBAM41 The β-amylase activity of RNAi Medicago sativa and wild type Medicago sativa WT after 7 days of combined stress treatment of saline-alkali and low temperature; Note: different lowercase letters represent significant differences (P<0.05). P <0.05) error bar is the standard error of each group (n=3).
[0014] Figure 7 To MsBAM41 The soluble sugar content of RNAi Medicago sativa and wild type Medicago sativa WT after 7 days of combined stress treatment of saline-alkali and low temperature; Note: different lowercase letters represent significant differences (P<0.05).P Error bars are standard error of each group (n=3).
[0015] Figure 8 For MsBAM41 MDA content changes of RNAi alfalfa and wild type alfalfa WT after 7 days of combined stress of saline-alkali and low temperature; Note: different lowercase letters represent significant difference (P<0.05). P Error bars are standard error of each group (n=3).
[0016] Figure 9 For MsBAM41 Electrolyte permeability changes of RNAi alfalfa and wild type alfalfa WT after 7 days of combined stress of saline-alkali and low temperature.
[0017] Note: different lowercase letters represent significant difference (P<0.05). P Error bars are standard error of each group (n=3). DETAILED DESCRIPTION
[0018] The application discloses a new saline-alkali and low temperature resistant composite stress gene MsBAM41 The gene is obtained from alfalfa, and specific related experiments are as follows: 1、Alfalfa MsBAM41 Gene cloning The nucleotide sequence of a close relative of alfalfa, Medicago truncatula, is searched from a NCBI database (http: / / www.ncbi.nlm.nih.gov / ) and saved, and a stress-induced expressed gene in alfalfa under combined stress of saline-alkali and low temperature is obtained through transcriptome sequencing of alfalfa under the combined stress. MsBAM41 The nucleotide sequence of the gene is determined through BLAST comparison and phylogenetic tree analysis. MsBAM41 See MsBAM41 Domain analysis shows that MsBAM41 the gene contains a Glyco_hydro_14 domain and belongs to the BAM gene family. The sequence is used to design a cloning primer, and the primer is as follows: MsBAM41 -F: AACAAAGTAAAACAACACAAACAAT MsBAM41 -R: TGTGACAGTTTCCTAATCCCTAT The specific process is as follows: RNA extraction: good alfalfa seeds are selected for planting, and the leaves of the cultivated alfalfa are taken after the alfalfa grows to 4 weeks old, and then the leaves are placed in liquid nitrogen for a moment and stored in-80℃ for standby. The total RNA of the alfalfa is extracted by using an RNA extraction kit (TIANGEN).
[0019] Obtaining cDNA: cDNA was obtained using a high-efficiency reverse transcription kit (TOYOBO) with the extracted RNA as a template, and the cDNA was used as a template for PCR amplification MsBAM41 Full-length sequence PCR reaction: PCR reaction was performed using Ex Taq DNA polymerase (TaKaRa).
[0020] PCR reaction system:
[0021]
[0022] After the PCR was completed, 1% agarose gel electrophoresis was performed for detection. The gel strip containing the target band in the above electrophoresis result was cut with a knife and placed in a 1.5 mL Eppendorf tube. Purification and recovery were performed using a QIAquick Gel Extraction Kit (QIAGEN).
[0023] Connection with pEASY-Blunt Zero Cloning Kit as a cloning vector MsBAM41 Gene, the reaction condition is 25°C, 1 h, and the connection system is as follows:
[0024] 2, pGWC- MsBAM41 Construction of an intermediate vector in a (RNAi) plant: Extraction of pBlunt ZERO- MsBAM41 The plasmid of the recombinant cloning vector and the pGWC vector was single-enzyme cut by Ahd I, and the target fragment and the enzyme-cut vector after recovery were connected. The relevant primer sequences are as follows: MsBAM41 (RNAi) - PGWC-F: AAAGCAGGCTTTGACTTTTTCCGTCACTATTCCTTTG Figure 2 (RNAi) - PGWC-R: GCTGGGTCTAGAGACTTGGTGTTTGAAATTGTCCCT The connection system is as follows:
[0025] 3, pANDA35HK- MsBAM41 Construction of a (RNAi) vector After transforming the E. coli strain competent cells, the pGWC- MsBAM41The pGWC-35HK-RNAi was identified by PCR and the positive clones were sequenced. The pGWC-35HK-RNAi was transformed into Agrobacterium GV3101 by freeze-thaw method. MsBAM41 The interference fragment of pGWC-35HK-RNAi was connected with pANDA35HK vector and the pANDA35HK-RNAi was constructed by Gateway LR Clonase II Enzyme Mix. Figure 3 The pANDA35HK-RNAi was constructed by Gateway LR Clonase II Enzyme Mix. MsBAM41 The schematic diagram of the pANDA35HK-RNAi expression vector was shown in Figure 1. MsBAM41 The vector was transformed into Agrobacterium GV3101 by freeze-thaw method.
[0026] 4. The genetic transformation procedure of Medicago sativa L. (1) The culture of Medicago sativa L. The sterilized seeds of Medicago sativa L. were sowed in vermiculite and placed in a culture room (24±1℃, 70-80% humidity, 16h light / 8h dark). The plants were watered regularly. After 4 weeks, the plants were cultured with 1x Hoagland nutrient solution until the plants were healthy. The 4-5 weeks old leaves were used as the transformation material.
[0027] (2) Agrobacterium treatment The Agrobacterium carrying pANDA35HK-RNAi was streaked on YEB solid medium containing kanamycin and rifampicin and cultured for 36-48h. The single colony was inoculated into YEB liquid medium and cultured until the OD 600 =0.6-0.8. The culture was transferred into SH3a liquid medium and used for infection when the OD 600 =0.2-0.4. MsBAM41 (3) Leaf infection
[0028] The leaves were treated with 15% sodium hypochlorite for 7 minutes and washed with sterile water. The leaves were immersed in SH3a medium, ultrasonicated for a short time to generate micro-wounds, and then inoculated with the Agrobacterium liquid. The infection was promoted by vacuum for 10 minutes. The leaves were shaken at 28℃ for 15 minutes. After the liquid was absorbed, the leaves were placed in SH3a co-culture medium and cultured in the dark for 24-48h. (4) Selection culture
[0029] The leaves were transferred into selection medium containing cefotaxime and hygromycin and cultured in the dark for 7-8 weeks. The medium was replaced every 2 weeks. After the callus was formed, the plants were transferred into MSBK medium (containing resistance) and induced to differentiate green shoots under light for 2-3 weeks. (5) Rooting and transplanting
[0030] The green shoots were transferred to SH9a medium (containing cephalosporin) and cultured for one month. After rooting, they were transferred to 1 / 2 SH9a rooting medium. Once the seedlings were robust, the medium was washed off, and they were transplanted into a 1:1 mixture of potting soil and vermiculite. The seedlings were covered with plastic wrap (with holes for ventilation) and placed in a 25°C incubator to acclimate to the natural environment.
[0031] 5. MsBAM41 -Molecular biological detection of RNAi in alfalfa by MsBAM41 -RNAi alfalfa DNA was used as a template for PCR identification. The primer was Guslinker484, and the specific sequence is as follows: Guslinker484-F:CGTCGTCGGTGAACAGGTAT Guslinker484-R: CACGCAAGTCCGCATCTTCA The PCR reaction procedure is as follows:
[0032] See MsBAM41 RNAi1 and RNAi2 are transgenic RNAi1 and RNAi2. MsBAM41 PCR identification results of two lines of genetically modified alfalfa: lane "0" represents water (blank control); lane "-" represents wild type (negative control); lane "+" represents pANDA35HK- Figure 4 (RNAi) vector, used as a positive control; lane M contains DL2000 DNA Marker. Successful transformation. MsBAM41 The plant with the gene was able to amplify a 372 bp band.
[0033] MsBAM41 qRT-PCR identification of RNAi in alfalfa RNA was extracted using an RNA extraction kit and identified as positive by PCR. MsBAM41 RNA from alfalfa was extracted using RNAi and reverse transcribed using a reverse transcription kit, then detected by quantitative real-time PCR. Figure 5 -RNAi alfalfa seedlings MsBAM41 The level of expression. See also Figure 6 Compared to WT, Figure 7 -RNAi alfalfa Figure 8 The expression level was significantly reduced.
[0034] 6. Figure 9 Functional validation of RNAi alfalfa response to combined salt and low temperature stress The combined stress conditions of saline-alkali and low temperature are: combined irrigation with saline-alkali solution at -1℃ (NaHCO3, Na2CO3, NaCl, Na2SO4 are arranged according to Na...). + The molar ratio of Na is 2:1:2:1. + The concentration was 200 mM, and 100 mL was applied every two days for 7 days of stress treatment. See [link / reference]. Figure 5 To further verify MsBAM41 The ability of RNAi alfalfa to resist multiple stresses was assessed by measuring β-amylase activity, soluble sugar content, MDA, and electrolyte permeability.
[0035] β-Amylase Activity Assay: Weigh 1.0 g of alfalfa root sample, homogenize under ice bath conditions, prepare amylase stock solution and corresponding dilution, and measure the optical density at 540 nm. Plot a maltose standard curve with maltose content on the x-axis and optical density on the y-axis. β-Amylase activity was determined using the 3,5-dinitrosalicylic acid extraction method. (See [link to relevant documentation]). MsBAM41 .
[0036] Method for determining soluble sugar content: Grind 0.1 g of plant roots and mix with 5 mL of acetone. Centrifuge at 10,000 rpm for 20 min, discard the supernatant, and recover the precipitate by centrifugation with 80% ethanol. Mix the supernatant with 72% H2SO4 (1:5, v / v) containing anthrone. Boil the mixture in a 100°C water bath for 15 min, then keep it on ice for 2 min. Measure the soluble sugar content at 620 nm spectrophotometrically using glucose as a standard. See [link to relevant documentation]. Figure 6 .
[0037] Method for determining MDA content: Grind 0.1 g of plant roots and add them to 2 mL of a solution containing 0.1% trichloroacetic acid. Centrifuge at 12,000 rpm for 20 min. Incubate at 90°C for 45 min, then immerse the test tube in an ice bath to stop the reaction. Measure the absorbance of the mixture at 532 nm, and subtract the absorbance at 600 nm to adjust for nonspecific turbidity. See [link to relevant documentation] MsBAM41 .
[0038] Electrolyte permeability determination method: Thoroughly rinse the root system with deionized water, cut the root system into 0.5 cm segments, place them in a clean beaker, add 30 mL of deionized water, vacuum for 15 minutes, measure the conductivity and label it E1. Then heat the root system in boiling water for 15 minutes and cool it at room temperature, measure the conductivity again, and label this value as E2. The formula for calculating electrolyte permeability (EL) is: EL = (E1 / E2) × 100%, see [link to relevant documentation]. MsBAM41 .
[0039] SeeFigure 7 Under normal growth conditions, no phenotypic difference was observed between WT and MsBAM41 -RNA alfalfa. After the combined stress treatment, the WT leaf part withered, and the top was bent, however MsBAM41 -RNA alfalfa leaf withering was more prominent, and the leaf edge was dry and the texture was brittle. See Figure 7 Before stress, Figure 8 The beta-amylase activity of the RNA alfalfa was significantly lower than that of the WT, and after the combined stress treatment, the beta-amylase activity increased, however MsBAM41 The RNA alfalfa beta-amylase activity increased significantly lower than that of the WT. See MsBAM41 Consistent with the change in beta-amylase activity, after the combined stress, MsBAM41 The soluble sugar content of the RNA alfalfa was significantly lower than that of the WT. As an important indicator of stress damage, MsBAM41 The MDA and EL of the RNA alfalfa under the combined stress were significantly higher than those of the WT, but there was no significant difference before stress, see MsBAM41 and .
[0040] In summary, the present application discloses a gene of alfalfa and a cloning method and application thereof, the full-length of the gene is 1722 bp, and the gene encodes 574 amino acids. By using the sequence information, the gene is cloned, and RNA alfalfa is created, the change in the ability of the alfalfa to resist the combined stress of salt and low temperature is analyzed through molecular biology detection and function verification, and it is further illustrated that the gene can participate in the stress resistance process of the plant. The gene in the present application provides a new gene resource for plant stress resistance molecular breeding, and lays a foundation for researching the plant stress resistance molecular mechanism.
[0041] Nucleotide and amino acid list SEQ.ID.NO.1 >
[0042] SEQ.ID.NO.2
Claims
1. A Medicago sativa gene for salt-alkaline and low temperature combined stress resistance MsBAM41 characterized in that, The nucleotide sequence of this gene MsBAM41 is shown in SEQ. ID. NO.
1.
2. A Medicago sativa salt-alkaline and low temperature composite stress resistance gene as claimed in claim 1 MsBAM41 characterized in that, The gene MsBAM41 The full length is 1722 bp, encoding 574 amino acids.
3. Medicago truncatula salt-alkaline and low temperature composite stress resistance gene according to claim 1 MsBAM41 The encoded protein is characterized in that, The amino acid sequence of this protein is shown in SEQ.ID.NO.
2.
4. An expression vector comprising the salt-alkaline and low temperature compound stress resistance gene of Medicago sativa according to claim 1. MsBAM41 characterized in that, The expression vector is the plant expression vector pANDA35HK MsBAM41 (RNAi).
5. The alfalfa gene of claim 1 MsBAM41 Use in increasing the resistance of alfalfa to combined salt and low temperature stress.
6. Use according to claim 5, wherein Constructing a plant expression vector containing the alfalfa salt-alkaline and low temperature compound stress resistance gene of claim 1 MsBAM41 , transforming the constructed plant expression vector into alfalfa by Agrobacterium-mediated method, screening positive plants to verify the function of the gene.