Application of brassica napus phosphatidylinositol monophosphate 5-kinase gene BnPIP5K9 in regulation and control of oil content of brassica napus
By cloning the rapeseed phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 and utilizing overexpression and gene editing technologies, the problem of increasing the oil content of rapeseed seeds was solved, and a significant increase in the oil content of rapeseed seeds was achieved, providing a new method for high-oil rapeseed breeding.
Patent Information
- Application Number
- CN202511339064.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-18
- Publication Date
- 2025-11-07
AI Technical Summary
There is significant room for improvement in the oil content of rapeseed seeds in existing technologies, but research on genes related to high-oil rapeseed breeding is limited, making it difficult to effectively regulate the oil content of rapeseed.
By analyzing the genetic basis of rapeseed seed oil content through multi-omics, the rapeseed phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 was cloned, and the oil content of rapeseed seeds was regulated by overexpression using the tobacco mosaic virus double 35S promoter or gene editing using CRISPR/Cas9 technology.
It significantly increased the oil content of rapeseed seeds by 2.16-2.77 percentage points, providing a new approach and means for high-oil rapeseed breeding and oil improvement.
Smart Images

Figure CN120905294A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant gene breeding, and particularly relates to a phosphatidylinositol monophosphate-5-kinase gene of Brassica napus BnPIP5K9 and application thereof in regulating oil content of Brassica napus. BACKGROUND
[0002] Brassica napus is one of the main oil crops in China and is the fifth largest crop after rice, wheat, corn and soybean. Brassica napus (AACC, 2n = 38) was formed about 7500 years ago by Brassica rapa (AA, 2n = 20) and Brassica oleracea (CC, 2n = 18) through natural hybridization and is an allo-tetraploid crop. Double-low rapeseed oil is one of the healthiest edible oils due to its low saturated fatty acid content and high oleic acid content. There is still a lot of room for improvement in the oil content of Brassica napus. Increasing the oil content of Brassica napus seeds is one of the important ways to increase the oil yield per unit area, and the economic value brought by an increase of 1 percent in oil content is equivalent to an increase of 2.2-2.3 percent in yield. Brassica napus Brassica napus is one of the main oil crops in China and is the fifth largest crop after rice, wheat, corn and soybean. Brassica napus (AACC, 2n = 38) was formed about 7500 years ago by Brassica rapa (AA, 2n = 20) and Brassica oleracea (CC, 2n = 18) through natural hybridization and is an allo-tetraploid crop. Double-low rapeseed oil is one of the healthiest edible oils due to its low saturated fatty acid content and high oleic acid content. There is still a lot of room for improvement in the oil content of Brassica napus. Increasing the oil content of Brassica napus seeds is one of the important ways to increase the oil yield per unit area, and the economic value brought by an increase of 1 percent in oil content is equivalent to an increase of 2.2-2.3 percent in yield. Brassica rapa Brassica oleracea Seed oil content is closely related to lipid biosynthesis, transport, accumulation and other biological processes. The lipid biosynthesis and metabolism of Arabidopsis thaliana has been studied more clearly, and more than 700 genes are related to lipid metabolism, which mainly involve de novo fatty acid synthesis, fatty acid chain elongation and desaturation, TAG assembly and synthesis, LD formation, transcriptional regulation, etc. The seed oil content of Brassica napus is a complex quantitative trait, and genes involved in oil synthesis can affect seed oil content, such as and
[0003] involved in fatty acid synthesis; FAD2 , FAE1 involved in fatty acid elongation; LACS2 , LACS9 involved in triacylglycerol synthesis; GPDH and GPAT ; and BASS2 , PPT1 involved in material transport, etc. Brassica napus is an allo-tetraploid, and functional genomics research started late and developed slowly. In addition to genes involved in oil synthesis, the reported genes related to increasing the oil content of Brassica napus are still limited. Therefore, studying the regulation pathway of oil content of Brassica napus, cloning oil content-related genes and cultivating excellent Brassica napus varieties with high oil content have great economic value for the oil crop industry in China. SUMMARY
[0004] The present application analyzes the genetic basis of the seed oil content of Brassica napus with the help of multi-omics, comprehensively analyzes the variation effect of genes, gene expression level, haplotype effect, etc., and finds that the phosphatidylinositol monophosphate-5-kinase gene BnaA05.PIP5K9The expression amount of the BnaA05g28620D is significantly positively correlated with the oil content, and there is obvious haplotype variation in the gene interval. Research shows that overexpression of the gene using a tobacco mosaic virus double 35S promoter can significantly improve the oil content of rapeseed; and the mutant rapeseed seed oil content is significantly reduced, indicating that the gene plays an important role in regulating the oil content of rapeseed seeds, and provides new theory and new gene resources for rapeseed high oil breeding and oil improvement. BnPIP5K9 The mutant rapeseed seed oil content is significantly reduced, indicating that the gene plays an important role in regulating the oil content of rapeseed seeds, and provides new theory and new gene resources for rapeseed high oil breeding and oil improvement.
[0005] Specifically, the present application provides a rapeseed phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 The application of the rapeseed phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 The encoded amino acid sequence is shown as SEQ ID NO: 3 or SEQ ID NO: 4, A1) regulating the oil content of rapeseed; A2) preparing a product for regulating the oil content of rapeseed; A3) cultivating high-oil rapeseed germplasm; A4) preparing a product for cultivating high-oil rapeseed germplasm.
[0006] Further, the rapeseed phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 The nucleotide sequence is shown as SEQ ID NO: 1 or SEQ ID NO: 2.
[0007] Further, the regulation is positive regulation.
[0008] Further, by promoting the expression of the rapeseed phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 or enhancing the function or activity of its protein, the oil content of rapeseed is improved.
[0009] The present application also provides an overexpression vector comprising a rapeseed phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 The application of the rapeseed phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 The encoded amino acid sequence is shown as SEQ ID NO: 3 or SEQ ID NO: 4, B1) regulating the oil content of rapeseed; B2) preparing a product for regulating the oil content of rapeseed; B3) cultivating high-oil rapeseed germplasm; B4) preparing a product for cultivating high-oil rapeseed germplasm.
[0010] Further, the overexpression vector is a plant expression vector pMDC83.
[0011] Furthermore, it includes the rapeseed phosphatidylinositol monophosphate-5-kinase gene. BnPIP5K9 overexpression vector pMDC83 -BnPIP5K9 The construction methods include: S1. RNA was extracted from rapeseed leaves, and cDNA was obtained after reverse transcription. The cDNA was then amplified using primers as shown in SEQ ID NO:5-6 to obtain cDNA as shown in SEQ ID NO:1 or SEQ ID NO:2. BnPIP5K9 Gene fragments; S2, using restriction endonucleases PacI and BamHI to... BnPIP5K9 The gene fragment was double-digested with restriction enzymes, and the plant expression vector pMDC83 was digested with restriction endonucleases SacI, PacI and BamHI. S3, after enzyme digestion and recovery BnPIP5K9 The gene fragment was ligated into the enzyme-digested plant expression vector pMDC83 and transformed into Escherichia coli DH5α competent cells; S4. Screen for positive clones to obtain the overexpression vector pMDC83. -BnPIP5K9 .
[0012] This invention also provides a method for increasing the oil content of rapeseed by promoting the growth of the phosphatidylinositol monophosphate-5-kinase gene in rapeseed. BnPIP5K9 The expression or enhancement of the function or activity of the protein, thereby increasing the oil content of rapeseed, wherein the rapeseed phosphatidylinositol monophosphate-5-kinase gene... BnPIP5K9 The encoded amino acid sequence is shown in SEQ ID NO:3 or SEQ ID NO:4.
[0013] Furthermore, using the plant expression vector pMDC83 as a backbone, a structure containing the rapeseed phosphatidylinositol 5-phosphate kinase gene was constructed. BnPIP5K9 overexpression vector pMDC83 - BnPIP5K9 To enhance the phosphatidylinositol monophosphate-5-kinase gene of rapeseed BnPIP5K9 The expression level was determined and transformed into rapeseed to obtain rapeseed overexpression plants.
[0014] This invention also provides a method for cultivating rapeseed germplasm with low oil content, which involves inhibiting the phosphatidylinositol monophosphate-5-kinase gene in rapeseed using CRISPR / Cas9 system-mediated gene editing technology. BnPIP5K9 The expression or reduction of protein function or activity is used to obtain rapeseed germplasm with low oil content; wherein the rapeseed phosphatidylinositol monophosphate-5-kinase gene is described. BnPIP5K9The encoded amino acid sequence is shown in SEQ ID NO:3 or SEQ ID NO:4; the CRISPR / Cas9 gene editing target is shown in SEQ ID NO:7 and SEQ ID NO:8.
[0015] Beneficial effects: This invention analyzed the genetic basis of oil content in rapeseed seeds based on multi-omics, and cloned a phosphatidylinositol monophosphate-5-kinase gene from rapeseed. BnPIP5K9 The study provided the full-length cDNA nucleotide sequence of the gene and the amino acid sequence of the encoded protein. Comprehensive research revealed a significant positive correlation between gene expression and oil content. Further functional verification was performed using the tobacco mosaic virus double 35S promoter and CRISPR / Cas9 gene editing technology to create mutants through gene overexpression and knockout. Results showed that overexpression of this gene significantly increased rapeseed seed oil content by 2.16-2.77 percentage points, positively regulating oil accumulation in rapeseed seeds. Furthermore, the gene can also be obtained through CRISPR / Cas9 gene editing technology. BnPIP5K9 Functionally deficient rapeseed germplasm resources provide new approaches and methods for high-oil rapeseed breeding and oil improvement, and have extremely high application value and potential. Attached Figure Description
[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1 In Embodiment 1 of the present invention BnPIP5K9 Results of agarose gel electrophoresis of gene amplification products.
[0018] Figure 2 This is a plasmid map of the plant expression vector pMDC83 constructed in Example 2 of the present invention.
[0019] Figure 3 In the overexpression single plant of Example 4 of this invention BnaA05.PIP5K9 Gene expression level detection results, ** indicates P<0.01 in Studen's t test.
[0020] Figure 4 Example 4 of the present invention: rapeseed BnPIP5K9 Editing of target sites in double mutants, where sgRNA is located in the gene. BnaA05.PIP5K9 and BnaC05.PIP5K9CR98 and CR430 are two double mutants of BnaA05.PIP5K9 and BnaC05.PIP5K9 edited by CRISPR.
[0021] Figure 5 For Example 5 of the present application BnPIP5K9 Transgenic rapeseed seed oil content identification, wherein OE61 and OE63 are overexpression lines; CR98 and CR430 are BnaA05.PIP5K9 and BnaC05.PIP5K9 CRISPR double mutants of the present application, each line has 6-8 different single plants, ** indicates P<0.01 in Student's t test. DETAILED DESCRIPTION
[0022] The following examples are only used to more clearly illustrate the technical solutions of the present application, and therefore are only examples and cannot limit the protection scope of the present application. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in the present application should be the usual meanings understood by the skilled in the art to which the present application belongs. Unless otherwise specified, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
[0023] In the early stage of the present application, the genetic basis of rapeseed oil content was analyzed by means of multi-omics, and a stably inherited new QTL qOC.A05.2 of oil content was identified, which contributed to the oil content by 1.5%. There are 45 candidate genes in the qOC.A05.2 interval (confidence interval is 200 kb), and by comprehensively analyzing the variation effect of genes in the interval, gene expression level, haplotype effect, etc., it is found that BnaA05.PIP5K9 Gene (BnaA05g28620D) is the only one significantly positively correlated with oil content in expression amount, and there is obvious haplotype variation in the gene interval.
[0024] Example 1 BnPIP5K9 Cloning of the gene PIP5K9 The gene encodes phosphatidylinositol monophosphate-5-kinase, and there is one copy on each of the A5 and C5 chromosomes of rapeseed, respectively named BnaA05.PIP5K9 (BnaA05g28620D) and BnaC05.PIP5K9(BnaC05g43070D). The CDS sequences thereof are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively, and have lengths of 2451 bp and 2457 bp, respectively, containing complete ORF reading frames and start codon ATG, which encode 817 and 819 amino acids, respectively (shown in SEQ ID NO: 3 and SEQ ID NO: 4), and the two copies of the protein have a homology of 97.8% found by BLAST comparison, and have a high similarity. Randomly selected genes BnaA05.PIP5K9 were cloned.
[0025] (1) Extraction of RNA The total RNA was extracted using TransZol (catalog number ET101) of Qiagen Company. The leaf of Brassica napus was ground in liquid nitrogen, 100 mg of the ground sample was transferred to a 1.5 mL centrifuge tube, 1 mL of TransZol was added, and it was mixed thoroughly by shaking up and down several times, and was allowed to stand at room temperature for 5 minutes. 0.2 mL of chloroform was added, and it was shaken vigorously for 15 seconds, and was incubated at room temperature for 3 minutes. It was centrifuged at 10000 x g at 4°C for 15 minutes. The colorless aqueous phase was transferred to a new centrifuge tube, 0.5 mL of isopropanol was added, and it was mixed thoroughly by shaking, and was incubated at room temperature for 10 minutes. It was centrifuged at 10000 x g at 4°C for 10 minutes, and the supernatant was removed. 1 mL of 75% ethanol (DEPC-treated water) was added, and it was vortexed vigorously. It was centrifuged at 7500 x g at 4°C for 5 minutes. The supernatant was discarded, and the precipitate was air-dried at room temperature. The precipitate was dissolved in 50-100 μl of RNA dissolution solution, and was incubated at 55°C for 10 minutes. 1 μl of the extracted total RNA was taken to measure the RNA concentration under Nanodrop, and the RNA purity was identified according to 1.8 < OD 260 / OD 280 < 2.0. At the same time, 1 μl was taken for 1% agrose electrophoresis to detect the integrity.
[0026] (2) Synthesis of cDNA Reverse transcription was performed using EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (catalog number AE311). Using 5 μg total RNA as a template, 1 μl of Anchored Oligo (dT)18 Primer, 10 μl of 2×ES Reaction Mix, 1 μl of EasyScript® RT / RI Enzyme Mix, 1 μl of gDNA Remover, and RNase-free water were added sequentially to a final volume of 20 μl. The mixture was gently mixed and incubated at 42°C for 30 min; this step synthesizes the first-strand cDNA and removes gDNA. The EasyScript® RT / RI and gDNA Remover were inactivated by heating at 85°C for 5 seconds. The synthesized cDNA was then dissolved in 180 μl of RNase-free water and set aside for later use.
[0027] (3) BnPIP5K9 Gene amplification Based on the reference genome sequence of rapeseed Westar, the target gene on chromosome A5 was amplified. BnPIP5K9 Using the above cDNA as a template, primers were used to amplify the fragment containing the full-length CDS of BnaA05.PIP5K9 using the forward primer PIP5K9-F1 and the reverse primer PIP5K9-R1. PCR amplification was performed using I-5™ 2×High-Fidelity Master Mix (TSINGKEBiological technology). The primer sequences are as follows: Forward primer PIP5K9-F1: 5'GCGttaattaaATGTCTTCCCTTGAAGTGGG-3' (SEQ ID NO:5) Reverse primer PIP5K9-R1: 5'GCGggatccTTATGCGTTGTTCTGAGGAA-3' (SEQ ID NO:6) The PCR amplification system is as follows: PCR amplification program: 98℃ total denaturation for 1 min; 98℃ denaturation for 15 sec, 55℃ annealing for 15 sec, 72℃ extension for 60 sec, 34 cycles; 72℃ total extension for 5 min. The amplified products were detected by agarose gel electrophoresis, as shown below. Figure 1 As shown, amplification yielded a 2451bp amplification. BnaA05.PIP5K9Full length, product digested and recovered using TIANGEN agarose gel recovery kit.
[0028] Example 2 BnPIP5K9 Construction of gene overexpression transformation vector (1) The above obtained BnaA05.PIP5K9 The fragment was double-digested with fast restriction enzymes PacI and BamHI, and the double-digestion system was as follows: The enzyme digestion reaction was performed in a 37°C water bath for 1 hour. The enzyme digestion product was recovered using a TIANGEN DNA purification kit.
[0029] (2) The plant expression vector pMDC83 was digested with fast restriction enzymes SacI, PacI and BamHI, and the enzyme digestion system was as follows: The enzyme digestion reaction was performed in a 37°C water bath for 1 hour. The enzyme digestion product was recovered using a TIANGEN DNA purification kit.
[0030] (3) The enzyme digestion product was ligated to the plant expression vector pMDC83, which contains a constitutive expression promoter and an antibiotic marker. The ligation system was as follows: The ligation reaction conditions were 4°C overnight.
[0031] (4) Escherichia coli DH5α was transformed, as follows: 5 μL of the ligation product was taken and added to 50 μL of DH5α competent cells, mixed well, and placed on ice for 30 min; 42°C water bath for 1.5 min, and placed on ice for 3 min; 400 μL of antibiotic-free liquid LB medium was added, and the activation was performed at 37°C, 150 r / min on a shaker for 45-60 min; 200 μL of the activated bacterial solution was spread on the corresponding antibiotic-resistant solid LB medium, and incubation was performed at 37°C for 12-16 h. After screening positive clones, plasmid digestion identification was performed, and three positive clones were selected for sequencing. The analysis results showed that BnaA05.PIP5K9 the CDS sequence of the gene was successfully connected to the vector, i.e., the plant expression vector pMDC83 for transforming plants was successfully constructed - BnaA05.PIP5K9 The plasmid map of the pMDC83 vector is shown in Figure 2 .
[0032] (5) The correctly constructed recombinant plasmid vector was introduced into the Agrobacterium strain GV3101, and positive single clones were selected and stored in a -80°C refrigerator, as follows: a. Clean the electroporation cuvette: first wash with pure water, then wash with ultrapure water, pour out, then clean with anhydrous ethanol (blow with a 1 mL syringe), pour out the anhydrous ethanol, and place on the clean bench to dry; b. Take 20 μL of Agrobacterium competent GV3101; c. Take 0.8 μL of correctly constructed recombinant plasmid and add to 20 μL of competent cells, mix gently to avoid air bubbles; d. Place the washed and dried electroporation cuvette in ice to pre-cool, then pour the above mixture into the cuvette; e. Adjust the electroporation instrument to 1800V; f. Take the electroporation cuvette out of the ice and wipe the outer wall of the cuvette clean with a water-absorbing paper; g. Place the electroporation cuvette into the instrument, press the "push" button twice in succession, and after a few seconds, if you hear a "drop" sound, it means success; h. After successful electroporation, add 400 μL of antibiotic-free LB to the electroporation cuvette, mix well, and transfer to a sterile centrifuge tube; i. Incubate at 28°C for about 1 hour, take 100 μL and plate on the corresponding resistance plate, seal with sealing film, and incubate in a 28°C incubator for 2 days, then pick and detect.
[0033] (6) Agrobacterium colony detection Select the colony in the double-antibiotic LB medium, incubate at 28°C for 1 hour, take an appropriate amount of bacterial solution for PCR detection, and save the positive Agrobacterium solution.
[0034] Example 3 BnPIP5K9 Construction of CRISPR vector Create a CRISPR-Cas9 system for Brassica napus BnPIP5K9 mutant using the team of Chen Qijun of the College of Life Sciences, China Agricultural University. (1) Select the target points ggagacgcgggatgagaca (SEQ ID NO: 7) and taggactcgccgttgggga (SEQ ID NO: 8), both located in the first exon region, which can target all BnPIP5K9 genes at the same time.
[0035] (2) Design primers (as shown in SEQ ID NO: 9-12) DT1-BsF: ATATATGGTCTCGATTGggagacgcgggatgagacaGTT DT1-F0: TGggagacgcgggatgagacaGTTTTAGAGCTAGAAATAGC DT2-R0: AACtccccaacggcgagtcctaCAATCTCTTAGTCGACTCTAC DT2-BsR: ATTATTGGTCTCGAAACtccccaacggcgagtcctaCAA (3) PCR amplification: four primers PCR amplification was performed with 100-fold diluted pCBC-DT1T2 as template. DT1-BsF and DT2-BsR were normal primer concentration; DT1-F0 and DT2-R0 were diluted 20 times. The amplification system was as follows: PCR amplification procedure: 98°C total denaturation 1 min; 98°C denaturation 15 sec, 56°C annealing 25 sec, 72°C extension 25 sec, 34 cycles; 72°C total extension 5 min.
[0036] (4) Purification and recovery of PCR product, and the following restriction-ligation system was established: Reaction conditions: 37°C reaction 5, 50°C 5 min, 80°C 10 min.
[0037] (5) Transformation of E. coli DH5a: 5 μL of transformed E. coli competent cells were taken, and Kan plate was selected. Positive clones were selected as follows: U626-IDF+U629-IDR=726 bp colony PCR identification, U626-IDF and U629-IDF sequencing. The correct vector was the CRISPR vector of BnPIP5K9 .
[0038] Colony PCR and sequencing primers: U626-IDF: TGTCCCAGGATTAGAATGATTAGGC U629-IDF: TTAATCCAAACTACTGCAGCCTGAC U629-IDR: AGCCCTCTTCTTTCGATCCATCAAC (rc: GTTGATGGATCGAAAGAAGAGGGCT) (6) The correctly constructed recombinant plasmid vector was introduced into Agrobacterium strain GV3101, and positive single clones were selected and stored in -80°C refrigerator. The transformation method was the same as that of Example 2.
[0039] Example 4 Genetic transformation experiment (1) Genetic transformation of rape The constructed BnPIP5K9 The overexpression vector and the CRISPR vector were genetically transformed into rape, and the Agrobacterium-mediated genetic transformation method was used. The receptor used for rape transformation in the present application was Brassica napus Westar. The specific operation process is described in detail in the reference: An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus. (2) Identification of overexpression transformation single plant The genomic DNA of the obtained rape overexpression transformation single plant was extracted, and the insertion of the exogenous gene fragment was detected by PCR. In the present application, the overexpression skeleton vector was pMDC83. The primer pMDC83 Primer-P1 (5'-GATAATCATCGCAAGACCGG-3') was designed on the skeleton vector, and the vector skeleton primer was matched with the exogenous fragment primer to perform PCR (pMDC83 Primer-P1 and PIP5K9-F1, the sequence of PIP5K9-F1 is shown in Example 1), and the transgenic seedlings were detected at the level of PCR.
[0040] The PCR system was as follows: Taq polymerase Mix 5 μL; pMDC83 Primer-P1 (10 μmol / L) 0.5 μL; BnaREM1.3-KpnI-F (10 μmol / L) 0.5 μL; gDNA 1 μL; ddH2O 3 μL.
[0041] The PCR conditions were as follows: 94°C total denaturation for 5 min; 94°C denaturation for 30 sec, 58°C annealing for 30 sec, 72°C extension for 2 min, 34 circles; 72°C total extension for 5 min.
[0042] qRT-PCR was performed on PCR obtained transgenic positive lines of B. napus to detect gene expression. RNA was extracted from transformed single plants and cDNA was synthesized (method same as Example 1). Quantitative primers were designed using Primer 5 software, with product sizes between 100 bp and 200 bp. After designing, BLAST comparison was performed using reference sequences to ensure the specificity of the primers qPIP5K9-F (5'- GTAGCTGAAGATGATACAATCG-3') and qPIP5K9-R (5'- GTATCTGCAGCCTGGCTGTTCCA-3'). BnaACTIN7-L (5'- CGCGCCTAGCAGCATGAA-3') and BnaACTIN7-R (5'- GTTGGAAAGTGCTGAGAGATGCA-3') were used as internal reference primers for B. napus qRT-PCR (see Zhou et al 2012: BnMs3 The reaction system was: cDNA diluted 40 times 6.9 μL Primer 1 (10 μmol / L) 0.3 μL Primer 2 (10 μmol / L) 0.3 μL 2 x TransStart® Green qPCR SuperMix 7.5 μL Reaction program: 94°C for 30 s; 45 cycles of 94°C for 10 s, 60°C for 15 s, 72°C for 30 s, and drawing a melting curve. qRT-PCR was performed in a Bio-Rad CFX96 Real-Time System.
[0043] According to the internal reference primers, the quantitative variation between different repeats was calculated using the method of delta-delta threshold cycle relative quantification (2 -ΔΔCT ). Finally, the analysis obtained overexpression transformed single plants OE61 and OE63 of B. napus, as shown in Figure 3 , the gene expression was significantly increased relative to the wild type control. PIP5K9
[0044] (3) Identification of CRISPR transformed single plants The obtained oilseed rape CRISPR transformation single plants were sequenced to screen the oilseed rape mutants. First, Cas9 protein was identified by using primers Cas9-F (5'- AGACCGTGAAGGTTGTGGAC-3') and Cas9-R (5'-TAGTGATCTGCCGTGTCTC-G-3'), and the specific amplification and sequencing identification of the target gene were performed on the Cas9 protein positive single plants. The specific amplification method of the target gene was as follows: C-PIP5K9-A5-F (5'- ATGTCTTCCCTTGAAGTGGG-3') and C-PIP5K9-A5-R (5'-TTCGATAACTTGTTGCCACC-3') were used for specific amplification BnaA05.PIP5K9 , respectively; C-PIP5K9-C5-F (5'-ATGTCTGACATTGAAGTGGGA-3') and C-PIP5K9-C5-R (5'- GAGAGCTTGTTGTTGCCACC-3') were used for specific amplification BnaC05.PIP5K9 , respectively. The amplification method was the same as shown in Example 4 (2).
[0045] The amplified target fragments were subjected to PCR product sequencing, and the sequencing results were analyzed for the editing of the target site by using the DSDecode online website (http: / / skl.scau.edu.cn / dsdecode / ). The sequencing results showed that two double mutant CR98 and CR430 BnaA05.PIP5K9 and BnaC05.PIP5K9 were obtained Figure 4 .
[0046] Example 5 Analysis of oil content of the obtained transformed plants The mature period harvested oilseed rape seeds were subjected to quality analysis by using a near infrared analyzer, and the seed oil content data were obtained. The instrument was provided by the National Oilseed Rape Engineering Technology Research Center of Huazhong Agricultural University.
[0047] The oil content results showed that, as shown in Figure 5 , the oil content of the receptor background material Westar was 41.29 ± 2.04%, the oil contents of the two overexpression lines OE61 and OE63 were 44.06 ± 1.33% and 43.21 ± 2.17%, respectively, which was significantly increased by 2.16-2.77 percentage points. The oil contents of the mutant materials CR98 and CR430 were 36.63 ± 2.51% and 37.85 ± 2.90%, respectively, i.e. the oil contents of the double mutants (CR98 and CR430) were significantly reduced by 3.44-4.66 percentage points. That is, overexpression BnPIP5K9 of the gene can significantly increase the oil content of oilseed rape seeds, and mutation of the gene can significantly reduce the oil content of oilseed rape seeds, which proves that the gene positively regulates the oil content of oilseed rape seeds.
[0048] In summary, the application is found that the gene BnPIP5K9 Play an important role in regulating the oil content of rape, can positively regulate the oil content of rape seed, and the overexpression of the gene can significantly improve the oil content of rape seed, providing a new way and means for rape high oil breeding and oil improvement, and has very high application value and potential The above specific embodiments describe the implementation of the application in detail, but the application is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concepts of the application, the technical solutions of the application can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the application.
Claims
1. Brassica phosphoinositide monophosphate-5-kinase gene BnPIP5K9 Use in any one of the following, characterized in that, The Brassica phosphoinositide monophosphate-5-kinase gene BnPIP5K9 The encoded amino acid sequence is shown as SEQ ID NO: 3 or SEQ ID NO: 4, A1) modulating oil content in Brassica napus; A2) making a product for modulating oil content in Brassica napus; A3) breeding high oil Brassica napus germplasm; A4) making a product for breeding high oil Brassica napus germplasm.
2. Use according to claim 1, characterized in that, The nucleotide sequence of the Brassica napus phosphoinositide monophosphate-5-kinase gene BnPIP5K9 is shown as SEQ ID NO: 1 or SEQ ID NO:
2.
3. Use according to any one of claims 1-2, characterized in that, The modulation is positive modulation.
4. Use according to claim 3, characterized in that, By promoting the phosphatidylinositol monophosphate-5-kinase gene in rapeseed BnPIP5K9 The expression or enhancement of the function or activity of its protein can increase the oil content of rapeseed.
5. Contains the rapeseed phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 The overexpression vector of the rapeseed phosphatidylinositol monophosphate-5-kinase gene is used in any of the following applications. BnPIP5K9 The encoded amino acid sequence is shown in SEQ ID NO:3 or SEQ ID NO:
4. BnPIP5K9 B1) modulating oil content in Brassica napus; B2) making a product for modulating oil content in Brassica napus; B3) breeding high oil Brassica napus germplasm; 6. Use according to claim 5, characterized in that, B4) making a product for breeding high oil Brassica napus germplasm.
7. Use according to claim 6, characterized in that, Overexpression vector pMDC83 for Brassica napus phosphoinositide monophosphate-5-kinase gene The overexpression vector is the plant expression vector pMDC83. Construction method of overexpression vector pMDC83 for Brassica napus phosphoinositide monophosphate-5-kinase gene BnPIP5K9 Construction method of overexpression vector pMDC83 for Brassica napus phosphoinositide monophosphate-5-kinase gene S1, extracting rape leaf RNA, obtaining cDNA after reverse transcription, and using primers as shown in SEQ ID NO: 5-6 to amplify the cDNA to obtain a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 - BnPIP5K9 gene fragment; S2, using restriction endonucleases PacI and BamHI to... BnPIP5K9 The gene fragment was double-digested with restriction enzymes, and the plant expression vector pMDC83 was digested with restriction endonucleases SacI, PacI and BamHI. S3, the enzyme-digested recovered BnPIP5K9 The gene fragment was ligated to the enzyme-digested plant expression vector pMDC83 and transformed into E. coli DH5α competent cells. S4, screening positive clones, obtaining overexpression vector pMDC83 BnPIP5K9 .
8. A method of increasing oil content in Brassica napus, comprising, By promoting the expression of a Brassica napus phosphatidylinositol monophosphate-5-kinase gene - BnPIP5K9 or enhancing the function or activity of the protein thereof, and thereby increasing the oil content of Brassica napus, wherein the amino acid sequence encoded by the Brassica napus phosphatidylinositol monophosphate-5-kinase gene BnPIP5K9 is set forth in SEQ ID NO: 3 or SEQ ID NO:
4.
9. The method of claim 8, wherein, Using the plant expression vector pMDC83 as a backbone, a gene containing the rapeseed phosphatidylinositol monophosphate-5-kinase was constructed. BnPIP5K9 overexpression vector pMDC83 BnPIP5K9 To enhance the phosphatidylinositol monophosphate-5-kinase gene of rapeseed - BnPIP5K9 The expression level was determined and transformed into rapeseed to obtain rapeseed overexpression plants.
10. A method of breeding a low oil content Brassica germplasm, characterized in that, Inhibition of the phosphatidylinositol monophosphate-5-kinase gene in rapeseed using CRISPR / Cas9 system-mediated gene editing technology BnPIP5K9 The expression or reduction of protein function or activity is used to obtain rapeseed germplasm with low oil content; wherein the rapeseed phosphatidylinositol monophosphate-5-kinase gene is described. BnPIP5K9 BnPIP5K9 The encoded amino acid sequence is shown in SEQ ID NO:3 or SEQ ID NO:4; the CRISPR / Cas9 gene editing target is shown in SEQ ID NO:7 and SEQ ID NO:8.
Citation Information
Cited By
Gene for regulating and controlling oil content of brassica napus seeds and application of gene
CN121975860A