Subtropical estuary benthic fish mullet chubil AHR1b gene recombinant expression plasmid and application thereof

By developing a recombinant expression plasmid for the AHR1b gene of the mullet goby and a luciferase reporter gene system, the problem of insufficient research on AHR1 in estuarine fishes has been solved, and high-sensitivity detection of dioxins and dioxin-like chemicals has been achieved, providing early warning capabilities.

CN120905305AActive Publication Date: 2025-11-07BEIJING NORMAL UNIV AT ZHUHAI
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511405298.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-29
Publication Date
2025-11-07
Estimated Expiration
2045-09-29

AI Technical Summary

Technical Problem

The lack of research on the AHR1 gene in estuarine fishes in existing technologies leads to high uncertainty in the ecological risk assessment of dioxin and dioxin-like chemical pollution, and there is a lack of highly sensitive monitoring methods suitable for nearshore and estuarine fishes.

Method used

We developed a recombinant expression plasmid of the AHR1b gene of the subtropical estuarine benthic fish *Mulletus edulis* and *Goblinus fasciatus*, and a luciferase reporter gene system, which, combined with the ARNT1 gene, was used to detect dioxins and dioxin-like chemicals. This enabled high-throughput and high-sensitivity monitoring of environmental pollutants using the luciferase reporter gene system.

Benefits of technology

It has achieved highly sensitive detection of dioxins and dioxin-like chemicals in nearshore and estuarine waters, providing species-specific early warnings for estuarine fish and reducing the uncertainty of ecological risk assessment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905305A_ABST
    Figure CN120905305A_ABST
Patent Text Reader

Abstract

The invention discloses a subtropical estuary benthic fish mullet chubil AHR1b gene recombinant expression plasmid and application thereof, and belongs to the technical field of environmental toxicology. The AHR1b gene recombinant expression plasmid is prepared by introducing an AHR1b gene into an expression vector. The invention also discloses a luciferase reporter gene system, which comprises an AHR1b gene recombinant expression plasmid, an ARNT1 gene recombinant expression plasmid and a firefly luciferase reporter plasmid containing a mouse CYP1A1 gene promoter. According to the invention, a luciferase reporter gene system is utilized to carry out comprehensive characterization on TCDD toxicity and evaluate the sensitivity and the specificity of a mugilogobius chuchuyi AHR1b and ARNT1 subtype dependency reporter gene system, so that a theoretical basis is provided for supporting high-throughput and high-sensitivity environment monitoring, and meanwhile, a species-specific early warning technology is provided for offshore and estuary DLCs pollution.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of environmental toxicology, and particularly relates to a recombinant expression plasmid of AHR1b gene of subtropical estuarine benthic fish Oreichthys parvus and application thereof. BACKGROUND

[0002] Dioxin-like compounds (DLCs) are a group of persistent organic pollutants with similar structure and toxicity, mainly including polychlorinated dibenzo-p-dioxins (PCDDs), polychlorinated dibenzofurans (PCDFs) and some polychlorinated biphenyls (PCBs). This group of substances has attracted much attention due to their high toxicity, environmental persistence, bioaccumulation and long-distance migration ability. The toxic effects of dioxins and DLCs are mainly mediated by the activation of aryl hydrocarbon receptor (AHR) signaling pathway. AHR is a ligand-regulated transcription factor and a key receptor for mediating dioxin toxicity. Among them, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) has been confirmed as the strongest exogenous AHR ligand. When this kind of substance enters the cell, it binds with AHR in the cytoplasm to form a complex, and then is transported to the nucleus to bind with aryl hydrocarbon receptor nuclear translocator (ARNT). The heterodimer can specifically recognize and bind to the dioxin response element (DRE) in the promoter region of the target gene, and then regulate the expression of downstream genes such as CYP1A1 and CYP1A2, causing various toxic effects. Therefore, it is urgent to establish an accurate ecological risk assessment method for dioxins and DLCs.

[0003] Fish has experienced a unique gene duplication event in the evolution process, forming a more complex AHR system than mammals. The structural and functional diversity of AHR is the key molecular basis for the difference in sensitivity to dioxins and DLCs among different species. Studies have shown that there are significant differences in ligand binding ability and transcriptional activation characteristics among different subtypes of AHR, which can lead to a change of sensitivity by orders of magnitude. Although fish is one of the most sensitive vertebrates to dioxins and DLCs exposure, there is a large difference in sensitivity among different species, and the concentration of DLCs that can cause fish embryo death may differ by 200 times. Existing research on fish AHR mainly focuses on freshwater fish and some marine fish, and the research on AHR of estuarine fish which has been exposed to high-pollution environment for a long time is still insufficient. It is particularly noteworthy that most current researches mainly focus on AHR2 subtype, and AHR1 is not paid enough attention. Therefore, it is necessary to further study AHR1 of estuarine fish. At present, the lack of research data on the sensitivity of estuarine fish to dioxins and DLCs increases the uncertainty of related ecological risk assessment.

[0004] Mugilogobius chulae is a kind of sub-tropical estuary and nearshore benthic fish, which has become an ideal species for detecting estuary and marine pollutants due to its unique ecological characteristics. Mugilogobius chulae has a long-term close contact with sediments due to its benthic living habits, and its adhesive embryos are more likely to be directly exposed to contaminated sediments. As the main distribution area of the species, the sediments in the Pearl River Estuary of China have been detected with a variety of dioxins and DLCs, which makes the species face the risk of exposure to DLCs from the embryonic development stage. However, the sequence and functional characteristics of the AHR1 gene of the species have not been characterized. SUMMARY

[0005] The purpose of the present application is to provide a sub-tropical estuary benthic fish Mugilogobius chulae AHR1b gene recombinant expression plasmid and its application, to solve the problems existing in the prior art, to develop a luciferase reporter gene system suitable for nearshore and estuary fish by using Mugilogobius chulae AHR1b and ARNT1 genes, to realize high-throughput and high-sensitivity environmental pollutant monitoring, and to provide species-specific early warning technology for nearshore and estuary DLCs pollution.

[0006] To achieve the above purpose, the present application provides the following scheme:

[0007] The present application provides a sub-tropical estuary benthic fish Mugilogobius chulae AHR1b gene recombinant expression plasmid, which is prepared by introducing AHR1b gene into an expression vector, and the nucleotide sequence of the AHR1b gene is shown in SEQ ID NO. 1.

[0008] The present application also provides a luciferase reporter gene system, which comprises the AHR1b gene recombinant expression plasmid, the ARNT1 gene recombinant expression plasmid and the firefly luciferase reporter plasmid containing the mouse CYP1A1 gene promoter; wherein the ARNT1 gene recombinant expression plasmid is prepared by introducing ARNT1 gene into an expression vector, and the nucleotide sequence of the ARNT1 gene is shown in SEQ ID NO. 2.

[0009] The present application also provides the application of the AHR1b gene recombinant expression plasmid or the luciferase reporter gene system in preparing a product for detecting dioxins and dioxin-like chemicals.

[0010] The present application also provides the application of the AHR1b gene recombinant expression plasmid or the luciferase reporter gene system in detecting dioxins and dioxin-like chemicals pollution in nearshore and estuary water bodies.

[0011] The present application also provides a method for detecting dioxins and dioxin-like chemicals, comprising the following steps:

[0012] (1) Transfect the premix solution containing the AHR1b gene recombinant expression plasmid, the ARNT1 gene recombinant expression plasmid and the firefly luciferase reporter plasmid containing the mouse CYP1A1 gene promoter into the culture cells, then add the to-be-tested toxicant solution, and continue to culture after the toxicant is added to detect the Firefly and Renilla luminescence values;

[0013] (2) Calculate the luciferase ratio according to the Firefly and Renilla luminescence values to obtain the luciferase activity induced by the luciferase reporter gene, and then determine the content of dioxin and dioxin-like chemical substances in the to-be-tested toxicant solution.

[0014] Preferably, the premix solution further comprises an experimental control plasmid and single-stranded DNA, and the volume ratio of the AHR1b gene recombinant expression plasmid, the ARNT1 gene recombinant expression plasmid, the firefly luciferase reporter plasmid containing the mouse CYP1A1 gene promoter, the experimental control plasmid and the single-stranded DNA is (0.2-0.23):(0.2-0.25):(0.2-0.25):(0.2-0.25):(0.3-0.35).

[0015] Preferably, the culture condition of the premix solution transfected into the culture cells is 37℃, 5% CO2 culture for 5 h; after the toxicant is added, the culture is continued under the same condition for 20 h.

[0016] Preferably, the culture cells comprise COS-7 cells, and the density of the COS-7 cells is 1.4×10 5 cells / mL; the volume ratio of the toxicant solution and the AHR1b gene recombinant expression plasmid is (3-5):(0.2-0.23).

[0017] Preferably, the premix solution without the firefly luciferase reporter plasmid is used as a reporter control, the premix solution without any transfected DNA is used as a blank control, and TCDD is used as a positive control.

[0018] Preferably, the to-be-tested toxicant solution comprises a TCDD solution or a nearshore and estuarine water body contaminated by TCDD.

[0019] The present application discloses the following technical effects:

[0020] The present application develops a luciferase reporter gene system suitable for offshore and estuary fish by using AHR1b and ARNT1 genes of subtropical estuary benthic fish O. marmoratus, and comprehensively characterizes the toxicity of complex environmental wastewater by using the luciferase reporter gene system, and evaluates the sensitivity and specificity of the AHR1b and ARNT1 subtype-dependent reporter gene system of O. marmoratus, thereby providing a theoretical basis for supporting high-throughput and high-sensitivity environmental monitoring.

[0021] The present application compares the AHR1b-ARNT1 activities of various freshwater fishes, and the results show that the AHR1b-ARNT1 of O. marmoratus has an EC 50 significantly lower than that of most freshwater fishes, which shows excellent pollutant recognition sensitivity, and provides a theoretical basis for using O. marmoratus AHR1b as a high-sensitivity dioxin pollutant detection element, and provides a species-specific early warning technology for offshore and estuary DLCs pollution. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description only constitute some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0023] Figure 1 AHR1b gene electrophoresis detection results; 1: AHR1b gene amplification product, 2: ARNT1 gene amplification product, M: standard DNA molecule;

[0024] Figure 2 A map of the recombinant plasmid pCDNA3.1(+)-AHR1b;

[0025] Figure 3 A map of the recombinant plasmid pCDNA3.1(+)-ARNT1;

[0026] Figure 4 A dose-effect relationship curve of TCDD-induced luciferase activity in COS-7 cells transfected with O. marmoratus AHR1b and ARNT1 expression plasmids. DETAILED DESCRIPTION

[0027] Now, various exemplary embodiments of the present application will be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.

[0028] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, a parameter, an intermediate value of the parameter is understood to be specifically disclosed anywhere that the parameter is stated to have a range of values. Any smaller range of values is understood to be specifically disclosed, even if not explicitly stated. The upper and lower limits of any smaller range of values are independently combinable with any other smaller or larger range of values.

[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials which are described herein. In case of conflict, the present specification will control.

[0030] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0031] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0032] Example 1

[0033] 1. Construction of pCDNA3.1(+)-AHR1b plasmid

[0034] 1.1 Synthesis of target gene: obtain AHR1b gene fragment

[0035] (1) Template: cDNA of Oryzias latipes brain was used as template to amplify AHR1b sequence.

[0036] (2) Amplification primers:

[0037] Upstream primer (5'-3'): ATGTACGCGGGCCGCAAGAGG (SEQ ID NO. 3);

[0038] Downstream primer (5'-3'): TCAGAGGTAAGAACCATTGGCTGGA (SEQ ID NO. 4).

[0039] (3) Amplification conditions

[0040] Table 1 PCR reaction liquid composition (50 μL system)

[0041]

[0042] PCR reaction conditions: 98℃ 10 sec, 55℃ 15 sec, 72℃ 3 min, 30 cycles.

[0043] (4) Purification, recovery and sequencing of samples

[0044] The electrophoresis detection results are shown in Figure 1 .

[0045] The target band was purified by agarose gel DNA recovery kit, and after ethanol precipitation purification, it was sent for analysis.

[0046] The amplified CDS sequence of AHR1b (SEQ ID NO. 1) is as follows:

[0047]

[0048] 1.2 Ligation transformation: After pCDNA3.1(+) vector was treated with BamHI and EcoRI, the treated vector was ligated with AHR1b gene fragment, and the ligation product was transformed into Stbl3 E. coli competent cells.

[0049] 1.3 Screening verification: The transformed product was plated on LB plates containing antibiotics, and after 12-14 h of inverted culture at 37°C, single colonies were picked for colony PCR primary screening. After selecting and expanding the positive clones, the plasmid was extracted and verified by BamHI / EcoRI double digestion. The positive clones that passed the verification were sent for sequencing, and after successful sequencing alignment, the recombinant expression plasmid IGEB0349-3 pCDNA3.1(+)-AHR1b (abbreviated as pCDNA3.1(+)-AHR1b) was obtained. Figure 2 )。

[0050] 1) Colony PCR identification system (20 μL), see Table 2.

[0051] Table 2 Colony PCR identification system

[0052]

[0053] PCR reaction conditions: 94°C 150 s; 94°C 150 s, 60°C 150 s, 72°C 180 s, 20 cycles; 72°C 5 min.

[0054] 2) Colony PCR identification primers are as follows:

[0055] Upstream primer (5'-3'): AAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGTACGCGGGCCGCAAGAGGAG (SEQ ID NO. 5);

[0056] Downstream primer (5'-3'): CTCGAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTCAGAGGTAAGAACCATTGG (SEQ ID NO. 6).

[0057] 2, Construction of pCDNA3.1(+)-ARNT1 plasmid

[0058] 2.1 Synthesis of target gene: Obtain ARNT1 gene fragment.

[0059] 2.1.1 Template: Amplify ARNT1 sequence using cDNA from the liver of O. jordani as template.

[0060] 2.1.2 Primers

[0061] (1) Adaptor primers:

[0062] 5' adaptor GCTGTCAACGATACGCTACGTAACGGCATGACAGTGGGIIGGGIIGGGIIG (SEQ ID NO. 7); (I: represents deoxyinosine, an artificial synthetic nucleotide analogue, designed to increase the compatibility with the target sequence and reduce the risk of primer dimerization).

[0063] 5.3' outer: GCTGTCAACGATACGCTACGTAAC (SEQ ID NO. 8);

[0064] 5.3' inner: GCTACGTAACGGCATGACAGTG (SEQ ID NO. 9).

[0065] (2) Intermediate sequence amplification primers:

[0066] RC1100-C-N1F: ATGGGGCGAGTGGGACC (SEQ ID NO. 10);

[0067] RC1100-C-N1F: ATGGGGCGAGTGGGACC (SEQ ID NO. 10);

[0068] RC1100-C-N1R: TCCGTTCTGACGAGAAATCTGAG (SEQ ID NO. 12);

[0069] Nested PCR was used for the intermediate sequence CN1.

[0070] RC1100-C-P2F: ACAGCAAGAGCCTGGAGAAGAC (SEQ ID NO. 13);

[0071] RC1100-C-P2R: TCACTCATTAAATGAAGAGTACATGGGA (SEQ ID NO. 14).

[0072] (3) 5' RACE reverse transcription primers and specific primers:

[0073] RC1100-C-RT1: TTGCTCTCGCAGTTTCTCGGT (SEQ ID NO. 15);

[0074] RC1100-C-RT2: GTTCAGGACGGGAATGATAGAGT (SEQ ID NO. 16);

[0075] RC1100-C-R2: TTCGATCTCGCTGTGGTTCTCT (SEQ ID NO. 17);

[0076] RC1100-C-R3: TTATCATTGTTGGAGCCTGAAGTG (SEQ ID NO. 18).

[0077] 2.2 Intermediate sequence amplification

[0078] (1) The PCR reaction system is shown in Table 3.

[0079] Table 3 PCR reaction system of intermediate sequence

[0080]

[0081] (2) The PCR cycle conditions are shown in Table 4.

[0082] Table 4 PCR cycle conditions of intermediate sequence

[0083]

[0084] 2.3 5' RACE

[0085] 2.3.1 cDNA end C addition

[0086] The cDNA obtained by reverse transcription using the 5' RACE reverse transcription primer was treated: RNase H digestion, cDNA purification recovery, TdT C tail addition.

[0087] 2.3.2 Nest PCR reaction system

[0088] (1) The PCR reaction system is shown in Table 5.

[0089] Table 5 Nest PCR reaction system

[0090]

[0091] (2) The PCR cycle conditions are shown in Table 6.

[0092] Table 6 PCR cycle conditions

[0093]

[0094] Note: *1: The first 10 cycles are touchdown PCR, each cycle decreases by 1°C; *2: The extension time is set at 1 kb / min.

[0095] The amplified products were detected by electrophoresis, and the results are shown in Figure 1

[0096] 3. Cloning and sequencing

[0097] 3.1 Transformation of ligation products

[0098] Prepare competent cells (SK2301), and the transformation steps are as follows:

[0099] 1) 100 μL of competent cells were placed on ice and completely thawed, and then the cells were gently suspended.

[0100] 2) Add 10 μL of ligation solution and mix gently. Place on ice for 30 min.

[0101] 3) Heat shock at 42°C for 60 s. Place on ice for 10-15 min.

[0102] 4) Add 400 μL of LB medium and incubate at 37°C with shaking at 200-250 rpm for 1 h.

[0103] 5) Centrifuge at 4000 rpm for 5 min at room temperature, aspirate 400 μL of supernatant with a gun tip, and suspend the cells with the remaining medium.

[0104] 6) Spread the bacteria on an ampicillin plate previously coated with 20 μL of 100 mM IPTG and 100 μL of 20 mg / mL X-gal, and incubate overnight.

[0105] 3.2 Colony PCR and sequencing

[0106] Use the universal primers on the pMD18-T vector [M13+(-47): agggttttcccagtcacg (SEQ ID NO. 19); M13-(-48): gagcggataacaatttcacac (SEQ ID NO. 20)] for colony PCR.

[0107] (1) The PCR reaction system is shown in Table 7.

[0108] Table 7 Colony PCR reaction system

[0109]

[0110] (2) The PCR cycle conditions are shown in Table 8.

[0111] Table 8 Colony PCR cycle conditions

[0112] ​

[0113] The amplified ARNT1 CDS sequence (SEQ ID NO. 2) is as follows:

[0114]

[0115] 3.3 Ligation transformation

[0116] First, the pCDNA3.1(+) vector was digested with BamHI and EcoRI, and then the digested pCDNA3.1(+) vector was ligated with the ARNT1 gene fragment. After ligation, it was transformed into Top10 E. coli competent cells.

[0117] 3.4 Screening and verification

[0118] The transformed E. coli was plated on a plate containing antibiotics and inverted for 12-14 h. The bacteria were picked for PCR identification. The positive colonies were extracted for plasmid, and the recombinant plasmid was identified by enzyme digestion. The positive clones were sequenced, and after successful sequence alignment, the plasmid was extracted to obtain the constructed recombinant expression plasmid IGEB0349-1 pCDNA3.1(+)-ARNT1 (abbreviated as pCDNA3.1(+)-ARNT1), as shown in Figure 3 .

[0119] 1) The colony PCR identification system (20 μL) is shown in Table 9.

[0120] Table 9 Colony PCR identification system

[0121]

[0122] PCR reaction conditions: 94°C 150s; 94°C 150s, 60°C 150s, 72°C 135s, 20 cycles; 72°C 5min.

[0123] 2) Primer:

[0124] F: 5'-ATCCGCCACCATGTTATTCCACTCGGATATGTCTTCATCAAACCCCGATTTAC-3' (SEQ ID NO. 21);

[0125] R: 5'-CTCGAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTCACTCATTAAATGAAGAGT-3' (SEQ ID NO. 22).

[0126] Example 2 Luciferase reporter gene detection

[0127] 1, medium preparation

[0128] 1.1 Cell culture medium preparation method for luciferase reporter gene experiment (LRG):

[0129] Take 500 mL of pre-prepared DMEM base medium (Gibco, USA), and add the following components in order: 50 mL of heat-inactivated fetal bovine serum (Gibco, USA); 5 mL of 100x non-essential amino acid solution (Gibco, USA); 5 mL of 100x penicillin-streptomycin double-antibiotic solution (Gibco, USA); mix well and store at 4°C for later use.

[0130] 1.2 Preparation of CS-DMEM medium

[0131] (1) Preparation of DMEM base medium

[0132] a) Take a 1 L beaker, add 950 mL of distilled water and a magnetic stirrer, and place it on a magnetic stirrer.

[0133] b) Gently shake the DMEM bagged powder (Gibco, USA) to make the powder sink to the bottom, and pour all of it into the beaker after opening the bag. Start stirring (low speed to avoid bubbles).

[0134] c) Rinse the packaging bag with a small amount of distilled water 2-3 times, and pour the rinse water into the beaker.

[0135] d) Add 3.7 g of NaHCO3, and add distilled water to make up to 1 L. Continue stirring until completely dissolved (about 30 min).

[0136] e) Adjust the pH to 6.8±0.1 with a pH meter (Sartorius PB-11) (if necessary, use 1 M HCl or NaOH).

[0137] (2) Activated carbon treatment

[0138] a) Add 25 g of dextran-coated activated carbon (Sigma-Aldrich) to a 50 mL centrifuge tube (Corning), and pour 50 mL of the above DMEM medium into it. Mix well by vortexing.

[0139] b) Incubate in a 37°C water bath with shaking (30 rpm) for 1 h to allow complete adsorption.

[0140] c) Centrifuge at 2000 x g and 21°C for 20 min. During centrifugation, perform ultraviolet sterilization (20 min) and 70% ethanol wiping on the clean bench.

[0141] d) After centrifugation, spray the outer wall of the centrifuge tube with ethanol for disinfection, and carefully transfer it to the clean bench (avoid disturbing the precipitate).

[0142] (3) Filtration and preparation of final medium

[0143] a) Filter the supernatant with 0.22 μm Steritop filter (Millipore, USA) to avoid charcoal entering the filtrate.

[0144] b) Add to 500 mL filtered CS-DMEM: 5 mL penicillin-streptomycin double antibody (100x, Gibco) and 50 mL charcoal-treated fetal bovine serum (CS-FBS, HyClone Laboratories).

[0145] c) Wrap with tin foil to protect from light, store at 4°C.

[0146] 2. Luciferase reporter gene assay

[0147] 2.1 Cell plating

[0148] 2.1.1 Preparation before experiment

[0149] Ultraviolet irradiation of the biosafety cabinet for 30 min (start in advance).

[0150] Put sterile consumables in the biosafety cabinet: pipette (Thermo) and corresponding range gun head (Axygen, sterile and enzyme-free); 96-well plate (Corning Costar 3610); sterile pipette (Corning), sample addition tank (Santa Cruz Biotechnology).

[0151] 37°C water bath preheating: 1x trypsin (Gibco), DMEM complete medium, CS-DMEM medium.

[0152] 2.1.2 Cell digestion and collection

[0153] 1) Discard old medium: tilt the culture bottle and suck out the old medium from the far corner (avoid touching the cell layer at the bottom of the bottle).

[0154] 2) PBS washing: add 4 mL PBS (HyClone) along the side wall, shake gently to cover the bottom, and discard (repeat 2 times).

[0155] 3) Trypsin digestion: add 2 mL of 1x trypsin to cover the cell layer, digest at 37°C for 5 min; continue to digest for 5 min after gently knocking the bottle wall (microscope confirms that the cells are completely detached).

[0156] 4) Stop digestion: add 6 mL of DMEM complete medium, blow 5 times, and then transfer to a 50 mL centrifuge tube (Corning).

[0157] 5) Cell dispersion: blow 50 times to a single cell suspension, centrifuge at 2000xg for 5 min (room temperature), and discard the supernatant.

[0158] 2.1.3 Cell counting and dilution

[0159] 1) Resuspend cells:

[0160] Estimate cell amount according to confluence (100% confluence ≈ 4 96-well plates).

[0161] Add 1 / 4 of target volume CS-DMEM (target concentration: 1.4 x 10 5 cells / mL), mix by pipetting.

[0162] 2) Counting by hemocytometer: adjust CS-DMEM volume to final concentration, make sure the suspension is even (pipette before each time).

[0163] 2.1.4 Seeding in 96-well plates

[0164] Transfer cell suspension to sterile sample wells, dispense by multichannel pipette (75 μL / well).

[0165] Incubate for 5 min, confirm seeding density by microscope (30-40% confluence).

[0166] Incubate in 37℃, 5% CO2, 95% humidity incubator overnight.

[0167] 2.2 Transient transfection

[0168] 2.2.1 Plasmid preparation

[0169] (1) Experimental plasmids

[0170] Expression plasmids: recombinant expression plasmids of O. jordani AHR1b and ARNT1.

[0171] Reporter plasmid: pGudLuc6.1 containing mouse CYP1A1 promoter (gifted by Professor Zhang Rui, Jinan University).

[0172] Internal control plasmid: pRL-CMV (Promega).

[0173] (2) Preparation of plasmid working solution

[0174] Table 10 Plasmid working solution

[0175]

[0176] Note: ss-DNA (MCE, USA) is salmon sperm DNA, which is used as carrier DNA to improve transfection efficiency.

[0177] 2.2.2 Transfection

[0178] 2.2.2.1 Biosafety cabinet preparation

[0179] UV disinfection for 30 min, pre-cool DNA dilution EP tube (ice operation).

[0180] 2.2.2.2 Transfection premix preparation

[0181] (1) Experimental group: (proportionally enlarged according to Table 11, additional 10-20% volume reserved).

[0182] Table 11 Transfection plasmid premix dosage (1-hole system)

[0183]

[0184] (2) Control group:

[0185] Reporter control: only contains pGudLuc6.1 + pRL-CMV + ss-DNA.

[0186] (3) Blank control: does not contain any transfection DNA.

[0187] 2.2.2.3 Transfection reagent complex preparation

[0188] Each hole needs: 0.2 μL FuGENE® HD (DNA transfection reagent) + 5 μL Opti-MEM;

[0189] After mixing, stand at room temperature for 5 min, then add the corresponding DNA premix, gently shake to mix, and incubate at room temperature for 15 min.

[0190] 2.2.2.4 Transfection

[0191] Add 6 μL of transfection complex to each hole (except blank control), and gently shake the 96-well plate to distribute evenly.

[0192] Label the plate information (plasmid combination, date, etc.).

[0193] 2.2.2.5 Culture and poisoning

[0194] After 5 h of culture at 37°C, 5% CO2, subsequent poisoning experiments were performed.

[0195] 3. Poisoning

[0196] (1) TCDD exposure concentration: 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 300 nM.

[0197] (2) Exposure and incubation: Use a pipette to add 5 μL of pre-prepared exposure working solution to each well of the 96-well plate (ensure the final concentration of DMSO is 0.5%). After exposure, place the 96-well plate in a 37°C, 5% CO2 incubator for 20 h before detection.

[0198] The experimental setup includes:

[0199] Technical repeats: 4 replicates per treatment group (in the same plate).

[0200] Biological repeats: Independent experiments repeated 3 times (different plate times).

[0201] 4. Detection

[0202] 4.1 Reagent thawing and preparation

[0203] Take Dual-Glo™ Luciferase Assay System (Promega) out of -80°C 1 h in advance and place on ice.

[0204] Luciferase Reagent preparation: Add Luciferase Buffer (thawed at room temperature) to the Luciferase Substrate brown bottle, completely dissolve, and then aliquot 9 mL / tube, and store in the dark.

[0205] Stop & Glo® Reagent preparation: Take 9 mL of Stop & Glo® Buffer, add 90 μL of Stop & Glo® Substrate (1:100 ratio), mix well, and then aliquot 9 mL / tube, and store in the dark.

[0206] 4.2 Detection operation

[0207] (1) Sample equilibration

[0208] Take the 96-well plate out of the incubator and equilibrate at room temperature for 5-10 min (to avoid interference from condensed water).

[0209] (2) Firefly luciferase detection

[0210] In a fume hood, pour the Luciferase Reagent into a sterile sample addition slot, use a dispensing gun to add 85 μL per well, and gently tap the side of the plate to mix. Wrap in tin foil to avoid light, and place on a horizontal shaker (Grant-bio) to incubate at room temperature for 20 min. Use an enzyme marker (Synergy H4 Hybrid or LuminoSkan Ascent) to detect the Firefly signal (wavelength: 560 nm).

[0211] (3) Renilla luciferase detection

[0212] Replace the new addition slot, add the prepared Stop & Glo® Reagent (9 mL / plate): add 85 μL per well, gently mix; tin foil light protection, horizontal shaking incubation at room temperature for 20 min; the same enzyme label instrument detects Renilla signal (wavelength: 480 nm).

[0213] 5. Data analysis

[0214] 5.1 Data preprocessing

[0215] (1) Background correction

[0216] Calculate the arithmetic mean of the blank control well fluorescence signal.

[0217] Subtract the background mean value from the Firefly and Renilla fluorescence signal values of all detection wells.

[0218] (2) Signal ratio calculation

[0219] Calculate the corrected luciferase ratio (Firefly / Renilla).

[0220] 5.2 Data standardization

[0221] (1) Solvent control correction

[0222] Calculate the arithmetic mean of the luciferase ratio of the DMSO control group (0.5% DMSO).

[0223] Subtract the solvent control mean value from the luciferase ratio of all experimental groups.

[0224] (2) Inter-plate standardization

[0225] Calculate the arithmetic mean of the normalized luciferase ratio of the positive control (300 nM TCDD).

[0226] Convert the data of each experimental group to the induction percentage relative to the positive control:

[0227] Induction percentage = (experimental group normalized ratio / positive control mean) x 100%.

[0228] 5.3 Data analysis and visualization

[0229] (1) Statistical analysis using GraphPad Prism 10.0.

[0230] (2) Dose-effect curve fitted with four-parameter logistic equation.

[0231] (3) The significance test was performed using one-way ANOVA.

[0232] 6. Results and Analysis

[0233] like Figure 4 As shown, the luciferase reporter gene assay results indicated that AHR1b from *Mulletogienos zhuyi* specifically responded to TCDD activation. Luciferase activity exhibited a dose-response relationship with TCDD; compared to the solvent control group, 5 nM TCDD significantly induced an increase in luciferase activity (p < 0.01), with the highest concentration of TCDD (300 nM) achieving 100% luciferase activity. The half-maximal effective concentration (EC50) of TCDD transfected with *Mulletogienos zhuyi* AHR1b and ARNT1 expression plasmids induced luciferase activity in COS-7 cells. 50 The molecular weight (M) is 4.32 nM. This characteristic parameter indicates that the AHR1b of the mullet goby has a high affinity for TCDD and can serve as a key molecular basis for the development of pollutant-specific biosensor elements.

[0234] Based on luciferase reporter gene assays, the AHR1b-ARNT1 signaling pathway in *Mulletochus zhuyi* involved in this invention exhibits significantly high sensitivity to TCDD. Compared with known AHR1b-ARNT1 activities in freshwater fish, the EC50 activity of *Mulletochus zhuyi* AHR1b-ARNT1 against TCDD is significantly higher. 50 The sensitivity of AHR1b to TCDD is significantly lower than that of most freshwater fish, demonstrating excellent pollutant detection sensitivity. Specifically, the sensitivity of AHR1b to TCDD described in this invention is 7.7 times that of the zebrafish model organism and 3 times that of the carp. This comparative result highlights the outstanding advantages of AHR1b from the Chinese mullet goby as a highly sensitive detection element for dioxin-like pollutants.

[0235] Table 12 Comparison of AHR1b-ARNT1 sensitivity to TCDD between *Mulletus zhurensis* and other freshwater fish (based on ECMO experiments using luciferase reporter gene assays) 50 value)

[0236]

[0237] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A recombinant expression plasmid of AHR1b gene of Oligolepis acuifrons, characterized in that, The AHR1b gene recombinant expression plasmid is prepared by introducing the AHR1b gene into an expression vector, and the nucleotide sequence of the AHR1b gene is shown as SEQ ID NO.

1.

2. A luciferase reporter gene system characterized in that, The luciferase reporter gene system comprises the AHR1b gene recombinant expression plasmid, the ARNT1 gene recombinant expression plasmid and the firefly luciferase reporter plasmid containing the mouse CYP1A1 gene promoter; wherein the ARNT1 gene recombinant expression plasmid is prepared by introducing the ARNT1 gene into an expression vector, and the nucleotide sequence of the ARNT1 gene is shown as SEQ ID NO.

2.

3. The AHR1b gene recombinant expression plasmid of claim 1 or the luciferase reporter gene system of claim 2 in the preparation of a product for detecting dioxins and dioxin-like chemicals.

4. The AHR1b gene recombinant expression plasmid of claim 1 or the luciferase reporter gene system of claim 2 in the detection of dioxins and dioxin-like chemical pollution in offshore and estuarine water bodies.

5. A method of detecting dioxin and dioxin-like chemicals, characterized by, The method comprises the following steps: (1) transfecting culture cells with a premix liquid containing the AHR1b gene recombinant expression plasmid, the ARNT1 gene recombinant expression plasmid and the firefly luciferase reporter plasmid containing the mouse CYP1A1 gene promoter, and then adding the to-be-tested contaminated liquid, culturing after contamination, and detecting the Firefly and Renilla luminescence values; (2) calculating the luciferase ratio according to the Firefly and Renilla luminescence values, obtaining the luciferase activity induced by the luciferase reporter gene, and then determining the content of dioxins and dioxin-like chemicals in the to-be-tested contaminated liquid.

6. The method of claim 5, wherein, The premix liquid further comprises an experimental control plasmid and single-stranded DNA, and the volume ratio of the AHR1b gene recombinant expression plasmid, the ARNT1 gene recombinant expression plasmid, the firefly luciferase reporter plasmid containing the mouse CYP1A1 gene promoter, the experimental control plasmid and the single-stranded DNA is (0.2-0.23):(0.2-0.25):(0.2-0.25):(0.2-0.25):(0.3-0.35).

7. The method of claim 5, wherein, The culture condition of the transfection of the premix liquid into culture cells is 37℃, 5% CO2 for 5 h; after contamination, the culture is continued under the same condition for 20 h.

8. The method of claim 5, wherein, The cultured cells include COS-7 cells, the density of the COS-7 cells is 1.4×10 5 cells / mL; the volume ratio of the exposure solution to the AHR1b gene recombinant expression plasmid is (3-5):(0.2-0.23).

9. The method of claim 5, wherein, The premix liquid without the firefly luciferase reporter plasmid is used as a reporter control, the premix liquid without any transfection DNA is used as a blank control, and TCDD is used as a positive control.

10. The method of claim 5, wherein, The to-be-tested contaminated liquid comprises a TCDD solution or offshore and estuarine water bodies contaminated by TCDD.

Citation Information

Patent Citations

  • Method for detecting plasmids of polycyclic aromatic hydrocarbons in environment and application thereof

    CN103898162A

  • Dioxin substance detection method based on fish promoter

    CN116144657A

  • Recombinant cell strain for detecting dioxin compounds according to behaviour of leuciferinase gene

    CN1749403A

  • Transformant for measuring dioxins, method for detecting same by using same, method for quantitatively analyzing same and method for screening same

    JP2004135662A

  • Transgenic fish and method for detecting or quantitatively determining detection object substance using transgenic fish

    JP2014223039A