Reagent for detecting SNP (Single Nucleotide Polymorphism) locus genotype of salt tolerance related character of scylla paramamosain and application of reagent

By screening specific SNP sites in the CA gene of mud crab *Scylla serrata*, primer sets were designed for PCR amplification and sequencing, solving the problem of salt tolerance screening in existing technologies and achieving efficient and accurate identification of salt tolerance traits and breeding support.

CN120905391APending Publication Date: 2025-11-07EAST CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510980673.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-16
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies lack efficient methods for screening and validating salt tolerance-related SNP sites in mud crabs, resulting in high breeding costs, data redundancy, and difficulty in meeting the needs of precision breeding.

Method used

By screening specific SNP sites (A13938G, T13981C, A18286G, C18336T) in the CA gene of mud crab, primer sets were designed for PCR amplification and sequencing to identify genotypes associated with salt tolerance traits, providing support for molecular-assisted breeding.

Benefits of technology

Clearly identifying the SNP loci genotypes of salt tolerance in mud crabs provides valuable breeding information and significantly improves the identification efficiency and breeding accuracy of salt tolerance traits in mud crabs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905391A_ABST
    Figure CN120905391A_ABST
Patent Text Reader

Abstract

The invention discloses a reagent for detecting SNP (Single Nucleotide Polymorphism) locus genotypes of salt-tolerant related traits of scylla paramamosain and application of the reagent. The invention provides a reagent for detecting SNP (Single Nucleotide Polymorphism) sites in a scylla paramamosain genome. The SNP sites comprise an SNP site 1, an SNP site 2, an SNP site 3 and an SNP site 4; the SNP site 1 is located at the 13938th basic group of the CA gene, the SNP site 2 is located at the 13981th basic group of the CA gene, the SNP site 3 is located at the 18286th basic group of the CA gene, and the SNP site 4 is located at the 18336th basic group of the CA gene. According to the invention, the single nucleotide polymorphism (SNP) of the salt tolerance related characters of the scylla paramamosain character is screened, the SNP is identified through sequencing, the peak map is clear, the typing is reliable, the salt tolerance related characters of the scylla paramamosain character are effectively determined, and valuable information is provided for breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the fields of molecular biology and aquatic genetic breeding technology, and in particular, to a reagent for detecting the SNP site genotype of a salt-tolerant trait of Scylla paramamosain and an application thereof. BACKGROUND

[0002] Scylla paramamosain belongs to the genus Scylla of the Portunidae family of crustaceans, and is widely distributed in the warm, subtropical and tropical sea areas of the Pacific and Indian Oceans. It is listed as a euryhaline species and can adapt to a wide range of salinity levels. This species can survive in marine environments with salinity concentrations between 3 ppt and 55 ppt, and has strong osmotic regulation ability. In actual production applications, due to frequent changes in salinity, some Scylla paramamosain exhibit poor adaptability, affecting the yield and economic benefits of aquaculture. Therefore, improving the salt tolerance of Scylla paramamosain has become an important goal of aquatic breeding. Studies have shown that in crustaceans, especially in gill tissue, CA (carbonic anhydrase) genes are considered to be key regulatory factors in response to salinity stress, and are important functional genes for regulating the salinity adaptability of crustaceans.

[0003] Currently, traditional breeding methods mainly rely on phenotypic selection, and the breeding cycle is long and the efficiency is low. With the development of molecular biology technology, SNPs may be directly related to specific traits (such as growth rate, disease resistance, reproductive capacity, salt tolerance, etc.). By screening SNPs of specific genes, the molecular regulation mechanism of these traits can be revealed. These studies not only provide genetic explanations for the survival and reproduction of shrimps and crabs in different salinity environments, but also provide a theoretical basis for resource protection and aquaculture. Not only can the genetic mechanisms of important biological processes be analyzed in depth, but also key technical support can be provided for precision breeding, stress-resistant variety breeding, and germplasm resource protection in aquaculture.

[0004] Although some studies have reported the relationship between some functional genes of Scylla paramamosain and salinity adaptation, there is a lack of a high-efficiency SNP site screening and verification method suitable for target functional genes. In particular, in small-scale samples and specific functional gene studies, the existing methods have problems such as high cost, data redundancy, and difficulty in verification, which cannot meet the needs of precision breeding. Therefore, developing a stable, reliable, and suitable SNP screening and verification process for Scylla paramamosain, and identifying key sites related to low-salt tolerance traits, will provide important technical support for molecular breeding and germplasm resource screening, and have important significance for the molecular genetic research and good strain selection of Scylla paramamosain. SUMMARY

[0005] The purpose of the present application is to overcome the above-mentioned deficiencies of the prior art, and to provide a reagent for detecting the SNP site genotype of a salt-tolerant trait of Scylla paramamosain and an application thereof.

[0006] The application focuses on the gene region of interest by screening and verifying SNP sites of specific functional CA genes, finds the SNP sites possibly related to the function of the genes in a targeted manner, avoids blindness and interference of a large amount of irrelevant data when large-scale screening is performed in the whole genome, screens the candidate SNP sites related to salt tolerance, and is convenient for subsequent molecular assisted breeding.

[0007] The first object of the application is to provide a reagent for detecting SNP sites in the genome of Scylla paramamosain.

[0008] The second object of the application is to provide application of the reagent in identifying salt tolerance related traits of Scylla paramamosain.

[0009] The third object of the application is to provide application of the reagent in breeding of Scylla paramamosain.

[0010] The fourth object of the application is to provide application of the reagent in preparation of a kit for identifying salt tolerance related traits of Scylla paramamosain.

[0011] The fifth object of the application is to provide a method for identifying salt tolerance related traits of Scylla paramamosain.

[0012] The sixth object of the application is to provide a kit for identifying salt tolerance related traits of Scylla paramamosain.

[0013] The seventh object of the application is to provide a molecular assisted breeding method of Scylla paramamosain.

[0014] In order to achieve the above objects, the application is realized by the following scheme:

[0015] A reagent for detecting SNP sites in the genome of Scylla paramamosain, wherein the SNP sites include SNP site 1, SNP site 2, SNP site 3 and SNP site 4.

[0016] The SNP site 1 is located at the 13938th base of the CA gene,

[0017] The SNP site 2 is located at the 13981th base of the CA gene,

[0018] The SNP site 3 is located at the 18286th base of the CA gene,

[0019] The SNP site 4 is located at the 18336th base of the CA gene,

[0020] The CA gene has a number of NCBI as NC_087187.1.

[0021] Further, the reagent includes a primer set,

[0022] The nucleotide sequences of the primer set for detecting the SNP site 1 are shown as SEQ ID NO: 1 and 2,

[0023] The nucleotide sequences of the primer set for detecting the SNP site 2 are shown as SEQ ID NO: 4 and 5,

[0024] The nucleotide sequences of the primer set for detecting the SNP site 3 are shown as SEQ ID NO: 7 and 8,

[0025] The nucleotide sequences of the primer set for detecting the SNP site 4 are shown as SEQ ID NO: 10 and 11.

[0026] The reagent is applied to identifying salt-tolerant related traits of Scylla paramamosain.

[0027] The reagent is applied to Scylla paramamosain breeding.

[0028] The reagent is applied to preparing a kit for identifying salt-tolerant related traits of Scylla paramamosain.

[0029] A method for identifying salt-tolerant related traits of Scylla paramamosain, detecting the genotypes of SNP sites of the Scylla paramamosain to be tested, wherein the SNP sites include SNP site 1, SNP site 2, SNP site 3 and SNP site 4;

[0030] The SNP site 1 is located at the 13938th base of the CA gene,

[0031] The SNP site 2 is located at the 13981st base of the CA gene,

[0032] The SNP site 3 is located at the 18286th base of the CA gene,

[0033] The SNP site 4 is located at the 18336th base of the CA gene,

[0034] The CA gene has a NCBI number of NC_087187.1;

[0035] The salt tolerance of the Scylla paramamosain individual of the sample with the SNP site 1 genotype of AG and GG is significantly higher than that of the Scylla paramamosain individual with the genotype of AA,

[0036] The salt tolerance of the Scylla paramamosain individual of the sample with the SNP site 2 genotype of CT and CC is significantly higher than that of the Scylla paramamosain individual with the genotype of TT,

[0037] The salt tolerance of the Scylla paramamosain individual of the sample with the SNP site 3 genotype of AG is significantly higher than that of the Scylla paramamosain individual with the genotype of AA,

[0038] The salt tolerance of the individual of the sample with the SNP site 4 genotype of CT and TT is significantly higher than that of the individual of the crab with the genotype of CC.

[0039] Further, the reagent is used for detection.

[0040] A kit for identifying the salt tolerance related traits of Scylla paramamosain, wherein the kit contains the reagent.

[0041] Further, the kit further contains double distilled water.

[0042] A molecular assisted breeding method of Scylla paramamosain, wherein the genotype of the SNP site of the to-be-tested Scylla paramamosain is detected, and the SNP site comprises SNP site 1, SNP site 2, SNP site 3 and SNP site 4.

[0043] The SNP site 1 is located at the 13938th base of the CA gene,

[0044] The SNP site 2 is located at the 13981th base of the CA gene,

[0045] The SNP site 3 is located at the 18286th base of the CA gene,

[0046] The SNP site 4 is located at the 18336th base of the CA gene,

[0047] The CA gene is numbered as NC_087187.1 in NCBI.

[0048] The salt tolerance of the individual of the sample with the SNP site 1 genotype of AG and GG is significantly higher than that of the individual of the crab with the genotype of AA,

[0049] The salt tolerance of the individual of the sample with the SNP site 2 genotype of CT and CC is significantly higher than that of the individual of the crab with the genotype of TT,

[0050] The salt tolerance of the individual of the sample with the SNP site 3 genotype of AG is significantly higher than that of the individual of the crab with the genotype of AA,

[0051] The salt tolerance of the individual of the sample with the SNP site 4 genotype of CT and TT is significantly higher than that of the individual of the crab with the genotype of CC.

[0052] Compared with the prior art, the present application has the following beneficial effects:

[0053] The application screens single nucleotide polymorphism sites (SNP) related to the salt tolerance of Scylla paramamosain, the SNP sites are located at bases 13938, 13981, 18286 and 18336 of the CA gene of Scylla paramamosain, and are respectively named A13938G (SNP site 1), T13981C (SNP site 2), A18286G (SNP site 3) and C18336T (SNP site 4), the CA gene is numbered as NC_087187.1 in NCBI, wherein the salt tolerance of the Scylla paramamosain individuals of the samples with genotypes AG and GG of the SNP site 1 and 3 is significantly higher than that of the Scylla paramamosain individuals with genotype AA; the salt tolerance of the Scylla paramamosain individuals of the samples with genotypes CT and CC of the SNP site 2 is significantly higher than that of the Scylla paramamosain individuals with genotype TT; the salt tolerance of the Scylla paramamosain individuals of the samples with genotype AG of the SNP site 3 is significantly higher than that of the Scylla paramamosain individuals with genotype AA; and the salt tolerance of the Scylla paramamosain individuals of the samples with genotypes CT and TT of the SNP site 4 is significantly higher than that of the samples with genotype CC. The genotypes of the SNP sites 1-4 are identified by direct sequencing, the peak diagram is clear, the typing is reliable, the salt tolerance related traits of the to-be-tested Scylla paramamosain are effectively determined, and valuable information is provided for breeding. BRIEF DESCRIPTION OF DRAWINGS

[0054] Figure 1 It is a gel electrophoresis diagram for detecting the integrity of genomic DNA.

[0055] Figure 2 It is a sequence peak diagram of the site when the mutation site appears. Wherein, A is A13928G site; B is T13981C site; C is A18286G site; D is C18336T site.

[0056] Figure 3 It is a schematic peak diagram for verifying the genotyping of the candidate A13938G SNP site.

[0057] Figure 4 It is a schematic peak diagram for verifying the genotyping of the candidate T13981C SNP site.

[0058] Figure 5 It is a schematic peak diagram for verifying the genotyping of the candidate A18286G SNP site.

[0059] Figure 6 It is a schematic peak diagram for verifying the genotyping of the candidate C18336T SNP site. DETAILED DESCRIPTION

[0060] The application will be further described in detail below with reference to the accompanying drawings and specific embodiments, which are only used to explain the application and not to limit the scope of the application. The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0061] Example 1

[0062] I. Genomic DNA extraction

[0063] Eight wild mud crabs from each of four different geographical populations in Sanmen, Zhejiang, Guangzhou, Guangdong, Shenzhen, Guangdong, and Fuzhou, Fujian were used as samples for SNP site screening of CA genes. Thirty mg of wild mud crab muscle samples soaked in anhydrous ethanol were placed in a clean 1.5 mL centrifuge tube, 200 μL of lysis buffer (Beijing Quanshi Gold Biology, EE151) was added, shaken for 10 s, incubated at room temperature for 2 min, then 20 μL of proteinase K was added, shaken thoroughly to mix, and then the sample was completely immersed in the solution to obtain a well-mixed sample. The water bath was preheated to 55°C, the well-mixed sample was placed in the water bath for incubation, and was shaken evenly every 20 min during the incubation until complete lysis, the solution became clear and transparent, and if necessary, steel balls could be added to aid sample lysis in a homogenizer; after complete lysis of the sample tissue, 360 μL of binding buffer (EE151) was added (anhydrous ethanol was added before use to mix), and then the sample was transferred to a clean centrifuge column using a pipette, centrifuged at 12000 rpm for 30 s, and the flow-through was discarded; 500 μL of clean buffer (Beijing Quanshi Gold Biology, EE151) was added to the centrifuge column (anhydrous ethanol was added before use to mix), centrifuged at 12000 rpm for 30 s, the flow-through was discarded, and this step was repeated once; 500 μL of wash buffer (Beijing Quanshi Gold Biology, EE151) was added to the centrifuge column (anhydrous ethanol was added before use to mix), centrifuged at 12000 rpm for 30 s, the flow-through was discarded, and this step was repeated once; the centrifuge column was centrifuged at 12000 rpm for 2 min to completely remove the residual clean buffer; the centrifuge column was placed in a clean centrifuge tube, 50-200 μL of elution buffer (50 μL, 100 μL, 150 μL, 200 μL) was added to the center of the centrifuge column, and the sample was allowed to stand at room temperature for 2 min, then centrifuged at 12000 rpm for 1 min to elute the DNA; if more genomic DNA was desired, the sample could be eluted again by repeating this step. The DNA integrity was detected by 1% agarose gel electrophoresis, and the DNA concentration was measured using a microspectrophotometer.

[0064] II. PCR amplification

[0065] Primers were designed according to the partial genomic sequence of Scylla paramamosain (NCBI genome sequence number: NC_087187.1) to screen SNP sites by PCR amplification. The reaction system of PCR amplification was 25 μL: ddH2O 9.5 μL, PCRSuperMix (Beijing Zomanbio, AS111-11) 12.5 μL, DNA template 1 μL, each primer 1 μL, and the concentration of each primer was 10 μmol / L. The PCR amplification procedure was as follows: 94-95 ℃ pre-denaturation for 5 min, then 94 ℃ pre-denaturation for 40 s, 52-54 ℃ annealing for 40 s, 72 ℃ extension for 40 s, 35 cycles, and finally 72 ℃ extension for 5 min.

[0066] According to the existing literature or database, the carbonic anhydrase (CA) gene related to salinity of Scylla paramamosain was selected, and the primers were designed by Primer Premier or NCBI Primer-BLAST. The length of the primer was about 20 bp, and the length of the product was 300-600 bp. The following is the primer sequence information for screening SNP sites:

[0067] Sp-CA-F1: 5'-CCCAACGGACTTTCAATAGTGTG-3',

[0068] Sp-CA-R1: 5'-GGTTCGGTAATAACTTCTTGGC-3';

[0069] Sp-CA-F2: 5'-GGCCAGCTATGTACCCTGTG-3',

[0070] Sp-CA-R2: 5'-GCCATCTATTGTGTGCTCGGA-3';

[0071] Sp-CA-F3: 5'-CTCTGGGTGATGACGAGTACG-3',

[0072] Sp-CA-R3: 5'-GCCTCGGCAAAGCTTGAAAAC-3';

[0073] Sp-CA-F4: 5'-AGCTTCACCTGGTACATTGGA-3',

[0074] Sp-CA-R4: 5'-GGGTAGGAAGGTCTCAGGGT-3';

[0075] Sp-CA-F5: 5'-AGGAGACTCAAGTCGTACCA-3',

[0076] Sp-CA-R5: 5'-TGCTTCATTCTTCCTTTCCT-3';

[0077] Sp-CA-F6: 5'-GCCAGCTATGTACCCTGTG-3',

[0078] Sp-CA-R6: 5'-CCAACTTGCGCCTTCCAT-3'.

[0079] III. PCR product sequencing

[0080] The amplified product was subjected to agarose gel electrophoresis (FIG. 2), and after ensuring that the product was amplified, it was sent to a biological company for sequencing. Figure 1

[0081] Example 2 Screening of candidate SNP sites

[0082] The sequencing results of Example 1 were placed in the sequencher software for data quality control, and sequences with a quality of less than 60% were deleted, and then the sequences were trimmed at the beginning and end. If too much trimming was performed, a portion of the bases could be restored, which could expand the alignment range of the aligned sequences. The reference genome sequence of the target functional gene was downloaded on NCBI, imported into the sequencher software, and labeled as "Reference sequence". Then the sequence was assembled, and after assembly, the sequence could be viewed to determine whether a double peak or a pure mutation occurred. Generally, the height of the secondary peak should be greater than or equal to one-third of the height of the primary peak to determine that the site is reliable. In addition, the CDS region of the intron and exon could be determined according to the genomic sequence, which could more clearly determine the position of the mutation site. After identifying the candidate sites, it could be determined whether the site was a synonymous mutation or a non-synonymous mutation according to whether the coding amino acid changed before and after the mutation. A total of 56 candidate SNP sites were screened on the CA gene, two of which were located on the coding region exon. Since the two sites were located at the 18286th base and the 18336th base of the CA genomic sequence, respectively, the two sites were named A18286G and C18336T, respectively. Two high-quality sites were selected on the intron. Since the two sites were located at the 13938th base and the 13981st base of the CA genomic sequence, respectively, the two sites were named A13938G and T13981C, respectively.

[0083] Table 1

[0084]

[0085] Example 3 Verification of candidate sites​

[0086] Among the candidate SNP sites, the sites with better quality are selected for typing verification. In general, the sites with high mutation frequency, clear peak, and no impurity peak or cross peak are relatively better in quality, and the sites can be selected for subsequent verification. A primer of about 20 bp is designed before and after the candidate site for typing verification of the site. PCR amplification and sequencing are performed according to the same method as in Example 2 to obtain the amplification product.

[0087] The primers of the A13938G site are F1: 5'-CCCAACGGACTTTCAATAGTGT-3' (SEQ ID NO: 1) and R1: 5'-ATGCGTAGTGGTGGATGACA-3' (SEQ ID NO: 2). The nucleotide sequence of the obtained amplification product 1 is 5'-CAGCCGTGATAACCTGACCAATCATCGCTGTGGCCTTTGCAAATAGTTTGAGTGATAGAAGGCAGCGTTTCACTACACTGGCCGTGGTAACTGAGGCCACTTCTGTCATCCACACTACGAAATA-3' (SEQ ID NO: 3), and the A13938G site is located at the 52nd base of the amplification product 1.

[0088] The primers of the T13981C site are F2: 5'-AGGGATGCGTTTAAGGATTCTG-3' (SEQ ID NO: 4) and R2: 5'-AAATGTCTCTGGAGTCACGAAA-3' (SEQ ID NO: 5). The nucleotide sequence of the obtained amplification product 2 is 5'-ACAAGGATTCTGCAGTTTAACAGGCTGTAGTGGAAGTTATGACGGTTTTCAAGGGTGTTTTCGTGACTCCAGAGACAGTTTAACAAGAATT-3' (SEQ ID NO: 6), and the T13981C site is located at the 43rd base of the amplification product 2.

[0089] The primers for the A18286G site are F3: 5'-ACACTTCCATCCCTCTCTTCC-3' (SEQ ID NO: 7), R3: 5'-AGACACTCACTCGACCTGC-3' (SEQ ID NO: 8); the nucleotide sequence of the obtained amplification product 3 is 5'-CTGTACCCTGTGGCGGGCGGCAGCAAGCAGTCCCCCATTGACATCAAG AGGACAGGCTGCCCTTTGGATCCCAGGCTGAGCAAGATGCAAGCTGCGTATGCGG ACATCAAGGTCTCTGAGCTCTCCAACAACGGACACTCATGGAAGGCGCAAGTTGGCAGCGGCAGGTCAGTGAGTGTCTTGAGA-3' (SEQ ID NO: 9), and the A18286G site is located at the 112th base of the amplification product 3.

[0090] The primers for the C18336T site are F4: 5'-GATCCCAGGCTGAGCAAGAT-3' (SEQ ID NO: 10), R4: 5'-AAACACACAGCCCAACAGAAG-3' (SEQ ID NO: 11); the nucleotide sequence of the obtained amplification product 4 is 5'-TCGCGAGCAGATGCAGCTGCGTATGCGGACATCAAGATCTCTGAG CTCTCCAACAACGGACACTCATGGAAGGCGCAAGTTGGCAGTGGCAGGTCGAGTGAG TGTCTAAGTGTTGTTTGTGTGA-3' (SEQ ID NO: 12), and the C18336T site is located at the 87th base of the amplification product 4.

[0091] The candidate sites are typed, and the standard for considering a site to be typed successfully is that at the candidate site, there are at least two genotypes, and the sequencing peak map is clear, without mixed peaks or cross peaks. 300 healthy and uniform-sized first-stage Scylla paramamosain crabs are selected, and three parallel groups are set up, with 100 crabs in each group. Under the condition of 20 ppt, the crabs are temporarily raised for 3 days, sufficient oxygen is maintained during the temporary raising period, normal feeding is performed, and dead individuals and residual bait are timely fished out to avoid affecting the water quality. After the temporary raising period, the salinity is suddenly reduced to 2 ppt, and acute stress is applied for 48 h. The first part of the individuals that die first are the low-salt-intolerant group, and the last part of the individuals that die last are the low-salt-tolerant group. Sampling is performed every 4 h for 12 h before the experiment, and sampling is performed every 8 h after 12 h. After the stress ends, 40 individuals are selected from each group to extract genomic DNA using a genomic marine organism genomic DNA extraction kit, and the extracted genomic DNA is amplified and sequenced using the primers and PCR method designed in Example 3 to perform typing verification.

[0092] According to the typing results, Figure 3 、 Figure 4 、 Figure 5 and Figure 6 , AA and AG genotypes exist at the A18286G site, and three genotypes exist at the other three sites. Through chi-square test, the mutant gene frequency of the four sites is significantly different between the low-salt-tolerant group and the low-salt-intolerant group (p<0.05). To further compare the genetic diversity of the CA gene mutation sites in different groups, polymorphism analysis is performed on the four sites in the low-salt-intolerant group and the low-salt-tolerant group. The results show that the observed heterozygosity (Ho), expected heterozygosity (He), effective allele number (Ne), and polymorphic information content (PIC) of each site in the low-salt-tolerant group are higher than those in the low-salt-intolerant group as a whole. In addition, compared with the low-salt-intolerant group, the polymorphism of the A18286G and A13938G sites is significantly increased in the low-salt-tolerant group, indicating that heterozygous mutations may be more widespread in the low-salt-tolerant group. The above results show that the A13938G, T13981C, A18286G, and C18336T sites have certain differentiation characteristics in the salt-tolerant trait population and can be used as candidate molecular markers related to the low-salt-tolerant trait, thereby providing technical support for molecular-assisted breeding of salt-tolerant traits in Scylla paramamosain.

[0093] Example 4: A kit for evaluating salt-tolerant related traits of Scylla paramamosain

[0094] I. Composition

[0095] Primer (Primer Pair 1) having a nucleotide sequence as set forth in SEQ ID NO: 1-2, primer (Primer Pair 2) having a nucleotide sequence as set forth in SEQ ID NO: 4-5, primer (Primer Pair 3) having a nucleotide sequence as set forth in SEQ ID NO: 7-8, primer (Primer Pair 4) having a nucleotide sequence as set forth in SEQ ID NO: 10-11, and ddH2O.

[0096] II. Use method

[0097] The genomic DNA of the mud crab to be tested is used as a template for PCR amplification.

[0098] The total reaction system of PCR amplification is 25 μL: ddH2O 9.5 μL, PCR SuperMix (Beijing Quanshi Gold Biology, AS111-11) 12.5 μL, DNA template 1 μL, each primer 1 μL, and each primer concentration is 10 μmol / L.

[0099] The PCR amplification program is as follows: 94-95 ℃ pre-denaturation for 5 min, then 94 ℃ pre-denaturation for 40 s, 52-54 ℃ annealing for 40 s, 72 ℃ extension for 40 s, 35 cycles, and finally 72 ℃ extension for 5 min.

[0100] After the PCR product is detected and confirmed to be correct by agarose gel electrophoresis, sequencing is performed.

[0101] III. Determination method

[0102] The nucleotide sequence of the amplification product (amplification product 1) of primer pair 1 is as set forth in SEQ ID NO: 3, SNP site 1 is located at the 52nd base of the amplification product 1 (i.e., the 13938th base site of the CA gene, NC_087187.1), and the salt tolerance of the individual of the mud crab of the sample with genotypes AG and GG is significantly higher than that of the individual of the mud crab with genotype AA.

[0103] The nucleotide sequence of the amplification product (amplification product 2) of primer pair 2 is as set forth in SEQ ID NO: 6, SNP site 2 is located at the 43rd base of the amplification product 2 (i.e., the 13981st base site of the CA gene, NC_087187.1), and the salt tolerance of the individual of the mud crab of the sample with genotypes CT and CC is significantly higher than that of the individual of the mud crab with genotype TT.

[0104] The nucleotide sequence of the amplification product (amplification product 3) of primer pair 3 is shown as SEQ ID NO: 9, and the SNP site 3 is located at the 112th base of the amplification product (i.e. the 18286th base site of the CA gene, NC_087187.1), and the salt tolerance of the individual of Scylla paramamosain of the sample with genotype AG is significantly higher than that of the individual of Scylla paramamosain with genotype AA.

[0105] The nucleotide sequence of the amplification product (amplification product 4) of primer pair 4 is shown as SEQ ID NO: 12, and the SNP site 4 is located at the 87th base of the amplification product 4 (i.e. the 18336th base site of the CA gene, NC_087187.1), and the salt tolerance of the individual of Scylla paramamosain of the sample with genotype CT and TT is significantly higher than that of the individual of Scylla paramamosain with genotype CC.

[0106] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not intended to limit the scope of protection of the present application. For those skilled in the art, on the basis of the above description and ideas, other different forms of changes or modifications can also be made, and here it is not necessary and also impossible to exhaust all the embodiments. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the claims of the present application.

Claims

1. A reagent for detecting a SNP site in a Scylla paramamosain genome, characterized in that, The SNP sites include SNP site 1, SNP site 2, SNP site 3 and SNP site 4; The SNP site 1 is located at the 13938th base of the CA gene, The SNP site 2 is located at the 13981th base of the CA gene, The SNP site 3 is located at the 18286th base of the CA gene, The SNP site 4 is located at the 18336th base of the CA gene, The CA gene is numbered as NC_087187.1 in NCBI.

2. The agent of claim 1, wherein The reagent includes a primer set, The nucleotide sequences of the primer set for detecting the SNP site 1 are shown as SEQ ID NO: 1 and 2, The nucleotide sequences of the primer set for detecting the SNP site 2 are shown as SEQ ID NO: 4 and 5, The nucleotide sequences of the primer set for detecting the SNP site 3 are shown as SEQ ID NO: 7 and 8, The nucleotide sequences of the primer set for detecting the SNP site 4 are shown as SEQ ID NO: 10 and 11.

3. The reagent of claim 1 or 2 is used for identifying the salt tolerance related traits of Scylla paramamosain.

4. The reagent of claim 1 or 2 is used for Scylla paramamosain breeding.

5. The reagent of claim 1 or 2 is used for preparing a kit for identifying the salt tolerance related traits of Scylla paramamosain.

6. A method for identifying a salt tolerance-related trait in Scylla paramamosain, characterized in that, The genotypes of the SNP sites of the to-be-tested Scylla paramamosain are detected, and the SNP sites include SNP site 1, SNP site 2, SNP site 3 and SNP site 4; The SNP site 1 is located at the 13938th base of the CA gene, The SNP site 2 is located at the 13981th base of the CA gene, The SNP site 3 is located at the 18286th base of the CA gene, The SNP site 4 is located at the 18336th base of the CA gene, The CA gene is numbered as NC_087187.1 in NCBI; The salt tolerance of the Scylla paramamosain individual of the sample with the SNP site 1 genotype of AG and GG is significantly higher than that of the Scylla paramamosain individual with the genotype of AA, The salt tolerance of the Scylla paramamosain individual of the sample with the SNP site 2 genotype of CT and CC is significantly higher than that of the Scylla paramamosain individual with the genotype of TT, The salt tolerance of the Scylla paramamosain individual of the sample with the SNP site 3 genotype of AG is significantly higher than that of the Scylla paramamosain individual with the genotype of AA, The salt tolerance of the Scylla paramamosain individual of the sample with the SNP site 4 genotype of CT and TT is significantly higher than that of the Scylla paramamosain individual with the genotype of CC.

7. The method of claim 6, wherein, The reagent of claim 1 or 2 is used for detection.

8. A kit for identifying salt tolerance related traits in Scylla paramamosain, characterized in that, The kit contains the reagent of claim 1 or 2.

9. The kit of claim 8, wherein The kit also contains double distilled water.

10. A method for molecular-assisted breeding of Scylla paramamosain, characterized in that, The genotypes of the SNP sites of the to-be-tested Scylla paramamosain are detected, and the SNP sites include SNP site 1, SNP site 2, SNP site 3 and SNP site 4; The SNP site 1 is located at the 13938th base of the CA gene, The SNP site 2 is located at the 13981th base of the CA gene, The SNP site 3 is located at the 18286th base of the CA gene, The SNP site 4 is located at the 18336th base of the CA gene, The CA gene is numbered as NC_087187.1 in NCBI; The salt tolerance of the individual of the sample with the SNP site 1 genotype AG and GG is significantly higher than that of the individual of the sample with the SNP site 1 genotype AA, The salt tolerance of the individual of the sample with the SNP site 2 genotype CT and CC is significantly higher than that of the individual of the sample with the SNP site 2 genotype TT, The salt tolerance of the individual of the sample with the SNP site 3 genotype AG is significantly higher than that of the individual of the sample with the SNP site 3 genotype AA, The salt tolerance of the individual of the sample with the SNP site 4 genotype CT and TT is significantly higher than that of the individual of the sample with the SNP site 4 genotype CC.