Cassava low-temperature-resistant MeSR45-2 gene and application thereof

Abstract

The invention provides the cassava low-temperature-resistant MeSR45-2 gene cloned from cassava for the first time, the expression of the MeSR45-2 gene in cassava is inhibited under low-temperature stress, and research shows that the gene can significantly improve the low-temperature resistance of cassava, reduce the malondialdehyde content, proline cumulant and the like in cassava, reduce leaf damage under low-temperature treatment and improve the yield of cassava. Terminal buds under low-temperature treatment are not affected and can normally grow, and expression of various protein genes is regulated and controlled. The invention provides a new candidate gene for research on improvement of plant low temperature resistance and the like, and also provides a new gene resource for cultivation of a new variety of low temperature resistant cassava and construction of a new variety of transgenic cassava.

Description

Technical Field

[0001] This invention belongs to the field of biology, specifically relating to the cassava low-temperature resistant MeSR45-2 gene and its applications. Background Technology

[0002] Cassava (Manihot esculenta) is a globally important food and energy crop. Its storage roots are rich in starch and are a major food source for nearly one billion people in tropical and subtropical regions worldwide. However, fundamental research on cassava yield, quality, stress resistance, and adaptability is severely lagging, resulting in its potential not being fully realized. Due to environmental degradation, reduced arable land, pests and diseases, drought, salinity, and low temperatures, the development of cassava cultivation has been consistently constrained. These factors cause yield losses exceeding 50% annually, leading to a shortage of raw materials for the cassava processing industry. To meet market demand, it is crucial to continue expanding cassava cultivation, improving breeding and planting techniques, conducting fundamental research on cassava's stress adaptation, and cultivating high-yielding, stress-resistant new cassava germplasm. These efforts play an irreplaceable role in meeting the diverse needs of people's lives and improving the economic benefits of cassava cultivation.

[0003] Cassava is highly sensitive to low temperatures and thrives best in areas with an average temperature above 18°C ​​and a frost-free period of at least eight months per year. Its growth and development begin to be inhibited when temperatures drop below 15°C, and below 4°C, apical growth is suppressed, plants wilt, and stems die. Low-temperature stress after tuber formation restricts tuber enlargement and starch accumulation, leading to reduced yield. In recent years, although cassava has been introduced and tested in Yunnan, Guizhou, Fujian, Jiangxi, Shandong, and other regions, the lack of cold-resistant varieties and the difficulty in expanding the planting area due to the impact of low temperatures have severely hampered the economic benefits of cassava cultivation. Therefore, conducting basic research on cold-resistant breeding to cultivate cold-resistant cassava varieties, enabling the northward expansion of cassava cultivation, and meeting the demand for cassava raw materials are urgent needs for the development of the cassava industry. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a cassava low-temperature resistant MeSR45-2 gene and its application.

[0005] The first aspect of the present invention is to provide a cassava low-temperature resistant MeSR45-2 gene, the CDS sequence of which is shown in SEQ ID NO:1.

[0006] A second aspect of the present invention is to provide a protein encoded by the cassava low-temperature resistant MeSR45-2 gene described in the first aspect of the present invention.

[0007] A third aspect of the present invention is to provide a recombinant vector containing the cassava low-temperature tolerance MeSR45-2 gene as described in the first aspect of the present invention.

[0008] The original vector for the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus or plasmid. This invention does not limit this. In one specific embodiment of this invention, the original vector is the pCambia1301 vector, etc., but it should be understood that other plasmids or viruses can also be used.

[0009] Preferably, the original vector of the recombinant vector is the pCambia1301 vector, and the cassava cold-resistant MeSR45-2 gene is ligated into the pCambia1301 vector by Sma 1 single enzyme digestion. The 5' end of the pCambia1301 vector contains the CaMV35S promoter and EGFP sequence, and the 3' end contains the Nos terminator.

[0010] A fourth aspect of the invention is to provide a host bacterium containing the cassava low-temperature resistant MeSR45-2 gene described in the first aspect.

[0011] The fifth aspect of the present invention is to provide an expression cassette containing the cassava low-temperature tolerance MeSR45-2 gene as described in the first aspect of the present invention.

[0012] The sixth aspect of the present invention is to provide the use of the cassava low-temperature tolerance MeSR45-2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassava as described in the fifth aspect of the present invention in improving the low-temperature tolerance of cassava and / or reducing the malondialdehyde content of cassava and / or increasing the proline accumulation of cassava.

[0013] The seventh aspect of the present invention is to provide the use of the cassava low-temperature tolerance MeSR45-2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving the low-temperature tolerance of cassava apical buds.

[0014] The eighth aspect of the present invention is to provide the application of the cassava low-temperature tolerance MeSR45-2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving the low-temperature tolerance of cassava leaves.

[0015] After low-temperature treatment, the terminal buds of WT plants softened and the leaves drooped, while the terminal buds of cassava plants that overexpressed the MeSR45-2 gene were not affected, and only some leaves wilted. Based on this, the transgenic lines and ordinary lines can be preliminarily distinguished.

[0016] The ninth aspect of the present invention is to provide the use of the cassava cold-resistant MeSR45-2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in the breeding of cold-resistant cassava varieties and / or the preparation of transgenic cassava.

[0017] The tenth aspect of the present invention is to provide the use of the cassava low-temperature resistant MeSR45-2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in interaction with the MeSPL13a gene, the MeTCP15b gene and / or the MeSR34b gene.

[0018] The eleventh aspect of the present invention is to provide a primer pair, wherein the primer pair is a MeSR45-2 cloning primer Sense Primer: CGGGATCCTATGAGTAGCCGCGCGAGCAGAA and a MeSR45-2 cloning primer Antisense Primer: ACGCGTCGACTCACCGGGATAAGCTCCTGCTC.

[0019] This invention provides the first cloned MeSR45-2 gene from cassava to enhance its cold tolerance. Under low-temperature stress, MeSR45-2 gene expression in cassava is suppressed. Studies show that this gene significantly improves cassava's cold tolerance, reduces malondialdehyde (MDA) content and proline accumulation, minimizes leaf damage under low-temperature treatment, and ensures that the terminal bud remains unaffected and continues to grow normally. It also regulates the expression of multiple protein genes. This invention provides a new candidate gene for improving plant cold tolerance and other related research, and also offers new gene resources for the breeding of new cold-tolerant cassava varieties and the construction of transgenic cassava varieties. Attached Figure Description

[0020] Figure 1 Expression analysis of the MeSR45-2 gene in different tissue sites and at low temperature.

[0021] Figure 2 Subcellular localization analysis of MeSR45-2.

[0022] Figure 3Identification and phenotypic analysis of cassava MeSR45-2 highly expressed lines.

[0023] Figure 4 Phenotypic analysis and stress resistance analysis of cassava MeSR45-2 highly expressed lines.

[0024] Figure 5 To identify and validate downstream genes regulated by MeSR45-2. Detailed Implementation

[0025] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0026] Example 1: Cloning of the MeSR45-2 gene for low-temperature tolerance in cassava

[0027] After extracting RNA from cassava leaves, cDNA was obtained by reverse transcription using the TaKaRa PrimeScript II 1st Strand cDNA Synthesis Kit. The cDNA was then used as a template for PCR cloning of the MeSR45-2 gene.

[0028] Reverse transcription reaction system:

[0029] reagents volume Oligo dT Primer 1 μL Random 6 mers 1 μL DNTP Mixture 1 μL RNA 3 μg <![CDATA[RNase Free ddH2O]]> Make up to 10 μL

[0030] Reverse transcription reaction procedure:

[0031] temperature time 30℃ 10 min 42℃ 1 h 70℃ 15 min 4℃ ∞

[0032] MeSR45-2 cloning primer Sense Primer: TCCcccgggATGGTGAAGCCAAAGCGAGG (containing Sma 1 site); MeSR45-2 cloning primer Antisense Primer: TCCcccgggCTATGATTTACGAGGTGGTGAGC (containing Sma 1 site).

[0033] The PCR amplification system is shown in Table 1, and the PCR reaction procedure is shown in Table 2. After PCR amplification, agarose gel electrophoresis is required to detect the PCR products, and the gene amplification status is determined according to Marker D2000. The correctly detected PCR products are then used to recover the amplified DNA using an agarose gel purification kit. The purification steps are as described in the Beijing Adley Agarose Gel Purification Kit (DR01). Sequencing is performed to obtain the CDS sequence of the cassava MeSR45-2 gene, as shown in SEQ ID NO:1.

[0034] Table 1 PCR amplification system

[0035] Components volume Sense Primer (10µM) 1.0 μL Antisense Primer (10µM) 1.0 μL Cassava leaf cDNA 1.0 μL 2×PrimerSTAR Max DNA Polymerase 25 μL <![CDATA[ddH2O]]> 23 μL Total 50 μL

[0036] Table 2 PCR reaction procedure

[0037]

[0038] Example 2: Expression analysis of cassava MeSR45-2 gene in different tissues and under low temperature conditions

[0039] Analysis of the MeSR45-2 gene in cassava at different tissue sites using qRT-PCR revealed that it was preferentially expressed in cassava leaves and terminal buds, while the expression level of MeSR45-2 was lowest in stems. Figure 1 A). The primers are: Forward primer: GTTCGCCGCCTTCCGGTTCTGG and Reverse primer: GCAGGTCTGGAGAACGACCTCG.

[0040] qRT-PCR method: Using reverse-transcribed cDNA as a template, PCR amplification was performed according to the designed quantitative primers (Table 3). The reaction program was: 95℃ for 10s, 55℃ for 5s, 72℃ for 15s, 40 cycles, with each sample repeated 3 times. 一△△Ct The method processes the data, and Microsoft Excel analyzes the output and creates charts.

[0041] Table 3 Reaction System

[0042] Component Volume TB Green Premix Ex Taq II 10 μL ROX Reference Dye 0.4 μL Template 1 μL Forward primer 0.8 μL Reverse primerddH2OTotal 0.8 μL 7.0 μL 20 μL

[0043] Cassava seedlings were treated with low temperature (5-week-old tissue culture seedlings were placed in a 4℃ light incubator for 24 hours), and RNA was extracted from young leaves and terminal buds for qRT-PCR (using the same method as above) to study the response of the MeSR45-2 gene to stress. The results showed that low temperature inhibited its expression (…). Figure 1 B).

[0044] Example 3: Construction of plant overexpression vectors

[0045] The amplification product from Example 1 was ligated into the pCambia1301 vector using Sma 1 single enzyme digestion. The 5' end contains the CaMV35S promoter and EGFP sequence, and the 3' end contains the Nos terminator. The final vector constructed was 1301-35S::GFP-MeSR45-2.

[0046] Example 4: Subcellular localization analysis of MeSR45-2

[0047] The pCambia1301-35S::EGFP-MeSR45-2 plasmid was transferred into Agrobacterium GV3101 competent cells using a heat shock method (i.e., 100 μL of competent Agrobacterium cells were placed in a pre-chilled centrifuge tube, 0.1-1 μg of plasmid DNA was added, the centrifuge tube was quickly placed in liquid nitrogen for 5 minutes, the centrifuge tube was quickly removed from the liquid nitrogen and immediately placed in a 37°C water bath for 5 minutes, and then spread on a culture medium). The Agrobacterium was spread on solid YEP medium supplemented with kanamycin and rifampin antibiotics. After colonies grew, PCR identification was performed. PCR-positive colonies were shaken and stored for subsequent plant infection.

[0048] Agrobacterium bacterial culture containing pCambia1301-35S::EGFP-MeSR45-2 plasmid was centrifuged and resuspended to an appropriate concentration (OD) in infiltration buffer containing acetylsuccinone and magnesium salt. 600 ≈ 0.5-1.0), after static induction at room temperature, the bacterial solution was injected into the underside of healthy tobacco leaves using a syringe (without a needle) to allow the leaves to be saturated with the bacterial solution. The plants were then cultured normally for 2-5 days for subcellular localization observation. Injection into the lower epidermal leaves of tobacco via transient transformation and observation using confocal fluorescence microscopy revealed that the MeSR45-2 protein was localized in the cell nucleus ( ). Figure 2 ).

[0049] Example 5: MeSR45-2 overexpression lines enhanced low-temperature tolerance.

[0050] The pCambia1301-35S::EGFP-MeSR45-2 plasmid was transferred into Agrobacterium GV3101 competent cells using a heat shock method (i.e., 100 μL of competent Agrobacterium cells were placed in a pre-chilled centrifuge tube, 0.1-1 μg of plasmid DNA was added, the centrifuge tube was quickly placed in liquid nitrogen for 5 minutes, the centrifuge tube was quickly removed from the liquid nitrogen and immediately placed in a 37°C water bath for 5 minutes for heat shock). Agrobacterium cells were then spread on solid YEP medium supplemented with kanamycin and rifampicin antibiotics. After colonies grew, PCR identification was performed. PCR-positive colonies were shaken and preserved for subsequent plant infection.

[0051] Embryogenic fragile callus from cassava cultivar cv.60444 was used as recipient material. Agrobacterium tumefaciens containing the pCambia1301-35S::EGFP-MeSR45-2 plasmid with an OD of approximately 1.0 was collected by centrifugation, washed twice with MS antibiotic-free medium, and resuspended in an equal volume of MS medium supplemented with 100 mmol / L acetylsyringone. A small amount of embryogenic fragile callus was added and suspended at room temperature for 40 min. After centrifugation, the bacterial suspension was removed, and the callus cells were placed on MS solid medium supplemented with 100 mmol / L acetylsyringone and cultured in the dark at 22°C for 3 days. After repeatedly washing the callus cells with sterile water, the callus cells were placed on GD solid medium supplemented with 500 mg / L carbenicillin and 5 mg / L hygromycin and cultured at 26°C under light for 2 weeks. Cells that did not successfully transform were eliminated and resistant callus cells were induced. The callus cells were then transferred to embryo induction medium supplemented with 500 mg / L carbenicillin and 5 mg / L hygromycin to obtain resistant transgenic plants.

[0052] like Figure 3 As shown, MeSR45-2 overexpressing plant lines were obtained through genetic transformation of cassava (callus transformation). Figure 3 A), strong GFP fluorescence was observed in both lines. Figure 3 B).

[0053] Transgenic plants were transferred to an outdoor environment for 30 days of growth, and then subjected to low-temperature treatment for 6 days in a light incubator with a temperature of 4℃, a light / dark cycle of 16h / 8h, and a humidity of 70% for ordinary cassava plants of similar growth. Morphological observations and photographs were taken at different time points during treatment, and the contents of malondialdehyde (MDA) and proline were measured at different time points. The results showed that phenotypic differences were observed between WT cassava and MeSR45-2 OE #1 and OE #2 after low-temperature treatment for 6h and 24d. After low-temperature treatment, the terminal bud of WT cassava softened and the leaves drooped, while only some leaves of SR45-2 OE #1 were wilted, and the terminal bud was unaffected, maintaining normal growth. Figure 3C). Physiological tests revealed that the malondialdehyde (MDA) content in the transgenic lines was significantly lower than that in the wild-type lines. Figure 3 D), while the accumulation of proline was significantly higher than that of the wild type ( Figure 3 E). Transmission electron microscopy observation of leaf cross-sections before and after low-temperature treatment revealed severe damage to the chloroplast membrane structure in wild-type leaf cells after low-temperature treatment. Figure 3 F). These results indicate that overexpression of MeSR45-2 significantly improves the low-temperature tolerance of cassava.

[0054] Example 5: Cassava MeSR45-2 specifically regulates the expression of 2930 protein-coding genes.

[0055] To further investigate key downstream genes and signaling pathways regulated by MeSR45-2, transcriptomic sequencing analysis was performed on WT and MeSR45-2 highly expressive lines. A total of 150G of clean data was obtained. Differential expression analysis of downstream genes was conducted using DEseq. By comparing transgenic lines with the control group, genes with |log2Ratio|≥1 and q<0.05 were selected as differentially expressed downstream genes. We found that a considerable number of protein-coding genes are directly or indirectly regulated by MeSR45-2 (…). Figure 4 KEGG analysis of differentially expressed genes in the MeSR45-OE #1 and MeSR45-OE #2 lines revealed a significant enrichment of genes involved in secondary metabolism. Figure 4 (B) These genes will be the focus of further in-depth research.

[0056] Example 6: Cassava MeSR45-2 protein specifically binds to 262 proteins.

[0057] To systematically identify potential partners interacting with the MeSR45-2 protein, protein immunoprecipitation (IP) was performed on transgenic cassava plants stably expressing the GFP-MeSR45-2 fusion protein. The co-precipitate products were analyzed using high-resolution liquid chromatography-mass spectrometry (LC-MS / MS). Mass spectrometry results successfully identified the MeSR45-2 protein itself and revealed a significantly enriched protein network, including multiple SR protein family members (such as SR34b) related to the pre-mRNA splicing regulatory core, spliceosome core components (such as U1 and U2 snRNP-specific proteins), and various novel interacting factors involved in transcription, RNA processing, and stress responses. In addition, mass spectrometry results also revealed interactions between several transcription factor families (such as TCP and SPL) and MeSR45-2. Figure 5(AB). This result indicates that MeSR45-2, in addition to acting as a splicing regulatory hub to coordinate post-transcriptional gene regulation in cassava, can also interact with transcription factors to regulate gene expression at the transcriptional level. Both bimolecular fluorescence complementation (BFF) and Co-IP assays confirmed the interactions between MeSR45-2 (Manes.06G171800) and MeSPL13a (Manes.12G009000), MeTCP15b (Manes.05G100100), and MeSR34b (Manes.05G062400) (https: / / phytozome-next.jgi.doe.gov / ). Figure 5 CD).

[0058] In crop cultivation and breeding, identifying downstream genes and interacting factors regulated by target genes is of great significance. Its role is threefold: First, it elucidates regulatory networks, revealing the complete molecular pathways through which target genes control cold resistance and yield via cascade reactions. Second, it provides precise breeding guidance. Downstream genes and interacting factors can serve as more direct and stable molecular markers, guiding genetic breeding, accelerating the aggregation of superior alleles, and avoiding the unpredictability of multi-gene regulation. Third, it helps discover new targets. Downstream genes and interacting factors themselves may be key switches regulating traits, serving as new targets for gene editing or transgenic breeding, thereby bypassing the potential negative effects of upstream major genes and achieving more refined trait improvement. In this invention, the study of regulatory genes in cassava using MeSR45-2 provides a theoretical basis and gene resources for the targeted and efficient genetic improvement of cassava's stress resistance traits.

[0059] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. The application of the cassava low-temperature tolerance MeSR45-2 gene, or the protein encoded by the cassava low-temperature tolerance MeSR45-2 gene, or a recombinant vector containing the cassava low-temperature tolerance MeSR45-2 gene, host bacteria, and / or expression cassava in improving the low-temperature tolerance of cassava, and / or reducing the malondialdehyde content of cassava, and / or increasing the proline accumulation of cassava, wherein the CDS sequence of the cassava low-temperature tolerance MeSR45-2 gene is shown in SEQ ID NO:

1.

2. The application of the cassava low-temperature tolerance MeSR45-2 gene, or the protein encoded by the cassava low-temperature tolerance MeSR45-2 gene, or a recombinant vector containing the cassava low-temperature tolerance MeSR45-2 gene, host bacteria, and / or expression cassette in improving the low-temperature tolerance of cassava apical buds, wherein the CDS sequence of the cassava low-temperature tolerance MeSR45-2 gene is shown in SEQ ID NO:

1.

3. The application of the cassava low-temperature tolerance MeSR45-2 gene, or the protein encoded by the cassava low-temperature tolerance MeSR45-2 gene, or a recombinant vector containing the cassava low-temperature tolerance MeSR45-2 gene, host bacteria, and / or expression cassette in improving the low-temperature tolerance of cassava leaves, wherein the CDS sequence of the cassava low-temperature tolerance MeSR45-2 gene is shown in SEQ ID NO:

1.

4. The application of the cassava low-temperature resistant MeSR45-2 gene, or the protein encoded by the cassava low-temperature resistant MeSR45-2 gene, or a recombinant vector containing the cassava low-temperature resistant MeSR45-2 gene, host bacteria, and / or expression cassette in the breeding of low-temperature resistant cassava varieties and / or the preparation of transgenic cassava, wherein the CDS sequence of the cassava low-temperature resistant MeSR45-2 gene is shown in SEQ ID NO:

1.

5. The application as described in any one of claims 1-4, characterized in that, Overexpression of the described cassava cold-resistant MeSR45-2 gene in cassava.

6. The application of the cassava cold-resistant MeSR45-2 gene, or the protein encoded by the cassava cold-resistant MeSR45-2 gene, or a recombinant vector containing the cassava cold-resistant MeSR45-2 gene, host bacteria, and / or expression cassette in interaction with the MeSPL13a gene, the MeTCP15b gene, and / or the MeSR34b gene, wherein the CDS sequence of the cassava cold-resistant MeSR45-2 gene is shown in SEQ ID NO:1; the accession number of the MeSPL13a gene is Manes.06G171800, the accession number of the MeTCP15b gene is Manes.05G100100, and the accession number of the MeSR34b gene is Manes.05G062400.

Images