Application of SNP molecular markers based on the STPG1 gene promoter in assessing bull semen quality
By detecting SNP molecular markers on the STPG1 gene promoter, especially SNP2: g.-1220 T>C and haplotype combination H5H2 (GCT/ACT), the problem of early assessment of bull semen quality was solved, breeding efficiency was improved and economic losses were reduced.
Patent Information
- Application Number
- CN202511414975.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2045-09-30
AI Technical Summary
Existing technologies make it difficult to assess the quality of bull semen in its early stages, resulting in significant economic losses.
By detecting SNP molecular markers on the STPG1 gene promoter, especially SNP2: g.-1220 T>C and haplotype combination H5H2 (GCT/ACT), sperm motility and abnormality rate in bull semen can be assessed as genetic markers for early identification.
It enables early assessment of bull semen quality, improves breeding efficiency, reduces costs, and significantly enhances herd reproductive performance.
Smart Images

Figure CN120924691B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic breeding technology, specifically to the application of SNP molecular markers based on the STPG1 gene promoter in evaluating bull semen quality. Background Technology
[0002] Bull semen quality is an important indicator for assessing the reproductive capacity of breeding bulls. It directly affects the success rate of artificial insemination and the health status of offspring, and has a profound impact on the genetic improvement and production efficiency of the entire herd.
[0003] The protein encoded by the STPG1 (sperm tail PG-rich repeat containing 1) gene is closely related to spermatogenesis and is mainly expressed in the male reproductive system. As a serine protease, it plays a crucial role in spermatogenesis. STPG1 participates in the regulation of different stages of sperm development and may be closely related to sperm quality, function, and male fertility. Studies on STPG1 in animals are limited, and no studies in breeding bulls have been reported.
[0004] Currently, the main evaluation indicators for bull semen quality include appearance, ejaculate volume, semen density, sperm motility, and sperm abnormality rate. These indicators typically require analysis of semen collected from bulls after they have reached sexual maturity. However, if poor semen quality is only discovered and bulls are culled at this stage, it will result in significant economic losses.
[0005] Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, have been widely used in animal breeding, becoming an important tool for studying the relationship between genes, traits, and diseases. SNP markers can effectively identify genetic markers of superior breeds in animal and plant breeding, thereby enabling precision breeding. Screening for genes and their SNP molecular markers related to spermatogenesis and semen quality in bulls has significant practical value for early assessment of bull reproductive performance and for promoting the breeding of superior bulls. Summary of the Invention
[0006] The purpose of this invention is to provide a novel SNP molecular marker based on the STPG1 gene promoter, which can be used to assess bull semen quality by detecting its genotype, thus providing more options for early identification of bull reproductive performance.
[0007] The technical solution of this invention is described in detail below:
[0008] In a first aspect, the present invention provides the application of SNP molecular markers based on the STPG1 gene promoter in assessing bull semen quality. The SNP molecular markers include SNP2: g.-1220 T>C, reference gene version NC_037329.1. The semen quality includes sperm motility and sperm abnormality rate. Bulls with the SNP2 genotype CT have significantly higher sperm motility than those with the CC genotype, and bulls with the SNP2 genotype CT have significantly lower sperm abnormality rate than those with the CC genotype.
[0009] Optionally or preferably, in the above applications, the characteristic is that SNP2 is the 15th position of the nucleotide sequence shown in SEQ ID NO:1.
[0010] Optionally or preferably, in the above applications, the primer pair nucleotide sequences used to detect SNP2 are as shown in SEQ ID NO:2~3.
[0011] Secondly, this invention provides the application of SNP molecular markers based on the STPG1 gene promoter in evaluating bull semen quality, wherein the SNP molecular markers include SNP1: g.-1234 G>A, SNP2: g.-1220 T>C and SNP3: g.-1211 C>T, reference gene version NC_037329.1;
[0012] There are a total of 6 haplotypes in SNP1 to SNP3: H1=ACC, H2=ACT, H3=ATC, H4=GCC, H5=GCT, H6=GTC;
[0013] The semen quality includes sperm motility and sperm abnormality rate. The sperm motility of bulls with haplotype combination H5H2 was significantly higher than that of other haplotype combinations, while the sperm abnormality rate of bulls with haplotype combination H3H2 was significantly lower than that of other haplotype combinations.
[0014] Optionally or preferably, in the above applications, SNP1 to SNP3 are the 1st, 15th, and 24th positions of the nucleotide sequence shown in SEQ ID NO:1, respectively.
[0015] Optionally or preferably, in the above applications, the primer pairs used to detect SNP1 to SNP3 have nucleotide sequences as shown in SEQ ID NO: 2 to 3.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] This invention identified three SNP molecular markers on the STPG1 gene promoter. Among them, SNP2: g.-1220 T>C was significantly associated with sperm motility and abnormality rate. The haplotype combination (SNP1SNP2SNP3 combination) H5H2 (GCT / ACT) showed significantly higher sperm motility than other haplotype combinations, while the haplotype combination H3H2 (ATC / ACT) showed significantly lower sperm abnormality rate than other haplotype combinations. All of these can serve as potential genetic markers for evaluating bull semen quality and for early identification of bull semen quality. This can not only improve breeding efficiency and reduce costs, but also significantly improve the reproductive performance of the entire herd. Attached Figure Description
[0018] Figure 1 The statistical results show the expression levels of the STPG1 gene in different tissues of adult bulls and in the testes of bulls of different ages.
[0019] Figure 2 These are three SNP sites identified on the promoter sequence of the STPG1 gene.
[0020] Figure 3 A represents the correlation analysis results between SNP2 (g.-1220 T>C) and semen quality, A represents the correlation analysis results with sperm motility, and B represents the correlation analysis results with sperm abnormality rate. Detailed Implementation
[0021] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.
[0022] Example 1: Expression profiling analysis of the STPG1 gene
[0023] Testicular tissue was collected from three newborn Holstein bulls within one week of birth, and heart, liver, spleen, lung, kidney, and testicular tissues were collected from three adult Holstein bulls. RNA was extracted, reverse transcribed, and then subjected to qRT-PCR. The upstream primer was GCTGGGTTCGTGTCCAAAAC (SEQ ID NO:4), and the downstream primer was GTAATAACCGGGTCCTGGGC (SEQ ID NO:5). The detection results were summarized and averaged.
[0024] The results are as follows Figure 1As shown in the figure, A represents the STPG1 gene expression level in different tissues of adult bulls, indicating that the STPG1 gene is enriched and expressed in bovine testicular tissue, with expression levels far exceeding those in other tissues. B represents the STPG1 gene expression level in the testicular tissues of newborn and adult bulls, showing that the STPG1 gene expression level in adult bull testicular tissue is far higher than that in newborn bulls. This spatiotemporal specificity of expression suggests that the STPG1 gene may play an important role in testicular development and spermatogenesis in bulls.
[0025] Example 2: Association Analysis of Genetic Markers on the STPG1 Gene with Semen Quality
[0026] 2.1 High-salt method for extracting genomic DNA from bull frozen semen
[0027] Genomic DNA was extracted from frozen semen of 247 bulls using a high-salt method. All 247 bulls had complete semen quality records. Semen quality data, including semen volume, sperm motility, semen density, post-freezing motility, and morphology rate, were taken from the average values of each semen quality trait from 2018 to 2024.
[0028] 2.2 Amplification of the Bull STPG1 promoter sequence
[0029] PCR primers were designed to amplify the promoter sequence of STPG1 from 247 bulls. The upstream primer for the promoter was 5'-TACCTCAAAACCATTTCCCCAGTCC-3' (SEQ ID NO:2), and the downstream primer was 5'-TTATCTCTGGAGTTGCGGTGG-3' (SEQ ID NO:3).
[0030] 2.3 Identification of SNP sites on the STPG1 promoter
[0031] The amplified gene promoter sequence was subjected to Sanger sequencing, and a portion of the amplification product sequence is shown below:
[0032]
[0033] Then, sequence alignment was performed using software to identify SNP sites on the STPG1 gene promoter. Three SNP sites were identified on the promoter: SNP1: g.-1234 G>A (position 1 of the sequence shown in SEQ ID NO:1), SNP2: g.-1220 T>C (position 15 of the sequence shown in SEQ ID NO:1), and SNP3: g.-1211 C>T (position 24 of the sequence shown in SEQ ID NO:1). The transcription start site was the +1 site (the last C position of the sequence shown in SEQ ID NO:1). (See...) Figure 2 The STPG1 gene was genotyped in 247 bulls based on three SNP loci.
[0034] 2.4 Correlation analysis between different genotypes and haplotypes and bull semen quality
[0035] The correlation between different STPG1 genotypes and bull semen quality was analyzed. The results showed that SNP2: g.-1220 T>C was significantly correlated with sperm motility and sperm abnormality rate (P<0.05). Figure 3 .
[0036] Sperm motility was significantly higher in CT-type individuals than in CC-type individuals, while the sperm abnormality rate was significantly lower in CT-type individuals than in CC-type individuals.
[0037] Haplotype analysis of three SNP loci was performed using the SHEsis online software, revealing a total of six haplotypes (H1=ACC, H2=ACT, H3=ATC, H4=GCC, H5=GCT, H6=GTC). The correlation between different haplotype combinations of STPG1 and bull semen quality traits was analyzed, and the results are shown in Table 1 below.
[0038] Table 1. Results of the association analysis between haplotype combinations and semen quality
[0039]
[0040] Note: Haplotype combinations with fewer than 3 individuals were removed.
[0041] The results showed that the sperm motility of haplotype combination H5H2 was significantly higher than that of other haplotype combinations, while the sperm abnormality rate of haplotype combination H3H2 was significantly lower than that of other haplotype combinations, making it the dominant haplotype combination.
[0042] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.
Claims
1. The application of a reagent for detecting SNP molecular markers based on the STPG1 gene promoter in the preparation of products for evaluating bull semen quality, characterized in that, The SNP molecular marker is SNP2, which is located at position 15 of the nucleotide sequence shown in SEQ ID NO:1, and has a polymorphism of T or C. The semen quality includes sperm motility and sperm abnormality rate. Bulls with the SNP2 genotype CT have significantly higher sperm motility than those with the CC genotype, and bulls with the SNP2 genotype CT have significantly lower sperm abnormality rate than those with the CC genotype.
2. The application of a reagent for detecting SNP haplotype combinations based on the STPG1 gene promoter in the preparation of products for evaluating bull semen quality, characterized in that, The SNPs are SNP1, SNP2, and SNP3; SNP1 is located at position 1 of the nucleotide sequence shown in SEQ ID NO:1, with a polymorphism of G or A; SNP2 is located at position 15 of the nucleotide sequence shown in SEQ ID NO:1, with a polymorphism of T or C; SNP3 is located at position 24 of the nucleotide sequence shown in SEQ ID NO:1, with a polymorphism of C or T. There are a total of 6 haplotypes in SNP1 to SNP3: H1=ACC, H2=ACT, H3=ATC, H4=GCC, H5=GCT, H6=GTC; The semen quality includes sperm motility and sperm abnormality rate. The sperm motility of bulls with haplotype combination H5H2 was significantly higher than that of other haplotype combinations, while the sperm abnormality rate of bulls with haplotype combination H3H2 was significantly lower than that of other haplotype combinations.
Citation Information
Patent Citations
SNP molecular marker used for screening and / detecting abnormal rate of breeding bull sperms
CN108823322A
HNRNPA2B1 gene-based SNP molecular marker related to bovine sperm malformation rate and application of HNRNPA2B1 gene-based SNP molecular marker
CN120060502A