Molecular marker linked with major QTL (quantitative trait loci) of total grain number of single rice plant and application of molecular marker

Abstract

The invention provides a molecular marker linked with a major QTL (Quantitative Trait Loci) of the total grain number of a single rice plant and application of the molecular marker. The molecular marker is TGN5. A new major QTL TGN5 for controlling the total grain number of a single plant of the super rice Y900 is identified, is positioned in a section of about 1.46 Mb of a long arm of a chromosome 5, and just falls in a hot spot region Chr5: 17.9-27.3 Mb range of indica-japonica genetic differentiation of parents; the TGN5 is reduced to an interval of about 251.39 Kb by constructing a local genetic linkage map, and 13.3% of phenotypic variation is explained to the maximum extent; the loci are verified in segregation populations of the super rice Y1 and Y2 at the same time, and the single plant total grain number heterosis of the three-stage super rice can be differentially influenced. The molecular marker provided by the invention can be applied to regulation and control of the total grain number of a single rice plant.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular genetics and crop molecular design breeding technology, and in particular relates to a molecular marker linked to a major QTL (quantitative trait locus) of total grain number per rice plant and its application. Background Technology

[0002] Rice is an important food crop worldwide and a major food crop in my country. Increasing rice yield is of great significance for ensuring food security. Rice yield is determined by several factors, including the number of effective panicles, the number of grains per panicle, the seed setting rate, and the thousand-grain weight. my country's high-yield research on super hybrid rice has found that the total number of grains per plant is a key trait for improving yield and heterosis.

[0003] Compared to successful practices in high-yield rice breeding, the regulatory mechanisms of the total grain number per plant trait remain unclear. Strengthening the cloning and functional research of relevant QTLs / genes holds promise for expanding new avenues for high-yield molecular breeding of rice. The total grain number per plant is a core constituent trait of rice yield, determined collaboratively by multiple secondary traits such as the number of effective panicles, grains per panicle, and number of branches per panicle. Current research focuses primarily on QTL mapping and cloning for individual traits like grains per panicle and effective panicles, with relatively few truly finely mapped and cloned loci for the total grain number per plant trait. There is a need to find a molecular marker linked to a major QTL for the total grain number per rice plant to improve rice yield. Summary of the Invention

[0004] The technical problem this invention aims to solve is to overcome the shortcomings of existing technologies and provide a molecular marker linked to a major-effect QTL for the total number of grains per rice plant and its application. Using a modified mixed-pond BSA method, a novel major-effect QTL controlling the total number of grains per plant in super rice Y900 was identified. TGN5 Located on the long arm of chromosome 5, within a region of approximately 1.46 Mb, it falls precisely within the Chr5 region (17.9–27.3 Mb), a hotspot region for genetic differentiation between the two parents (indica and japonica varieties). By constructing a local genetic linkage map... TGN5 Narrowed to a range of approximately 251.39 kb, this locus explained up to 13.3% of the phenotypic variation. It was also validated in the segregating populations of super rice Y1 and Y2, demonstrating its ability to differentially influence heterosis in the total number of grains per plant in the three super rice varieties.

[0005] To address the aforementioned technical problems, this invention provides a molecular marker linked to a major-effect QTL related to the total number of grains per rice plant. The molecular marker is... TGN5 Positioned between markers M2 and M3; The M2-labeled primers include: M2 C -F, M2 T -F and reverse primer 1; The M2C The gene sequence of -F is shown in SEQ ID NO.1; The M2 T The gene sequence of -F is shown in SEQ ID NO.2; The gene sequence of the reverse primer 1 is shown in SEQ ID NO. 3; The M3-labeled primer includes: M3 A -F, M3 G -F, and reverse primer 2; The M3 A The gene sequence of -F is shown in SEQ ID NO.4; The M3 G The gene sequence of -F is shown in SEQ ID NO.5; The gene sequence of the reverse primer 2 is shown in SEQ ID NO. 6.

[0006] The aforementioned molecular markers, further, the M2 C -F is attached to the 5' end with a fluorescent reporter group; the M2 T The 5' end of -F is attached to another fluorescent reporter group.

[0007] The aforementioned molecular markers, further, the M3 A -F is attached to the 5' end with a fluorescent reporter group; the M3 G The 5' end of -F is attached to another fluorescent reporter group.

[0008] Furthermore, the aforementioned molecular markers include fluorescent reporter groups of FAM or HEX.

[0009] Based on a general technical concept, the present invention also provides an application of the above-mentioned molecular markers in regulating the total number of grains per rice plant.

[0010] Based on a general technical concept, the present invention also provides an application of the above-mentioned molecular markers in molecular breeding of high-yield rice.

[0011] Compared with the prior art, the advantages of the present invention are as follows: (1) This invention provides a molecular marker linked to a major QTL for the total number of grains per plant in rice. This invention uses high-throughput pooled sequencing technology to discover and locate a new locus for the total number of grains per plant in super rice Y900. TGN5 Genetic analysis showed that it could be repeatedly mapped in three super rice F2 populations. The allele from the paternal parent R900 had an enhancing effect on the total number of grains per plant, which was limited to the 251.39 kb region on the long arm of chromosome 5. No related QTL reports have been found yet.

[0012] (2) This invention provides a molecular marker TGN5 Application in regulating the total number of grains per rice plant. TGN5 In Y1, Y2 and Y900, the heterosis of total number of grains per plant is affected in different ways, with the overdominance in Y900 being the most significant. At the same time, it is located in the hotspot region of genetic differentiation between the super rice parents of indica and japonica.

[0013] In addition to the objectives, features, and advantages described above, the present invention has other objectives, features, and advantages. The invention will now be described in further detail with reference to the accompanying drawings and tables. Attached Figure Description

[0014] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0015] Figure 1 The plant and leaf morphology of super rice.

[0016] Figure 2 This refers to the panicle morphology of super rice.

[0017] Figure 3 A bar chart showing the super-parental advantage as the main factor influencing the yield of super rice.

[0018] Figure 4 Box plots showing the total number of grains per plant in four mixed pools for different super rice F2 populations.

[0019] Figure 5 Manhattan plot for QTL mapping of total grain number per plant in different super rice populations.

[0020] Figure 6 QTL (Quantity Tolerance) of total grains per plant TGN5 Genetic population verification diagram.

[0021] Figure 7 Genotyping diagram of the M2 gene for KASP markers.

[0022] Figure 8 Genotyping map of the M3 gene for KASP markers.

[0023] Figure 9 To construct near-isogenic NIL ( TGN5 -Y58S R900 Plant and leaf morphology and ear morphology. Detailed Implementation

[0024] The present invention will be further described below with reference to specific preferred embodiments, but this does not limit the scope of protection of the present invention.

[0025] The materials, reagents, and instruments used in the following examples are all commercially available. Unless otherwise specified, the experimental methods used in the following examples are conventional methods in the art.

[0026] The current agronomic traits of super rice and its parent lines in my country are shown in Table 1.

[0027] Table 1: Statistics on yield traits of super rice and its parent lines.

[0028]

[0029] Note: Y1 was used as the control (CK) for the analysis of phenotypic differences in hybrid rice; R9311 was used as the control (CK) for the analysis of phenotypic differences in restorer lines.

[0030] The results in Table 1 show that from the second to the fourth stage, the effective panicle and thousand-grain weight of super hybrid rice showed a decreasing trend, while the number of grains per panicle (184.3, 218 and 268.4) and the total number of grains per plant (1591.9, 1847.9 and 2145.9) increased significantly, and the final yield per plant showed a significant increase (33.4g, 38.9g and 43.9g).

[0031] Heterosis, a biological phenomenon prevalent in the plant kingdom, manifests as a significant surpassing of the parent in growth rate, biomass, and environmental adaptability of hybrid offspring. Its degree is primarily evaluated by the heterosis rate of the middle or superior parent. The following analysis compares the phenotypes and heterosis effects of super rice and its parents.

[0032] Figure 1 The figures show the plant and leaf morphology of super rice. Figure a shows the plant and leaf morphology of the female parent Y58S, hybrid Y900, and male parent R900 (from left to right). Figure b shows the plant and leaf morphology of the female parent Y58S, hybrid Y2, and male parent Yuanhui 2 (from left to right). Figure c shows the plant and leaf morphology of the female parent Y58S, hybrid Y1, and male parent R9311 (from left to right).

[0033] Figure 2 The figures show the panicle morphology of super rice; in the figure, d represents the panicle morphology of the female parent Y58S, hybrid Y900, and male parent R900 (from left to right); e represents the panicle morphology of the female parent Y58S, hybrid Y2, and male parent Yuanhui 2 (from left to right); and f represents the panicle morphology of the female parent Y58S, hybrid Y1, and male parent R9311 (from left to right).

[0034] Figure 3This is a bar chart showing the heterosis of super parents as the main factors affecting the yield of super rice. In the chart, g, h, and i represent hybrid rice Y900, Y2, and Y1, respectively; EPN represents the number of effective panicles, GNPP represents the total number of grains per plant, GNPPa represents the number of grains per panicle, TGW represents the weight of a thousand grains, SSR represents the seed setting rate, and GYPP represents the yield per plant. Blue represents heterosis of the super male parent, red represents heterosis of the super female parent, and green represents heterosis of the super mid-parent parent.

[0035] Basic analysis of heterosis traits showed that Y1, Y2, and Y900 all exhibited a consistent trend of heterosis exceeding parental traits in traits such as effective panicles, thousand-grain weight, and seed setting rate. Except for Y900, which showed negative superior paternal heterosis (OMPH) in grains per panicle, the others all showed positive superior heterosis exceeding both parents, with Y900 showing the highest superior maternal heterosis (57.33%). Notably, from the 2nd to the 4th generation of super rice, there was an increasing superior maternal heterosis (from -13.83% in Y1 to 0.04% in Y2, and then to 16.17% in Y900) and a positive superior mid-parental heterosis (OMiPH) in the total grains per plant trait, with the final yield per plant showing a positive superior paternal heterosis. In summary, Y900 showed the strongest yield advantage among the three generation super rice varieties, and the increase in the total grains per plant was the main factor contributing to the differences in yield advantage among them.

[0036] The total number of grains per plant is also an important source of heterosis differences in yield among indica-japonica hybrid rice. The overall trend in heterosis levels is as follows: Indica / japonica > Indica / Javanese > Japonica / Javanese > Indica / Indica > Japonica / Japonica. Currently, most of the leading or promising high-yield super rice varieties, such as Y Liangyou 1 (Y1: Y58S / R9311), Y Liangyou 2 (Y2: Y58S / RYH2), and Y Liangyou 900 (Y900: Y58S / R900), are typical inter-varietal (indica-indica) hybrid rice varieties with strong heterosis. However, with the continuous exploration of high-yield potential, the utilization of inter-varietal heterosis seems to have reached its "ceiling," i.e., a bottleneck period. As of 2024, the Ministry of Agriculture and Rural Affairs of the People's Republic of China has confirmed that a total of 128 rice varieties can be named super rice. Statistical analysis shows that super rice from indica and japonica varieties has a better yield advantage in regional trials, with an average yield of 666.8 kg / mu, which is significantly higher than other types of super rice / combinations.

[0037] Table 2 shows the results of the yield composition analysis for different types of super rice.

[0038] Table 2: Analysis of Yield Composition of Different Types of Super Rice

[0039] Note: The data comes from the super rice regional trial yield data of the National Rice Data Center. Due to the small number of japonica three-line super rice varieties (only 4), they were not included in the statistics.

[0040] A detailed analysis of Table 2 reveals that while the number of effective panicles per mu (approximately 0.067 hectares) and the thousand-grain weight are relatively low (24.7g), the total number of grains per panicle (263.2 grains) results in a total of 37 million spikelets per mu, far exceeding the 28.72 million of indica two-line super rice. Compared to indica hybrid rice combinations, conventional japonica / indica rice, although having more effective panicles (over 200,000), still has slightly fewer total spikelets per panicle (average 124.2 grains). Based on the unified planting density (6×6 inches) in regional trials, the indica-japonica hybrid combination still has the highest total number of grains per plant at 2221.6. Therefore, to achieve greater yield breakthroughs, it is essential to strengthen research on the mechanism and utilization of heterosis between indica and japonica subspecies. Considering the balance between effective panicles and the number of grains per panicle, the total number of grains per plant trait is a crucial breakthrough for studying the genetic basis of strong heterosis between indica and japonica subspecies. By discovering and identifying new genes related to the total number of grains per plant from the differentiation of super rice varieties from indica to japonica, a theoretical basis can be provided for elucidating the formation of yield heterosis between indica and japonica subspecies.

[0041] The following section uses super rice Y900 as a sample to identify the major QTL-linked molecular markers controlling the total number of grains per plant in super rice Y900.

[0042] Example 1 A molecular marker of the present invention linked to a major-effect QTL for the total number of grains per rice plant: TGN5 . TGN5 Located within a 1.46 Mb region on the long arm of rice chromosome 5. Subsequently, KASP markers M2 and M3 were developed within this target region.

[0043] The M2 marker was used to identify differentially expressed SNPs at 22,956,120 bp (physical location of the Nipponbare reference genome in japonica rice); the M3 marker was used to identify differentially expressed SNPs at 23,207,509 bp (physical location of the Nipponbare reference genome in japonica rice).

[0044] M2-labeled primers include: M2 C -F, M2 T -F, and reverse primer 1. M2 C -F is a specific primer designed for the allele C of the target SNP site; M2 T -F is a specific primer designed for the allele T at the same target SNP locus; reverse primers 1 and M2... C -F、M2 T -F co-amplifies the target fragment.

[0045] M2 C -F has the DNA sequence shown in SEQ ID NO.1, specifically: GAAGGTGACCAAGTTCATGCTGAAACTCGATTAAAGCACTGTCCC. The bold text represents parental differential SNPs, and the italicized text represents the FAM universal fluorescent tag sequence.

[0046] M2 T -F has the DNA sequence shown in SEQ ID NO.2, specifically: GAAGGTCGGAGTCAACGGATT GTGAAACTCGATTAAAGCACTGTCCT. Bold text represents parental differential SNPs, and italicized text represents HEX universal fluorescent tag sequences.

[0047] Different SNP amplification primers display different colors when the machine reads the genotype, depending on the fluorescent tag attached to them.

[0048] Reverse primer 1 has the DNA sequence shown in SEQ ID NO.3, specifically: GATTCGCCTTCATTGGAGATTAGTC.

[0049] M3-labeled primers include: M3 A -F, M3 G -F, and reverse primer 2; M3 A -F is a specific primer designed for allele A at the target SNP site; M3 G -F is a specific primer designed for the allele G at the same target SNP locus, and the reverse primers 2 and M3... A -F、M3 G -F co-amplifies the target fragment.

[0050] M3 A -F has the DNA sequence shown in SEQ ID NO.4, specifically: GAAGGTGACCAAGTTCATGCT ATCCCTGTCACTTGACCCACA. Bold text represents parental differential SNPs, and italicized text represents the FAM universal fluorescent tag sequence.

[0051] M3 G -F has the DNA sequence shown in SEQ ID NO.5, specifically: GAAGGTCGGAGTCAACGGATT CCCTGTCACTTGACCCACG. Bold text represents parental differential SNPs, and italicized text represents HEX universal fluorescent tag sequences.

[0052] Different SNP amplification primers display different colors when the machine reads the genotype, depending on the fluorescent tag attached to them.

[0053] Reverse primer 2 has the DNA sequence shown in SEQ ID NO.6, specifically: ACTGGGGAGAGGTGGATCCT.

[0054] The chromosome segment between markers M2 and M3 (over 200 kb in size) contains the QTL of the total number of grains per plant. TGN5 Only genotypes that simultaneously match the M2 and M3 markers (with the same bases as R900) are considered to contain sites that increase the total number of grains per plant within this interval. TGN5 .

[0055] This invention, with slight modifications to the GPS-BSA method developed by Huang Xuehui et al. (2019), identifies a novel molecular marker linked to a major-effect QTL controlling the total number of grains per plant in super rice Y900. The specific method includes the following steps: (1) The major F2 populations used for positioning were divided into 4 mixed pools according to the phenotypic value of the total number of grains per plant. Table 3 shows the statistical results of the characteristic values ​​of the super rice F2 population.

[0056] Table 3: Statistics of Characteristic Values ​​of Super Rice F2 Population

[0057] (2) Using sequencing technology and bioinformatics analysis, SNPs of homozygous and different genotypes of the two parents were screened, and non-reference bases were screened from each pool. Then, ridit statistical analysis was performed for each site, and a p-value scatter plot was drawn. Then, the significant variants of the whole genome were counted. The ratio of the number of significant sites to the total number of sites (SNP ratio) was calculated with a 400 kb window and a 100 kb step size, and a ratio scatter plot was drawn. The region with the higher peak is the location of the target gene, and the candidate region of trait association is located.

[0058] Figure 4 Box plots showing the total number of grains per plant in four mixed ponds for different F2 super rice populations; in the figure, a represents super rice Y1, b represents super rice Y2, and c represents super rice Y900.

[0059] Figure 5 Manhattan plots for QTL mapping of total grains per plant in different super rice populations; d in the plot represents super rice Y1, e represents super rice Y2, and f represents super rice Y900. The red line represents the top 1% threshold, and the blue line represents the top 5% threshold.

[0060] Comparative analysis revealed a novel QTL for the total number of grains per plant in each of the F2 mixed populations of super rice varieties Y1, Y2, and Y900. TGN5Located at the long arm of chromosome 5 (indicated by the blue dashed box and green arrow in the figure); after comparing the mixed pool localization intervals of three different populations, the 95% confidence interval shows... TGN5 It is currently limited to a physical range of approximately 3.3 Mb (21.6 Mb-24.9 Mb for Nipponbare japonica rice).

[0061] (3) This was further verified in a small random group of Y2. TGN5 The software showed that the effect had a LOD value of 4.38, explaining 10.36% of the phenotypic variation, located within a 1.46 Mb region on the long arm of chromosome 5. Figure 6 (a) Subsequently, KASP markers were further developed within the target interval and validated in random small populations of Y1, Y2, and Y900, respectively. TGN5 Reduced to approximately 251Kb ( Figure 6 (b to d in the original text). Among them, the highest phenotypic variation rate explained in the randomized small population of Y900 was 13.29%, located between markers M2 and M3, with a physical range of 251.39 kb. Table 4 shows the KASP marker detection sequences and differentially expressed genotypes.

[0062] Table 4: KASP marker detection sequences and differentially expressed genotypes

[0063] Note: Bold text indicates parental differences (SNPs).

[0064] (4) Using molecular markers M2 and M3 for assisted selection and phenotypic screening, near-isogenic line NILs under the Y58S background were constructed and obtained. TGN5 -Y58S R900 .

[0065] Figure 7 Genotyping map of M2 KASP markers; Figure 8 Genotyping map of the M3 gene for KASP markers. Figure 9 To construct and obtain the near-isogenic line NIL in the Y58S background ( TGN5 -Y58S R900 In the figure, 'a' represents the plant and leaf morphology; 'b' represents the ear morphology.

[0066] For Y58S and NIL ( TGN5 -Y58S R900 An agronomic trait survey was conducted, and the results are shown in Table 5.

[0067] Table 5: TGN5 Near-isogenic phenotypic survey

[0068] The results in Table 5 show that: NIL ( TGN5 -Y58S R900 There were no significant differences between it and Y58S in terms of plant height, panicle length and other traits; however, it was significantly higher than the parent Y58S in terms of effective panicles and number of grains per panicle, which also resulted in a significantly higher total number of grains per plant than Y58S, providing a new selection site for exploring the creation of new high-yield rice germplasm.

[0069] Example 2 Application of a molecular marker from Example 1 in regulating the total number of grains per rice plant.

[0070] Experiment 1: Investigation TGN5 Located in the indica-japonica differentiation zone, they participate in heterosis in the total number of grains per plant through different mechanisms.

[0071] Following the research methods of Huang X et al. (Huang X, et al. Genomic architecture of heterosis foryield traits in rice. Nature. 2016 Sep 29;537(7622):629-633. doi: 10.1038 / nature19760), TGN5 The heterosis effect in different super rice varieties was analyzed. First, individual plants with a seed setting rate of less than 20% and a yield of less than 5g per plant were removed from each F2 population; then... TGN5 The M2 and M3 markers flanking the locus are used as the basis for detection to classify the homozygous paternal genotype (RR), heterozygous genotype (RS), and homozygous maternal genotype (SS) of the offspring population; combined with the phenotypic values, the mode of action of each locus in each population is calculated using classical genetic theory.

[0072] Analyzing from a holistic perspective, TGN5 In the segregating populations Y1, Y2, and Y900, it participated in the formation of heterosis in the total number of seeds per plant in a positive partial dominance manner (d / a=0.646). The results for individual populations are shown in Table 6.

[0073] Table 6: TGN5 The effect of heterosis on the total number of seeds per plant was evaluated in each F2 population.

[0074]

[0075] Note: Partially dominant (-0.8 < [d / a] ≤ -0.2; 0.2 < [d / a] ≤ 0.8), dominant (-1.2 < [d / a] ≤ -0.8; 0.8 < [d / a] ≤ 1.2), superdominant ([d / a] ≤ -1.2; 1.2 < [d / a]), additive (-0.2 < [d / a] ≤ 0.2).

[0076] The results in Table 6 show that: TGN5 In different populations, this locus participates in the formation of heterosis in the total number of grains per plant in their respective hybrids through partial dominance, additive, and overdominance. The overdominance effect is most prominent in Y900, with the heterozygous genotype contributing 2255.6 and the homozygous paternal genotype respectively to the total number of grains per plant, with an effect value of 1.44 (d / a). The effect of this locus on heterosis in the total number of grains per plant is consistent with the increasing trend of the total number of grains per plant in super rice from growth stages 2 to 4. We hypothesize that this locus participates in the formation of heterosis in the total number of grains per plant in super rice and influences the final yield heterosis. Therefore, cloning this locus is of significant research value for understanding the formation of heterosis in the total number of grains per plant and its contribution to yield from different perspectives.

[0077] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solutions of the present invention shall still fall within the protection scope of the technical solutions of the present invention.

Claims

1. A molecular marker linked to a major-effect QTL for the total number of grains per rice plant, characterized in that, The molecular marker is TGN5 It is located between markers M2 and M3; The M2-labeled primers include: M2 C -F, M2 T -F and reverse primer 1; The M2 C The gene sequence of -F is shown in SEQ ID NO.1; The M2 T The gene sequence of -F is shown in SEQ ID NO.2; The gene sequence of the reverse primer 1 is shown in SEQ ID NO. 3; The M3-labeled primer includes: M3 A -F, M3 G -F and reverse primer 2; The M3 A The gene sequence of -F is shown in SEQ ID NO.4; The M3 G The gene sequence of -F is shown in SEQ ID NO.5; The gene sequence of the reverse primer 2 is shown in SEQ ID NO.

6.

2. The molecular marker according to claim 1, characterized in that, The M2 C -F is attached to the 5' end with a fluorescent reporter group; the M2 T The 5' end of -F is attached to another fluorescent reporter group.

3. The molecular marker according to claim 1, characterized in that, The M3 A -F is attached to the 5' end with a fluorescent reporter group; the M3 G The 5' end of -F is attached to another fluorescent reporter group.

4. The molecular marker according to claim 2 or 3, characterized in that, The fluorescent reporter group is FAM or HEX.

5. The application of any one of the molecular markers in claims 1 to 4 in regulating the total number of grains per rice plant.

6. The application of a molecular marker according to any one of claims 1 to 4 in molecular breeding of high-yield rice.

Images