Rice OsHAD5 mutant and application thereof
By using CRISPR/Cas9 technology to perform targeted mutations on the rice OsHAD5 gene to create the had5-1 mutant, the problem of low phosphorus utilization efficiency in rice has been solved, achieving efficient phosphorus accumulation and reducing the use of phosphate fertilizers, thus promoting sustainable agricultural development.
Patent Information
- Application Number
- CN202511190722.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-25
- Publication Date
- 2025-11-14
AI Technical Summary
The low phosphorus utilization efficiency of rice leads to the large amount of phosphate fertilizer used, causing serious environmental pollution. Furthermore, the molecular mechanism of high phosphorus utilization efficiency is unclear, making it difficult to cultivate high phosphorus-efficient varieties through genetic improvement.
The rice OsHAD5 gene was mutated using CRISPR/Cas9 technology, inserting a T base to form the had5-1 mutant, which increased the phosphorus content in rice leaves, regulated phosphorus homeostasis, and enhanced phosphorus accumulation.
It can significantly improve the efficiency of phosphorus utilization in rice, reduce the amount of phosphate fertilizer used, lower production costs, reduce environmental pollution, provide new genetic resources and research materials, and promote sustainable agricultural development.
Smart Images

Figure CN120944923A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and plant genetic engineering, and more specifically, to a rice OsHAD5 mutant and its applications. Background Technology
[0002] Phosphorus (P) is an essential nutrient element for plant growth and development, participating in various physiological processes such as energy metabolism, synthesis of important macromolecules, and cell signal transduction. However, the available phosphorus content in soil is usually low and easily fixed by other elements, resulting in very little soluble inorganic phosphorus available for direct absorption and utilization by plants, far below the inorganic phosphorus concentration required by plant tissues (5-20 mM). As one of the world's major food crops, rice's phosphorus use efficiency directly affects its yield and quality. To improve crop growth and development and increase production, agricultural production uses chemical phosphate fertilizers and organic fertilizers such as animal manure to improve soil phosphorus fertility; however, up to 80% of the applied phosphorus may be fixed in the soil. Phosphorus is a non-renewable resource. With the current use of phosphate fertilizers, not only are phosphate rock resources facing depletion, but the large amount of phosphorus lost will also lead to environmental problems such as soil compaction and eutrophication of water bodies. Therefore, in order to ensure the sustainable development of modern agriculture, regulating the absorption, transport and metabolism of phosphorus in plants is an important direction of agricultural scientific research. Studying the physiological and molecular mechanisms of plants in response to phosphorus deficiency stress, discovering and utilizing the phosphorus-efficient genes in plants themselves, and cultivating phosphorus-efficient varieties through genetic improvement have important theoretical significance and practical value.
[0003] Currently, although some genes related to phosphorus nutrition in rice have been identified, the molecular mechanisms of phosphorus efficiency in rice are still not fully understood, and many potential phosphorus-efficient genes remain to be discovered. The HAD (Haloacid Dehalogenase) family of genes is a family of genes encoding hydrolases that are widely involved in phosphate metabolism in organisms. Studies have shown that many members of this family play important roles in phosphorus deficiency responses; some members, as acid phosphatases, degrade organic phosphorus into inorganic phosphorus to regulate tolerance to low phosphorus stress. PHOSPHO1 is an acid phosphatase; studies have shown that this enzyme can release inorganic phosphorus by hydrolyzing phosphocholine and phosphoethanolamine, participating in bone biomineralization in animals and humans. In rice, OsACP1, a homolog of PHOSPHO1, is induced by OsPHR2 and is located on the endoplasmic reticulum membrane and Golgi apparatus membrane. Overexpression or mutation of OsACP1 significantly alters intracellular Pi homeostasis and Pi starvation signals, regulating phosphorus homeostasis in plants by degrading organic phosphorus and recovering inorganic phosphorus. OsHAD1 is a functional protein possessing both acid phosphatase and phytase activities. It functions under OsPHR2-mediated transcriptional regulation. Overexpression of OsHAD1 in rice promotes the utilization of organic phosphorus in the environment, increasing phosphorus accumulation and playing a crucial role in phosphorus homeostasis. Under phosphorus-deficient conditions, the expression of the OsHAD5 gene is significantly upregulated in rice leaves, indicating its important role in the phosphorus starvation response. These results suggest that members of the HAD family play a vital role in regulating phosphorus homeostasis. Altering the expression of target genes using transgenic technology to increase phosphorus accumulation and improve phosphorus utilization efficiency shows promising application potential. Summary of the Invention
[0004] The purpose of this invention is to provide a rice OsHAD5 mutant and its application. This mutant can increase the phosphorus content in the aboveground parts of rice and reveals the key role of this gene in rice phosphorus metabolism. Through in-depth research and rational utilization of this mutant, new avenues can be opened for the breeding of new rice varieties with high phosphorus utilization efficiency, thereby reducing the amount of phosphate fertilizer applied in agricultural production, lowering production costs, increasing rice yield and quality, and mitigating environmental pollution caused by excessive phosphate fertilizer application, thus promoting sustainable agricultural development.
[0005] The above-mentioned technical objective of the present invention is achieved through the following technical solution: a rice OsHAD5 mutant and its application, wherein the mutant is formed by directed mutation of the rice phosphatase OsHAD5 gene, named had5-1, and its nucleotide sequence is as follows: GATGAACTCGCTGATTTtCTGTGGG.
[0006] Furthermore, the rice OsHAD5 mutant was obtained by editing the OsHAD5 gene using CRISPR / Cas9 technology, specifically by inserting a T base into the rice phosphatase HAD5 gene.
[0007] This invention also provides the application of the rice OsHAD5 mutant in increasing the phosphorus content of rice leaves.
[0008] The present invention also provides the application of the rice OsHAD5 mutant in the breeding of rice varieties with high phosphorus content.
[0009] In summary, this invention offers the following advantages: Directed mutation of the rice OsHAD5 gene using CRISPR / Cas9 technology significantly increases phosphorus content in the aboveground parts of the plant. Phosphorus deficiency-induced expression in the leaves helps improve phosphorus utilization efficiency in rice, reducing phosphate fertilizer application and production costs, while also mitigating environmental pollution caused by excessive phosphate fertilizer use. Furthermore, this invention provides new gene resources and research materials for studying the molecular mechanisms of efficient phosphorus utilization in rice. Research on the OsHAD5 mutant helps to elucidate the regulatory network of phosphorus absorption, transport, and metabolism in rice, providing a theoretical basis and research ideas for further exploration and utilization of other phosphorus-efficient genes. Simultaneously, the method established in this invention for breeding new phosphorus-efficient rice varieties using mutants provides new technical means and practical experience for the field of plant genetics and breeding, with broad application prospects and significant socio-economic benefits. Attached Figure Description
[0010] Figure 1 These are the nucleotide sequences of the mutation sites in the OsHAD5 gene, named had5-1.
[0011] Figure 2 This is a map showing the construction of the OsHAD5 gene's sgRNA within the pRGEB31 backbone vector plasmid.
[0012] Figure 3 This refers to the inorganic phosphorus content in various parts of HAD5 rice cultivated under normal and phosphorus-deficient conditions.
[0013] Figure 4 : This refers to the total phosphorus content of various parts of had5 rice cultivated under normal and phosphorus-deficient conditions. Detailed Implementation
[0014] The following is in conjunction with the appendix Figure 1-4 The present invention will be described in further detail below.
[0015] Example 1: Construction of mutant vector
[0016] The genomic sequence of OsHAD5 (SEQ ID NO: 1) was found through NCBI. sgRNA primers were designed and synthesized using the website http: / / www.genome.arizona.edu / crispr / . The vector pRGEB31 was digested with Bsa I, and the fragment was ligated into the vector using T4 ligase. The primer sequences were: forward primer: 5'GGCACTGAAAGCACTTAAGGATAG3', reverse primer: 5'AAACCTATCCTTAAGTGCTTTCAG3'.
[0017] SEQ ID NO: 1:
[0018]
[0019] The primers were annealed using a PCR instrument to form double-stranded DNA. The PCR reaction mixture consisted of: 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 7 μL of 10x T4 DNA ligase buffer, and 1 μL of ddH2O. The PCR amplification program was: 37℃ for 60 minutes, 95℃ for 10 minutes, decreasing by 0.1℃ per cycle, gradually cooling to 25℃. The sample was diluted 1:200 and stored at 4℃.
[0020] The vector pRGEB31 was digested with the restriction endonuclease BsaI, and the linearized vector was recovered. The vector and sgRNA were ligated using T4 ligase. The reaction mixture consisted of: linear pRGEB31 x (50 ng), sgRNA 1 μL, 10x T4 DNA ligase Buffer 0.5 μL, T4 ligase 1.0 μL, and ddH2O up to 5 μL. The sgRNA product was ligated into the digested pRGEB31 vector and transformed into *E. coli* DH5α strain using the heat shock method. Positive clones were selected for PCR verification, and the verified positive clones were sequenced. The plasmid that matched the sequence was transformed into *Agrobacterium* EHA105 for later use. The vector was named pRGEB31-HAD5 (simplified vector structure diagram shown below). Figure 2 (As shown).
[0021] Example 2: Obtaining had6 transgenic rice material
[0022] (1) Experimental material: wild-type (i.e. non-GMO) rice variety Zhonghua 11 (ZH11).
[0023] (2) Solution preparation
[0024] 1. MS large stock solution (10X)
[0025]
[0026] Bring the volume to 1L and store at 4℃ for extended periods.
[0027] 2. MS micro-stock solution (100x)
[0028]
[0029] Na₂MoO₄·2H₂O 0.025g
[0030] CoCl2·6H2O 0.0025g
[0031] CuSO4·5H2O 0.0025g
[0032] Bring the volume to 1L and store at 4℃ for extended periods.
[0033] 3. N6 large stock solution (10x)
[0034] KNO3 28.3g
[0035] (NH4)2SO4 4.63g
[0036] KH2PO4 4.0g
[0037] MgSO4·7H2O 1.85g
[0038] CaCl2 1.25g or CaCl2·2H2O 1.66g
[0039] Bring the volume to 1L and store at 4℃ for extended periods.
[0040] 4. B5 micro-stock solution (100x)
[0041] KI 0.08g
[0042] H3BO3 0.16g
[0043] ZnSO4·7H2O 0.15g
[0044] MnSO4·4H2O 0.44g orMnSO4·H2O 0.3335g
[0045] Bring the volume to 1L and store at 4℃ for extended periods.
[0046] 5. Fe 2+ -EDTA stock solution (100x)
[0047] Add 800mL of H2O to a beaker and bring to a boil. Then add 3.73g of Na2EDTA·2H2O. After cooling slightly, add 200mL of H2O to another beaker and dissolve 2.78g of FeSO4·7H2O. While stirring, slowly pour the solution into the Na2EDTA·2H2O mixture. Stir and keep warm at 70℃ for 2 hours. After cooling, bring the volume to 1L and store at 4℃ away from light.
[0048] 6. Organic reagent stock solution (100x)
[0049] Nicotinic acid 0.1g
[0050] Thiamine HCl (VB1) 0.1g
[0051] Pyridoxine HCl (VB6) 0.1g
[0052] Inositol 10g
[0053] Glycine 0.2g
[0054] Bring the volume to 1L and store at 4℃.
[0055] 7. KT stock solution (1 mg / mL)
[0056] Dissolve 100 mg of KT in 1 mL of 1 M KOH, shake well, add water to dissolve and bring the volume to 100 mL. Store at room temperature. (KT may precipitate during long-term storage; it is recommended to prepare only 10 mL at a time.)
[0057] 8. 2,4-D stock solution (1 mg / mL)
[0058] Add 100 mg of 2,4-D to 1 mL of 1 M KOH, shake well, dissolve in water and bring the volume to 100 mL, and store at room temperature.
[0059] 9. 200mMAS stock solution
[0060] Dissolve 0.4g AS in 10mL DMSO, filter and sterilize, aliquot into sterile 1.5mL centrifuge tubes, and store at -20℃.
[0061] 10. NAA stock solution (1 mg / mL)
[0062] Add 100 mg NAA to 1 mL of 1 M KOH, shake well, add water to dissolve and bring the volume to 100 mL, and store at room temperature.
[0063] (3) Culture medium formulation (prepare before use)
[0064] Table 1 Induction Culture Medium
[0065]
[0066] Table 2 Subculture Culture Media
[0067]
[0068] Table 3 Suspension Culture Medium
[0069]
[0070]
[0071] Table 4 Co-culture medium
[0072]
[0073] Table 5. Selected Culture Media
[0074]
[0075] Add after sterilization:
[0076]
[0077]
[0078] Table 6 Differentiation Culture Media
[0079]
[0080] Table 7 Rooting Culture Medium
[0081]
[0082] (4) Transgenic Operation Steps
[0083] All the following operations shall be performed in a laminar flow hood, with sterilization in the laminar flow hood lasting at least 30 minutes and air blowing for 20 minutes.
[0084] 1. Inducing callus formation
[0085] After the mature rice seeds are hulled, select plump, smooth, and sterile seeds and place them in centrifuge tubes. Disinfect with 75% ethanol for 2 minutes. Discard the ethanol and add 30% (v / v) NaClO solution (or 84 disinfectant: sterile water (v:v) = 1:1) for 30 minutes, inverting and mixing several times during this process. Discard the NaClO solution and rinse five times with sterile water, finally soaking in sterile water for 30 minutes, inverting and mixing several times during this process. Discard the sterile water and blot the seeds dry on sterile filter paper (place absorbent paper at the bottom of the petri dish and filter paper on top). Use tweezers to transfer the seeds into the induction medium, placing 10-12 seeds per bottle (embryo facing upwards). Incubate in the dark at 28°C for one month.
[0086] 2. Succession
[0087] From the induced callus, select pale yellow, granular, dry, and viable callus tissues and transfer them to subculture medium for dark culture for 20 days (it is best to perform infection after one subculture, and subculture a maximum of two times, otherwise the callus transformation efficiency will be very low. When subculturing for the first time, be careful to remove other tissues such as endosperm and buds attached to the callus tissue).
[0088] 3. Infection and Co-cultivation
[0089] Two days before infection, the preserved Agrobacterium strain stock solution was streaked in YEP medium (with the corresponding antibiotic added, the resistance of the strain determined) at 28°C for activation. In a sterile 250mL Erlenmeyer flask, 100mL of suspension medium (with 50μL 200mMAS and 1mL 50% glucose) was poured in. The streaked Agrobacterium was scraped into a pea-sized portion of the suspension medium and incubated at 28°C and 200rpm for 30 minutes, until slightly turbid. Rice callus particles that had grown to a certain size were picked out and soaked in the Agrobacterium suspension for 30 minutes. The callus tissue was removed, placed on sterile filter paper to drain for 2 hours, and then evenly placed on a co-culture medium (with a layer of sterile filter paper on top to prevent overgrowth of Agrobacterium) and incubated in the dark at 19°C for 3 days.
[0090] 4. Screening for resistant callus
[0091] After 3 days of co-culturing, callus was collected in 250 mL blue-capped bottles and rinsed with sterile water until the water in the bottles was clear, indicating that the Agrobacterium was thoroughly cleaned. Finally, sterile water containing 1000 mg / L carbenicillin sodium was added and the callus was soaked for 30 minutes. The sterile water was then discarded, and the callus was spread on filter paper and air-dried for 3 hours. The dried callus was then transferred to a selective medium containing 400 mg / L carbenicillin sodium and 50 mg / L hygromycin for the first round of selection, and cultured in the dark at 28°C for 14 days. The initially grown callus was then transferred to a selective medium containing 300 mg / L carbenicillin sodium and 80 mg / L hygromycin for the second round of selection, and cultured in the dark at 28°C until granular resistant callus tissue grew. If no resistant callus grew after four weeks, the callus was transferred to a selective medium with the same composition.
[0092] 5. Differentiation and seedling formation of resistant callus
[0093] Select 2-3 resistant calluses from the same callus and place them on differentiation medium. Incubate at 26°C under light [14h / 10h (day / light) photocycle, light intensity 2000lx]. After 30-50 days of differentiation culture, the callus tissue will differentiate into seedlings. When the green shoots grow to about 3-5cm, remove the young roots with scissors and transfer them to rooting medium. Incubate at 26°C under light.
[0094] 6. Transplanting and molecular identification of transgenic seedlings
[0095] After 10-15 days of rooting culture, select seedlings with well-differentiated roots and stems, remove the sealing film, add an appropriate amount of distilled or sterile water, and harden them off in a culture room for 5-7 days. Then, wash off the agar and transfer them to rice nutrient solution for 2 weeks of cultivation. Use screening marker genes to select resistant transgenic materials. Finally, transplant the obtained transgenic positive seedlings into the field or pots for seed harvesting.
[0096] Example 3: Determination of Mutant Materials
[0097] DNA was extracted from transgenic plants using the TPS method. The OsHAD5 gene fragment was amplified using PCR, and the amplified product was sequenced and compared with OsHAD5 gene sequences in the database to accurately determine the mutation site and mutation type. Furthermore, the morphological characteristics of the mutant were observed and recorded in detail, and compared with wild-type rice to preliminarily determine whether there were significant differences in growth and development. The primer sequences were: forward primer: 5'GACATGGTGCAATGCCGATG', reverse primer: 5'ACAGTTCCTGTCATTGCCCT 3'.
[0098] Using DNA from rice mutant plants as a template, the OsHAD5 target sequence was amplified using a standard PCR program. The PCR reaction mixture consisted of: 1 μL DNA, 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 10 μL 2X mix, and 7 μL H2O. The PCR amplification program was as follows: 94℃ pre-denaturation for 2 minutes; 33 cycles of 94℃ for 30 seconds, 58℃ for 30 seconds, and 72℃ for 10 seconds; and a final extension at 72℃ for 5 minutes. After agarose gel electrophoresis, the fragment was excised and recovered; the amplified fragment size was 234 bp.
[0099] Example 4: Determination of phosphorus content in plants
[0100] Seeds of ZH11 and had5 transgenic materials were soaked in 1% nitric acid for 14 hours, rinsed several times with distilled water, and then germinated at 37℃. After the seeds showed signs of germination, they were cultured in rice nutrient solution (formulation as shown in Table 8). The greenhouse light cycle was 12 hours of light / 12 hours of darkness, with a light intensity of 3000 lx. The daytime culture temperature was 30℃, and the nighttime culture temperature was 22℃. After 20 days of treatment with normal phosphorus and phosphorus deficiency (without NaH2PO4·2H2O in the nutrient solution), the inorganic phosphorus content was measured. After 25 days of treatment with normal phosphorus and phosphorus deficiency (without NaH2PO4·2H2O in the nutrient solution), the total phosphorus content was measured.
[0101] Inorganic phosphorus determination: 25 mg samples were taken from different tissue parts of the plant, and 25 μL of 5 mol / L sulfuric acid was added. The mixture was ground, and then 1.5 mL of distilled water was added and thoroughly mixed. The mixture was centrifuged at 12000 r / min for 10 min at 4℃. The supernatant was collected in a new centrifuge tube. The supernatant was diluted a certain factor and mixed with malachite green solution at a ratio of 3:1. After standing at room temperature for 30 min, the OD650 was measured. The phosphorus concentration was calculated based on the standard curve. Results are as follows: Figure 3 As shown, under different treatment conditions, the inorganic phosphorus content in all tissues of the mutant was significantly higher than that of the wild type.
[0102] Total phosphorus determination: Samples were taken from different tissue parts of the plant and dried. 0.05 g of the crushed plant sample was placed at the bottom of a 20 mL digestion tube. 1 mL of concentrated sulfuric acid (H₂SO₄) was added using a glass pipette, and the tube was gently shaken and allowed to stand overnight. The tube was then digested at 130℃ for 1 hour. When the solution turned a uniform brownish-black color, it was removed from the heat and cooled slightly. 6 drops of H₂O₂ were added, and the tube was heated to a gentle boil and digested for 30 minutes. After cooling slightly, 2-3 drops of H₂O₂ were added again, and the tube was digested until the solution became colorless or clear. The solution was then heated to remove any remaining H₂O₂, and cooled to room temperature. Water was added to bring the volume to 20 mL, and the tube was sealed with sealing film and shaken thoroughly. The solution was filtered through dry quantitative filter paper into a 10 mL centrifuge tube. After diluting the test solution by a certain factor, pipette 1 mL into a clean 10 mL centrifuge tube, add 1 drop of dinitrophenol indicator, then add 4 mol / L NaOH solution until the solution turns yellow. Add 2 mol / L (1 / 2 H₂SO₄) solution until the yellow color just fades (or becomes pale yellow), then add water to a final volume of 9 mL. Add 1 mL of molybdenum antimony anti-chromic reagent and mix well. After reacting at room temperature for 30 min, pipette 200 μL onto a microplate and perform colorimetric analysis at 700 nm using a microplate reader. Use the blank digest as a control. Results are as follows: Figure 4 As shown, under normal phosphorus conditions, the total phosphorus content in the aboveground parts of the mutant was significantly higher than that of the wild type, while there was no significant difference under low phosphorus conditions. The results of inorganic phosphorus and total phosphorus measurements fully demonstrate that targeted mutation of the rice OsHAD5 gene using CRISPR / Cas9 technology can significantly increase the phosphorus content of the plant.
[0103] Table 8 Rice Nutrient Solution Formula
[0104]
[0105] Note in Table 8: Adjust the pH of the nutrient solution to 5.0-5.8 using 1M hydrochloric acid.
[0106] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.
Claims
1. A rice OsHAD5 mutant, characterized by: The mutant was formed by a directed mutation of the rice phosphatase OsHAD5 gene and was named had5-1. Its nucleotide sequence is shown below: GATGAACTCGCTGATTTtCTGTGGG.
2. The rice OsHAD5 mutant according to claim 1, characterized in that: The rice OsHAD5 mutant was obtained by editing the OsHAD5 gene using CRISPR / Cas9 technology, specifically by inserting a T base into the rice phosphatase OsHAD5 gene.
3. The application of the rice OsHAD5 mutant according to claim 1 or 2 in increasing the phosphorus content of rice leaves.
4. The application of the rice OsHAD5 mutant according to claim 1 or 2 in the breeding of rice varieties with high phosphorus content.