Primer pair for detecting pyrazol insecticide resistance of brown planthopper and application of primer pair

Abstract

The invention relates to a primer pair for detecting pyrazol insecticide resistance of brown planthopper and application of the primer pair, in particular to an upstream primer, namely 5 '-GAGTTTACAGCAGGCGGAC-3'; the invention discloses a primer pair of Rp: 5 '-GCAGAATCGCGCTAGAAAGA-3', downstream primers Rp: 5 '-GCAGAATCGCGCTAGAAAGA-3' and Sp: 5 '-GCAGAATCGCGCTAGAAAGG-3', and the primer pair is used for detecting the pesticide resistance of brown planthopper by adopting an allele specific PCR (Polymerase Chain Reaction) method. The primer pair has the characteristics of short detection time, less manpower, less sample amount, large sample detection amount, high accuracy and the like.

Description

Technical Field

[0001] This application relates to the fields of molecular biology and pest control, and more specifically, to a primer pair for detecting resistance to benzirazole insecticides in brown planthoppers and its application. Background Technology

[0002] The brown planthopper (Nilaparvata lugens (Stal)) is a major pest of rice in my country and many other Asian countries. It damages rice by feeding on rice stalks, laying eggs in rice tissues, and spreading rice viruses, causing large-scale yield reductions and significant losses to the agricultural economy.

[0003] For a long time, the control of brown planthoppers has mainly relied on chemical agents. However, resistance to insecticides or decreased sensitivity have emerged. To overcome the resistance of brown planthoppers to insecticides such as imidacloprid, phenylpyrazole (fipro) insecticides targeting the γ-aminobutyric acid (GABA)-gated chloride ion channels in the insect's central nervous system, such as fipronil and acetamiprid, have been widely used for the control of brown planthoppers. It has been reported that field populations in China have developed moderate resistance to fipronil (23.8-43.3 times resistance) and cross-resistance to acetamiprid (47.1-100.9 times) (References 1-2). With the overuse of acetamiprid, the problem of acetamiprid resistance has become increasingly serious. In 2013, Thailand reported a high level of resistance (308.5 times) to acetamiprid in field brown planthoppers (Reference 3). Therefore, in order to more effectively use acetamiprid to control brown planthoppers, it is particularly urgent to establish a simple, rapid, and reliable detection technology for acetamiprid-resistant brown planthoppers.

[0004] The main monitoring techniques for insect pesticide resistance include bioassay techniques, biochemical detection techniques, and molecular marker techniques. Among these, molecular marker techniques offer advantages over morphological markers, cytological markers, and biochemical markers, such as high stability, minimal susceptibility to environmental conditions, high information content, and broad comparability across different levels and groups. In recent years, molecular marker techniques have also been applied in insect pesticide resistance research. Many studies have reported the use of molecular marker techniques for the molecular detection of resistance gene mutations in resistant insect strains.

[0005] Allele-specific PCR (AS-PCR) was first established by Newton et al. to detect known mutations. The working principle of AS-PCR is as follows: When designing AS-PCR primers, the 3' nucleotides of the two downstream primers for each allele differ. When the two primers specifically amplify the wild-type and mutant types respectively, the downstream primer that does not perfectly match the template will not form a complete complementary base pair, resulting in a mismatch. On the one hand, the mismatched bases affect product elongation; on the other hand, the mismatched bases change the annealing temperature of the allele variant, ultimately leading to differences in amplification effects between different genotypes. Detecting these differences confirms the genotype. This method has been used in medicine to detect point mutations in various diseases. AS-PCR is one of the most accurate technical tools for genetic disease diagnosis and has also made significant contributions to cancer / genetic disease screening and targeted therapy. Its main advantages are ease of operation, speed, high sensitivity, and relatively low equipment cost. The high specificity requirement of AS-PCR: From the principle of AS-PCR, this detection method requires a high degree of specificity from the PCR system. To ensure specificity, we can start from the following two aspects: (1) Optimize primer design: One common method is to introduce more than one mismatched base, usually at the second or third to last position of the 3' end, which works together with the terminal mismatched base to significantly reduce the number of non-complementary amplification products; at the same time, reduce the number of PCR amplification cycles, because increasing the number of cycles will increase the probability of false positive results. (2) Adjust the relevant components in the reaction system to improve the specificity of the reaction system.

[0006] Faced with pesticide resistance, effective solutions are still lacking. The only feasible approach is to adopt proactive resistance management strategies to slow down the rate of resistance development as much as possible. Such proactive and effective resistance management strategies rely on rapid, sensitive, and accurate resistance monitoring technologies. Undoubtedly, the development of molecular detection and diagnostic technologies for early resistance in brown planthoppers will provide technical means for evaluating resistance management measures and providing early warnings of resistance risks. This will be of great significance in reducing pest damage, minimizing pesticide pollution, ensuring the quality of vegetables and rice products, and protecting public health.

[0007] Non-patent literature: Literature 1: Wang YH., Wu CX, Zhao XP, Chen LP, Yu RX, Cang T, Wu SG, WangQ. 2009. Current status of the pest resistance to Þpronil. Chin. Bull.Entomol. 46: 846-854. Document 2: Zhao X, Ning Z, He Y, Shen J, Su J, Gao C et al, Differentialresistance and cross-resistance to three phenylpyrazole insecticides in the planthopper Nilaparvata lugens (Hemiptera: Delphacidae). J Econ Entomol 104:1364– 1368 (2011). Literature 3: Punyawattoe P, Han ZJ, Sriratanasa W, Arunmit S, Chaiwong J andBullangpoti V, Ethiprole resistance in Nilaparvata lugens (Hemiptera:Delphacidae): possible mechanisms and cross-resistance. Appl Entomol Zool 48:205– 211 (2013). Summary of the Invention

[0008] This application provides a molecular detection method for insecticide resistance in brown planthoppers based on allele-specific PCR (AS-PCR) technology. Specifically, this invention establishes an allele-specific PCR detection system for insecticide-resistant brown planthoppers, designs and provides specific primers, and can be used for early and rapid molecular detection of insecticide resistance-related genes in brown planthopper populations.

[0009] Specifically, In a first aspect, the present invention provides a primer pair that detects and encodes the codon at position 414 of SEQ ID NO:10. The primer pair includes one upstream primer and two downstream primers, wherein the two downstream primers have different 3' ends and a mismatched base is introduced at the penultimate position of the 3' end.

[0010] Preferably, the primer pair includes: Upstream primer: 5'-GAGTTTACAGCAGGCGGAC (SEQ ID NO:1)-3'; Downstream primer: Rp: 5'-GCAGAATCGCGCTAGAAAGA(SEQ ID NO:2)-3'; Sp: 5'-GCAGAATCGCGCTAGAAAGG (SEQ ID NO: 3)-3'.

[0011] In one specific embodiment, the primer pair includes: Upstream primer: 5'-GAGTTTACAGCAGGCGGAC (SEQ ID NO:1)-3', Downstream primer: Rp: 5'-GCAGAATCGCGCTAGAAAGA (SEQ ID NO: 2)-3'; and, Upstream primer: 5'-GAGTTTACAGCAGGCGGAC (SEQ ID NO:1)-3', Downstream primer: Sp:5'-GCAGAATCGCGCTAGAAAGG(SEQ ID NO:3)-3'.

[0012] Preferably, the primer pair can be used to detect the resistance of brown planthoppers to insecticides.

[0013] Preferably, the insecticide includes benzimidazole agents; more preferably, the benzimidazole agents include, but are not limited to, acetamiprid, fipronil, and tebufenozide.

[0014] In a second aspect, the present invention provides a kit comprising the primer pairs described above.

[0015] A third aspect of the present invention provides an application of the above-described primer pair or the above-described reagent kit, the application comprising: (1) To identify the resistance of brown planthoppers to insecticides, including benzylidene insecticides; (2) Control brown planthoppers or screen for insecticides for brown planthoppers.

[0016] Preferably, the benzimidazole insecticides include, but are not limited to, acetamiprid, butafenone, and fipronil.

[0017] Preferably, step (1) includes determining whether the brown planthopper is sensitive to insecticides based on the test results. If a band appears after amplification of the Sp primer pair and no band appears after amplification of the Rp primer pair, it is a wild-type homozygous brown planthopper that is sensitive to insecticides. If a band appears after amplification of the Rp primer pair and no band appears after amplification of the Sp primer pair, it is a mutant homozygous brown planthopper that is resistant to insecticides. If bands appear after amplification of both the Sp primer pair and the Rp primer pair, it is a heterozygous brown planthopper whose resistance to insecticides is between that of the two homozygous brown planthoppers.

[0018] Preferably, in (2) based on the results of (1), a) if the brown planthopper is a non-homozygous mutant brown planthopper population, then benzylpyrazole insecticides can be applied or the number of applications of benzylpyrazole insecticides can be reduced; b) If the brown planthopper population is homozygous mutant or is the dominant population, then apply insecticides other than benzylidene pyrazole. Preferably, the non-homozygous mutant brown planthopper includes the non-mutant type or the 414S / 414F heterozygous type; Preferably, the dominant population of homozygous mutant brown planthoppers means that at least one-quarter, for example, more than one-half, of the brown planthoppers are homozygous mutant brown planthoppers.

[0019] In a fourth aspect, the present invention provides a method for identifying the resistance of brown planthoppers to insecticides, the method comprising detecting the genes of brown planthoppers using the primer pairs or the kits described above.

[0020] Preferably, the identification method includes determining whether the brown planthopper is sensitive to insecticides based on electrophoretic detection results, wherein if a band appears after amplification of the Sp primer pair, then the amino acid at position 414 of SEQ ID NO:10 is serine (S); if a band appears after amplification of the Rp primer pair, then the amino acid at position 414 of SEQ ID NO:10 is phenylalanine (F).

[0021] Preferably, if the Sp primer pair produces a band after amplification but the Rp primer pair does not, the planthopper is a wild-type homozygous brown planthopper, which is sensitive to insecticides; if the Rp primer pair produces a band but the Sp primer pair does not, the planthopper is a mutant homozygous brown planthopper, which is resistant to insecticides; if both the Sp and Rp primer pairs produce bands, the planthopper is a heterozygous brown planthopper, whose resistance to insecticides is between that of the two homozygous brown planthoppers.

[0022] Preferably, the identification method includes: 1) Total DNA extracted from brown planthoppers; 2) Using the primer pair, PCR amplification was performed with crude DNA extract as a template to obtain the amplification product; 3) Perform electrophoretic detection on the amplification products.

[0023] Preferably, the PCR reaction system comprises: .

[0024] Preferably, the DNA polymerase premix comprises Taq DNA polymerase, PCR buffer, dNTPs, and MgCl2.

[0025] Preferably, the PCR reaction conditions include: Pre-denaturation at 98℃ for 30 seconds; denaturation at 98℃ for 5 seconds; annealing at 60℃ for 34 seconds, for a total of 30 cycles; termination temperature is 4℃.

[0026] Preferably, the insecticide includes benzimidazole insecticides; more preferably, the benzimidazole insecticides include, but are not limited to, acetamiprid, fipronil, and tebufenozide.

[0027] In a fifth aspect, the present invention provides a method for controlling brown planthoppers, the method comprising controlling brown planthoppers based on the results of the identification method described above. 1) If the brown planthopper population is a non-homozygous mutant brown planthopper, then benzylpyrazole insecticides can be applied or the frequency of application of benzylpyrazole insecticides can be reduced; 2) If the brown planthopper population is a homozygous mutant or the homozygous mutant brown planthopper is the dominant population, then apply insecticides other than benzylidene.

[0028] Preferably, the non-homozygous mutant brown planthopper includes the non-mutant type or the 414S / 414F heterozygous type; Preferably, the dominant population of homozygous mutant brown planthoppers means that at least one-quarter, for example, more than one-half, of the brown planthoppers are homozygous mutant brown planthoppers.

[0029] Preferably, the benzimidazole insecticide includes acetamiprid, butafenone, or fipronil.

[0030] In a sixth aspect, the present invention provides a method for screening insecticides for brown planthoppers, the screening method comprising: 1) Based on the results of the above identification methods, and using the principles of genetics, homozygous mutant brown planthopper populations and wild-type homozygous brown planthopper populations were separated. 2) Apply candidate insecticides to homozygous mutant brown planthopper populations and wild-type homozygous brown planthopper populations, and screen for insecticides that have no difference in toxicity to the two populations or are more toxic to the homozygous mutant brown planthopper populations. The candidate insecticides do not include benzirazole insecticides.

[0031] Preferably, the benzimidazole insecticide includes acetamiprid, butafenone, or fipronil.

[0032] Those skilled in the art will understand that, due to the coding correspondence between genes and proteins (enzymes), the aforementioned 414th site can sometimes be understood as a description of a gene and sometimes as a description of a protein (enzyme), but those skilled in the art can clearly infer its meaning from the context.

[0033] The technical effects of this invention are as follows: Based on the findings in CN119286810A that the S414F mutation in the CYP6CW1 gene plays a major driving role in acetamiprid resistance, this invention designs PCR primers based on the As-PCR principle using the codon sequence of the mutation site, achieving specific amplification of wild-type and mutant strains respectively. Furthermore, preliminary work was done in (1) optimizing primer design and (2) adjusting relevant components in the reaction system to improve its specificity, resulting in optimized primer pairs, PCR amplification system, annealing temperature, and PCR amplification conditions. Using these primer pairs, brown planthoppers resistant to benzimidazole insecticides can be identified.

[0034] Specifically, this invention establishes an allele-specific PCR (AS-PCR) detection method for acetamiprid-resistant brown planthoppers, enabling rapid and large-scale early detection of target brown planthoppers. The detection time of this invention is less than 5 hours. The AS-PCR agarose gel electrophoresis method requires only 10-50 brown planthoppers per population for testing, regardless of the planthopper's age. One person can complete the testing of several or even a dozen populations. In contrast, traditional live-testing methods require at least 3 days. If enough nymphs of the same age cannot be collected at once, at least one generation (approximately one month) of rearing is required before testing. Furthermore, each population requires at least 200-300 third- or fourth-instar nymphs, necessitating multiple people to complete the testing. The method of this invention features short detection time, low manpower requirements, small sample size, large sample volume, and high accuracy.

[0035] The above only summarizes some aspects of the present invention and is not, and should not be considered as limiting the present invention in any way.

[0036] All patents and publications mentioned in this specification are incorporated herein by reference in their entirety. Those skilled in the art will recognize that certain modifications may be made to this invention without departing from its spirit or scope. The following embodiments further illustrate the invention in detail and should not be construed as limiting the scope of the invention or the specific methods described herein. Attached Figure Description

[0037] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein: Figures 1A-1D Screening of As-PCR primers and testing of amplification specificity; among which Figure 1A and Figure 1B The results of the first set of As-PCR primers under different amplification systems and conditions are shown below. Figure 1C The results for the second set of As-PCR primers; Figure 1D This is the result of the third set of As-PCR primers.

[0038] Figure 2As-PCR molecular detection of brown planthopper populations in Jiangxi fields.

[0039] Figure 3 Brown planthoppers were screened five times with acetaminophen and then detected by As-PCR.

[0040] Figure 4 Brown planthoppers were screened for six times using acetaminophen, followed by As-PCR molecular detection. Detailed Implementation

[0041] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0042] Example 1: Design of allele-specific PCR primer sequences for detecting acetamiprid resistance I. Obtaining the sequence and resistance mutation point (see Chinese patent application No. 2024118475738, which is incorporated herein by reference in its entirety). Cloned from field populations CYP6CW1 The gene sequence revealed a polymorphism, S414F, at amino acid position 414. Transgenic fruit flies have been constructed, and it has been verified that the S414F mutation results in overexpression of acetamiprid resistance. CYP6CW1 The transgenic fruit flies with the unmutated gene sequence showed a metabolism rate more than 100 times higher than those with the unmutated sequence. Insecticide metabolism assays on the transgenic fruit flies also demonstrated that the fruit flies overexpressing the S414F mutation had a significantly enhanced metabolic capacity for insecticides such as acetamiprid and imidacloprid compared to those overexpressing the non-mutated sequence, proving... CYP6CW1 The S414F gene mutation is crucial for the development of pesticide resistance. Therefore, this invention primarily constructs a molecular detection method for the S414F mutation site to detect pesticide resistance in brown planthoppers.

[0043] II. Primer Design Methods and Principles: Based on the S414F mutation... CYP6CW1 Based on the principles of allele-specific PCR, several primer pairs were designed using the codon sequences in the gene. Each primer pair contains one upstream primer and two downstream primers, Sp and Rp. The following principles must be followed: 1. The upstream primer is designed upstream of the mutation site and compared with the CYP6CW1 sequence of each clone obtained from the field population. The upstream primer is located in a place without base polymorphism, that is, in a place where the base sequences of each clone are consistent.

[0044] 2. Place the codon of the mutation site at the 3' end of the downstream primer. The downstream primer Sp does not contain the mutation, that is, the 3' end of the downstream primer is the wild-type codon; the 3' end of the downstream primer Rp is the mutant codon. 3. Introduce a mismatched base at the third or second to last position from the 3' end. This base, together with the terminal mismatched base, significantly reduces the amount of non-complementary amplification products. 4. The downstream primers Sp and Rp are identical except for the 3' end, and their pairing with the target DNA fragment must be precise and strict. 5. The percentages of G+C base pairs in the two primers should be as similar as possible; 6. Primers should avoid having obvious secondary structures inside; 7. There should be no complementary sequences between the two primers to avoid the formation of "primer dimers"; 8. Specific primers should have a certain annealing temperature (not less than 50℃) and a certain length (not less than 20 bp).

[0045] III. Results: Based on the obtained sequences and resistance-related mutation points, primers were designed, resulting in three primer pairs. The primer pair sequences are as follows: Group 1: The upstream primer sequence is as described in SEQ ID NO:1, namely: 5'-GAGTTTACAGCAGGCGGAC(SEQ ID NO:1)-3'; The downstream primer sequences are as described in SEQ ID NO:2 and SEQ ID NO:3, namely: Rp: 5'-GCAGAATCGCGCTAGAAAGA (SEQ ID NO:2)-3'; Sp: 5'- GCAGAATCGCGCTAGAAAGG (SEQ ID NO:3)-3'. The core principle of this primer design is to place the codon of the mutation site at the 3' end of the downstream primer, and then introduce a mismatched base (T replaced by A) at the third-to-last position of the 3' end of the downstream primer, which works together with the terminal mismatched base.

[0046] The second set of primers consists of the upstream primer sequence as described in SEQ ID NO:1, namely: 5'-GAGTTTACAGCAGGCGGAC (SEQ ID NO:1)-3'; and the downstream primer sequences as described in SEQ ID NO:4 and SEQ ID NO:5, namely: Rp: 5'-GCAGAATCGCGCTAGAATCA (SEQ ID NO:4)-3'; Sp: 5'-GCAGAATCGCGCTAGAATCG (SEQ ID NO:5)-3'. The core principle of this primer design is to place the codon of the mutation site at the 3' end of the downstream primer, and then introduce a mismatched base (G replaced by C) at the penultimate position of the 3' end of the downstream primer, which works together with the terminal mismatched base.

[0047] The third group: The upstream primer sequence is as described in SEQ ID NO:1, namely: 5'-GAGTTTACAGCAGGCGGAC (SEQ ID NO:1)-3'; the downstream primer sequences are as described in SEQ ID NO:6 and SEQ ID NO:7, namely: Rp: 5'-GCAGAATCGCGCTAGAACGA (SEQ ID NO:6)-3'; Sp: 5'- GCAGAATCGCGCTAGAACGG (SEQ ID NO:7)-3'. The core principle of this primer design is to place the codon of the mutation site at the 3' end of the downstream primer, and then introduce a mismatched base (T replaced by C) at the third-to-last position of the 3' end of the downstream primer, which works together with the terminal mismatched base.

[0048] Example 2: Screening suitable As-PCR primers and testing the amplification specificity of primers (1) Single-head conventional PCR detection and sequencing 1) Select 10 brown planthoppers from the field population and extract crude DNA from each planthopper, specifically: Place a single brown planthopper into a 1.5 mL centrifuge tube, add 30 μL of lysis buffer from the M5 Superspeed Mix kit, and grind with a grinder for 20 seconds. Use a new sterile grinder for each sample. Boil in water or place in a high-temperature bath for 5 minutes, then centrifuge at 12,000 rpm for 4 minutes. Transfer the supernatant to a PCR tube for storage. Use 2.0–2.5 μL as PCR template. Store the remaining crude extract at -20°C.

[0049] 2) Design a pair of primers to amplify the 414 mutation site based on the CYP6CW1 gene sequence and the location of the 414 mutation site. The primer sequences are as follows: C-414-F: CAGGCTTACGACATAGAAATGAC (SEQ ID NO: 8); C-414-R:GATCCAAGTGAATGCCGATAAC (SEQ ID NO:9).

[0050] Using single-head crude DNA extract as a template, the DNA fragment containing the 414 mutation site was amplified by PCR and sent to Beijing Sangon Biotech Co., Ltd. for sequencing.

[0051] 3) Based on the sequencing data, identify and select three crude DNA extracts (e.g., homozygous wild-type, heterozygous, and homozygous mutant) for the 414 mutation site. Figures 1A-1D The sequencing map showing the location of the mutation sites is shown.

[0052] (2) As-PCR verification 1) Using these three crude DNA extracts as templates, PCR amplification was performed using the upstream and midstream primers and Sp from the three sets of As-PCR primers designed in this invention as a primer pair, and the upstream primer and Rp as a primer pair, respectively. The amplification system and method were the same as described in this invention. In screening suitable As-PCR primer sets, suitable PCR amplification systems, amplification conditions, and agarose gel electrophoresis detection methods in this invention, some screening work was carried out. Figure 1 shows the DNA agarose gel electrophoresis detection results under each As-PCR primer set, PCR amplification system, amplification conditions, and detection conditions. First, the first primer pair, namely the upstream primer, downstream primer Rp and Sp (… Figure 1A and Figure 1B The second primer pair consists of the same upstream primer as in this invention, and the downstream primers Rp and Sp differ from those in this invention in that in this invention, the third-to-last base from the 3' end of Rp and Sp is replaced with an A, while here the second-to-last base from the 3' end of G is replaced with a C. Figure 1C The third primer pair has the same upstream primer as in this invention. The difference between the downstream primers Rp and Sp and those in this invention is that in this invention, the T at the third-to-last base from the 3' end of Rp and Sp is replaced with A, while here the T at the third-to-last base from the 3' end is replaced with C. Figure 1D ).

[0053] Secondly, based on the As-PCR primers (first group) used in this invention, other commonly used PCR amplification systems and PCR amplification conditions were first tried. Figure 1AThe PCR amplification system and conditions used are as follows: 10 µL DNA polymerase premix, 1 µL 10 µM upstream primer, 1 µL 10 µM downstream primer (Sp or Rp), 2.5 µL crude DNA extract, and H2O to a total volume of 20 µL. PCR reaction conditions: 98 °C pre-denaturation for 30 s; 98 °C denaturation for 5 s, 60 °C annealing for 34 s, for a total of 40 cycles; termination temperature is 4 °C. Under these PCR amplification system and conditions, homozygous wild-type, heterozygous mutant, and homozygous mutant types could not be specifically distinguished. Therefore, the PCR amplification system and conditions were further optimized, resulting in the PCR amplification system and conditions used in this invention. The PCR reaction system includes: 10 µL DNA polymerase premix, 0.6 µL 10 µM upstream primer, 0.6 µL 10 µM downstream primer (Sp or Rp), 2.5 µL crude DNA extract, and H2O to a total volume of 20 µL. The DNA polymerase premix comprises Taq DNA polymerase, PCR buffer, dNTPs, and MgCl2. The PCR reaction conditions include: Pre-denaturation at 98℃ for 30 seconds; denaturation at 98℃ for 5 seconds; annealing at 60℃ for 34 seconds, for a total of 30 cycles; termination temperature is 4℃. Figure 1B The detection pattern obtained using the optimized PCR amplification system, PCR amplification conditions, and the first set of primers.

[0054] 2) Take 2.0 µL of the amplification product, mix it with 1.0 µL of 6× loading buffer, spot it into a 1.0% agarose gel, and electrophoresis it in 1× TAB buffer at 5 V / cm. After electrophoresis, take a picture on an automated gel imaging system. Figure 1A The primer pairs used in this invention, as clearly seen in electrophoresis, show that when homozygous wild-type, the Sp primer amplifies a bright band, but the Rp primer also amplifies a faint band. Therefore, this invention ultimately adjusted the PCR amplification system and conditions, adjusting the primer concentration to 0.6 µL and the PCR cycle to 30 cycles, finally obtaining the optimal conditions in this invention. Figure 1B Comparison Figure 1C Electrophoresis results showed that primers designed based on the principle of mismatched second-to-last base at the 3' end could not produce amplification products. (Control) Figure 1D The results showed that primers designed based on the principle of replacing the third-to-last T base at the 3' end with C, although yielding amplification products, could not distinguish between homozygous wild-type, heterozygous mutant, and homozygous mutant (the As-PCR electrophoresis verification results were compared with the single-head conventional PCR sequencing results, see [link to single-head conventional PCR sequencing results]). Figure 1B (Partial diagram of medium base nucleotide peaks).

[0055] result( Figure 1B The results showed that, using crude DNA extract from the homozygous wild-type 414 mutation site as a model, the Sp primer amplified a band, while the Rp primer did not; using crude DNA extract from the homozygous 414 mutation site as a model, the Sp primer amplified no band, only the Rp primer amplified a band; and using crude DNA extract from the heterozygous 414 mutation site as a model, both the Sp and Rp primers amplified bands. The As-PCR electrophoresis results were consistent with the single-head conventional PCR sequencing results. Figure 1B This invention demonstrates that using the primers designed in this invention, along with the optimized PCR amplification system and conditions, and using crude DNA extract from a single brown planthopper as a template, it is possible to distinguish between three genotypes: wild-type, heterozygous, and homozygous at the 414 mutation site. This method can be used for the identification of acetamiprid-resistant brown planthoppers in the field.

[0056] In summary, through preliminary experiments, primers SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, along with the PCR amplification system and conditions described in this invention, were screened. Combined with the PCR amplification system and conditions of this invention, the advantages of these primers are: the upstream and downstream primers Sp can only specifically amplify the wild type; the upstream and downstream primers Rp can only specifically amplify the mutant type; and the amplified bands are clear, the amplification is stable, and the repeatability is good. Identification showed that the detection results for the CYP6CW1 S414F mutant genotype in the brown planthopper were consistent with those obtained using conventional PCR sequencing. Figure 1B ).

[0057] Example 3: As-PCR primers were used to detect the frequency of acetaminophen-resistant brown planthoppers. I. Materials: A number of brown planthopper nymphs were collected from the field in Jiangxi Province in October 2023 and stored in an ultra-low temperature freezer at -80℃.

[0058] Brown planthopper screening populations with acetonitrile: 2023 field populations in Jiangxi Province were screened using acetonitrile LC50. 50 or LC 70 The populations after 5 and 6 concentration screenings (see the test population materials in Example 4 for specific screening concentrations) were raised on rice seedlings in nylon cages in a greenhouse at an ambient temperature of 27±1℃, a relative humidity of 60%-70%, and a photoperiod of light:dark = 16h:8h.

[0059] II. Method: 1. Extraction of crude DNA from brown planthopper: Select 10-50 nymphs or adults (remove abdomen from females) of the brown planthopper and place them individually into a 1.5 mL centrifuge tube. Add 30 μL of lysis buffer from the M5 Superspeed Mix kit and grind with a grinder for 20 seconds. Use a new sterile grinder for each sample. Boil in water or place in a high-temperature bath for 5 minutes, then centrifuge at 12,000 rpm for 4 minutes. Transfer the supernatant to a PCR tube for storage. Use 2.0-2.5 μL as PCR template. Store the remaining crude extract at -20°C.

[0060] 2. The As-PCR primers mentioned above were synthesized by Beijing Sangon Biotech Co., Ltd.

[0061] 3. As-PCR amplification: The PCR reaction system consists of the following components per 20µL: 10µL DNA polymerase premix; 0.6µL 10µM upstream primer; 0.6µL 10µM downstream primer (Sp or Rp); 2.5µL crude DNA extract; and the remainder is H2O.

[0062] The As-PCR reaction conditions are as follows: pre-denaturation at 98℃ for 30 seconds; denaturation at 98℃ for 5 seconds, annealing at 60℃ for 34 seconds, for a total of 30 cycles; termination temperature is 4℃.

[0063] 4. Electrophoresis detection: Take 2.0 µL of the amplification product from step 3, mix it with 1.0 µL of 6× loading buffer, spot it onto a 1.0% agarose gel, and electrophores it in 1× TAB buffer at 5 V / cm. After electrophoresis, take a picture on an automated gel imaging system.

[0064] 5. Mutation frequency of mutant gene = [(number of homozygous resistance types × 2) + (heterozygous resistance types × 1)] / (number × 2).

[0065] Following the above method, 11 brown planthoppers from a field population in Jiangxi Province were tested. Figure 2 (Numbers 1-11) After screening 5 generations of brown planthoppers with acetamiprid, the population was 10 individuals. Figure 3 After screening with acetamiprid (numbered 1-10) and brown planthoppers for 6 generations, the population was 10 individuals. Figure 4 As-PCR was performed on samples numbered 1-10. Electrophoresis results are shown in [Figure number missing]. Figure 2 , Figure 3 and Figure 4 . Figure 2 and Figure 3 In the electrophoresis detection, the DNA marker is the full-gold Trans2KⓇ DNA Marker. Figure 4 The DNA marker used in the electrophoresis detection is the full-gold TransDNA Marker II.

[0066] 6. For the above samples, single-head conventional PCR detection and sequencing were used for verification (see Example 2 for the method), and the frequency of the S414F mutation was calculated. The calculation method is as described in 5.

[0067] The results are shown in Table 1. Brown planthopper populations in Jiangxi Province... CYP6CW1 The frequency of the homozygous genotype of the S414F gene mutation was 27.3%, and the heterozygous genotype was 36.3%, with a mutation frequency of 45.5%. In 2023, acetonitrile LC50 was used in field populations in Jiangxi. 50 or LC 70 After 5 concentration screenings CYP6CW1 The frequency of the homozygous genotype for the S414F gene mutation was 80%, and the frequency of the heterozygous genotype was 10%, with a total S414F mutation frequency of 85.0%. After six more rounds of screening... CYP6CW1 The frequency of the homozygous genotype of gene S414F mutation was 90%, and the frequency of the heterozygous genotype was 10%, with a mutation frequency of 95.0%. The frequencies of wild type, homozygous 414F mutation, and heterozygous 414F mutation in each population, as well as the calculated mutation frequencies, were consistent with those obtained using single-head conventional PCR. Sanger sequencing The data obtained were the same, indicating that the accuracy of resistance mutation detection using the PCR amplification system and PCR amplification conditions of this invention is 100%.

[0068] Table 1. Genotypes and mutation frequencies of acetaminophen resistance mutants in brown planthopper populations detected by As-PCR

[0069] Example 4: Differences in sensitivity of field populations and acetamiprid-screened populations in Jiangxi Province to several benzylidene insecticides. To further clarify the relationship between the frequency of the homozygous S414F mutant genotype of the CYP6CW1 gene and the resistance level of benzylidene insecticides, and to improve the guidance for controlling brown planthopper populations in the field by using As-PCR detection of the S414F mutant frequency, this invention also verified the relationship between the differences in sensitivity to several benzylidene insecticides and the frequency of the S414F mutant genotype in field populations and acetamiprid-selected populations in Jiangxi Province using the As-PCR detection and toxicity determination methods of this invention. This facilitates the guidance for controlling brown planthopper populations in the field.

[0070] I. Materials of the tested population: A number of brown planthopper nymphs were collected from the field in Jiangxi Province in October 2023. They were cultured in TN1 rice seedlings for 1-2 generations indoors without contact with any insecticides for insecticide bioassay. The ambient temperature was 27±1℃, the relative humidity was 60%-70%, and the photoperiod was light:dark = 16h:8h.

[0071] Brown planthopper screening populations with acetonitrile: 2023 field populations in Jiangxi Province were screened using acetonitrile LC50. 50 or LC 70 Populations after 2, 4, 5, and 6 generations of concentration subculture selection (LC was used in the first and second generations). 70 Concentration screening was performed at a concentration of 120.7 mg / L; subsequently, the previous generation LC was used. 50 Concentrations were screened, with the third and fourth screenings using a concentration of 265.5 mg / L; the fifth screening used 518 mg / L; and the sixth screening used 1238 mg / L. Rice seedlings were raised in nylon cages in a greenhouse at an ambient temperature of 27±1℃ and a relative humidity of 60%-70%, with a photoperiod of light:dark = 16h:8h.

[0072] II. As-PCR Detection The primers, detection methods, and systems described in this invention were used to perform A-PCR detection on individual brown planthoppers in each population to calculate the frequency of the 414F homozygous mutant and the 414F mutation frequency. 10-20 individuals were monitored in each population. The frequency of the 414F homozygous mutant = number of homozygous resistance types / total number of individuals. The mutation frequency of the mutant gene = [(number of homozygous resistance types × 2) + (heterozygous resistance types × 1)] / (number of individuals × 2). III. Bioassay Methods: The bioassay method used to determine the toxicity of various insecticides to brown planthoppers was the rice seedling immersion method, as specified in the national industry standard "Technical Regulations for Monitoring the Resistance of Brown Planthoppers in Rice" (NY / T1708-2009).

[0073] (1) The technical grade pesticides of acetamiprid, fipronil, and tebufenozide were completely dissolved in acetone to a clear liquid; the pesticides were diluted to a series of gradient concentrations with deionized water containing 1‰ Triton X-100 adjuvant. Deionized water containing 1‰ Triton X-100 adjuvant was used as the control group.

[0074] (2) Select about 20 robust TN1 seedlings that are 10 days old. Wash the roots to remove soil and impurities. Wrap the young roots with sterile absorbent cotton and immerse them in the corresponding concentration of the drug solution for 30 seconds. Place them in transparent plastic cups (bottom diameter = 5cm, height = 7.5cm). Inoculate each cup with 20 third-instar nymphs and seal with 200-mesh nylon netting. After 2 hours, remove any individuals that were mechanically damaged during the transfer process. Each treatment was repeated three times. After completion, place the device in a constant temperature artificial climate chamber with a temperature of (27±1)℃, humidity of 70%, and photoperiod L:D = 16h:8h. Check and record the mortality of each drug treatment group after 96 hours.

[0075] Table 2. Differences in sensitivity of field populations and acetamiprid-screened populations in Jiangxi Province to several benzylidene insecticides.

[0076] Note: Relative resistance multiple = LC50 of the acetonitrile screening population 50 Value / Jiangxi field population LC 50 value.

[0077] The results are shown in Table 2. Before screening with acetonitrile, the LC50 of field populations in Jiangxi Province in 2023 showed the following results: [Table 2 shows the results of LC50 of acetonitrile, fipronil, and butafenone]. 50 The values ​​were 60.0 mg / L, 45.20 mg / L, and 75.8 mg / L, respectively. The LC-MS concentrations of acetonitrile were applied to field populations in Jiangxi Province in 2023. 50 or LC 70 LC-15 of the population after 6 concentration screenings against acetonitrile, fipronil, and tebufenozide 50 The values ​​were 2677.3 mg / L, 1922.473 mg / L, and 3704.2 mg / L, respectively, representing resistance multiples of 44.6, 42.5, and 48.9 times that of the original 2023 field population in Jiangxi. Based on the results of Example 3, the resistant population at this time... CYP6CW1 The frequency of homozygous S414F mutant genotypes increased from 27.3% in the field population to 90%; the S414F mutation frequency increased from 45.5% to 95%. These results indicate... CYP6CW1 The S414F gene mutation was highly correlated with resistance to the benzylazoline insecticides acetamiprid, fipronil, and tebufenozide. Furthermore, comparisons were made before selection and after 2, 4, 5, and 6 selection cycles. CYP6CW1 The frequency of homozygous S414F mutant genotypes, the frequency of S414F mutation, and the differences in susceptibility to acetamiprid in populations before selection and after 2, 4, 5, and 6 selections were analyzed. The results indicate... ， CYP6CW1 The frequency of homozygous S414F mutant genotypes contributes significantly to resistance to acetamiprid, with... CYP6CW1 The increased frequency of homozygous S414F mutant genotypes in a population correlates with the LC50 of acetonitrile. 50 The value increased rapidly. Based on these results, it is recommended that [the following measures be taken] in the brown planthopper population. CYP6CW1 When the frequency of homozygous S414F mutant genotypes exceeds one-quarter (i.e., the frequency of homozygous S414F mutant genotypes in Jiangxi field populations in 2023), it is necessary to rotate the use of benzimidazole insecticides with other types of insecticides or to prohibit the use of benzimidazole insecticides in order to reduce the number of times benzimidazole insecticides are used each quarter.

[0078] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0079] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0080] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A primer pair, characterized in that, The primer pair is used to detect the codon at position 414 of SEQ ID NO:

10. The primer pair includes one upstream primer and two downstream primers. The two downstream primers have different 3' ends, and a mismatched base is introduced at the third to last position of the 3' end.

2. The primer pair according to claim 1, characterized in that, The primer pairs include: Upstream primer: 5'-GAGTTTACAGCAGGCGGAC (SEQ ID NO:1)-3'; Downstream primer: Rp: 5'-GCAGAATCGCGCTAGAAAGA(SEQ ID NO:2)-3'; Sp: 5'-GCAGAATCGCGCTAGAAAGG (SEQ ID NO: 3)-3'.

3. A reagent kit, characterized in that, The kit comprises the primer pair as described in any one of claims 1-2.

4. The application of any primer pair according to claims 1-2 or the kit according to claim 3, characterized in that, The applications include: (1) To identify the resistance of brown planthoppers to insecticides, including benzylidene insecticides; (2) Control brown planthoppers or screen for insecticides for brown planthoppers.

5. A method for identifying the resistance of brown planthoppers to insecticides, characterized in that, The identification method includes detecting the genes of the brown planthopper using the primer pairs described in any one of claims 1-2 or the kit described in claim 3.

6. The identification method according to claim 5, characterized in that, The identification method includes determining whether brown planthoppers are sensitive to insecticides based on electrophoretic detection results. Specifically, if a band appears after amplification with the Sp primer pair but no band appears after amplification with the Rp primer pair, it is a wild-type homozygous brown planthopper, sensitive to insecticides; if a band appears after amplification with the Rp primer pair but no band appears after amplification with the Sp primer pair, it is a mutant homozygous brown planthopper, resistant to insecticides; if bands appear after amplification with both the Sp and Rp primer pairs, it is a heterozygous brown planthopper, with insecticide resistance intermediate between the two homozygous brown planthopper types. The insecticides mentioned include benzylidene insecticides.

7. The identification method according to any one of claims 5-6, characterized in that, The identification method includes: 1) Total DNA extracted from brown planthoppers; 2) Using the primer pair, PCR amplification was performed with crude DNA extract as a template to obtain the amplification product; 3) Perform electrophoretic detection on the amplification products.

8. The identification method according to claim 7, characterized in that, The PCR reaction system includes: The PCR reaction conditions include: Pre-denaturation at 98℃ for 30 seconds; denaturation at 98℃ for 5 seconds; annealing at 60℃ for 34 seconds, for a total of 30 cycles; termination temperature is 4℃.

9. A method for controlling brown planthoppers, characterized in that, The control method includes using the results of the identification method according to any one of claims 5-8 to control brown planthoppers. 1) If the brown planthopper population is a non-homozygous mutant brown planthopper, then benzylpyrazole insecticides can be applied or the frequency of application of benzylpyrazole insecticides can be reduced; 2) If the brown planthopper population is a homozygous mutant or is dominated by a homozygous mutant, then apply insecticides other than benzylidene pyrazole. The non-homozygous mutant brown planthopper includes the non-mutant type or the 414S / 414F heterozygous type; The term "dominant population of homozygous mutant brown planthoppers" means that at least one-quarter of the brown planthoppers are homozygous mutant brown planthoppers.

10. A method for screening an insecticide for brown planthoppers, characterized in that, The screening method includes 1) Based on the identification method according to any one of claims 5-8, homozygous mutant and wild-type homozygous brown planthopper populations were separated. 2) Apply candidate insecticides to homozygous mutant brown planthopper populations and wild-type homozygous brown planthopper populations, and screen for insecticides that have no difference in toxicity to the two populations or are more toxic to the homozygous mutant brown planthopper populations. The candidate insecticides do not include benzirazole insecticides.

Images