Pig-derived LOC106507823 gene detection target, primer probe, kit and digital PCR detection method

Abstract

The invention relates to the technical field of biological detection, and discloses a porcine-derived LOC106507823 gene detection target, a primer probe, a kit and a digital PCR (Polymerase Chain Reaction) detection method. The absolute quantitative characteristic of ddPCR overcomes the dependence of qPCR on a standard curve, stable detection can still be realized in a complex matrix (such as processed food), and high-throughput, high-sensitivity and accurate quantitative detection of the swine-derived components is realized. The authenticity of food label declaration can be verified and fraudulent behaviors can be attacked through accurate quantitative analysis of the pig-derived components; allergen harm is prevented, and food safety is guaranteed; feed safety is monitored; powerful molecular evidence is provided for species identification, forensic investigation and the like; a novel and reliable tool is provided for detecting the pig-derived components in meat and products thereof, and technical support is provided for food safety supervision and market order maintenance.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, and more specifically, to a detection target, primers, probes, kits, and digital PCR detection method for the porcine LOC106507823 gene. Background Technology

[0002] In today's food safety field, the authenticity testing of meat and its products is receiving increasing attention. Adulteration of meat not only harms consumers' economic interests but also poses potential threats to their health. Pork, due to its price advantage, is often mixed with beef and mutton. Therefore, developing efficient and accurate methods for detecting animal-derived components is of great significance for ensuring food safety and maintaining market order.

[0003] In recent years, with the continuous development of molecular biology techniques, digital PCR (ddPCR), as an emerging nucleic acid detection technology, has gradually become an important tool in food safety testing due to its high sensitivity, high specificity, and absolute quantification capability. While traditional quantitative PCR (qPCR) technology has been widely used in the detection of animal-derived components, it relies on a standard curve for relative quantification, which has certain limitations. In contrast, ddPCR technology disperses the sample into thousands of independent microreaction units, performs PCR amplification on each unit, and directly calculates the proportion of positive reaction units, thereby achieving absolute quantification of the target nucleic acid. This method not only improves the accuracy and reliability of detection but also reduces errors caused by inaccurate standard curves. Furthermore, ddPCR technology exhibits higher sensitivity when detecting low-abundance target nucleic acids, making it an ideal choice for detecting rare events and low-abundance components.

[0004] In porcine quantitative assays, selecting appropriate target genes is crucial. The applicant found that the LOC106507823 gene possesses a single copy in the genome, is highly conserved, and functionally important, thus considering it an ideal target gene. The expression level of the LOC106507823 gene is relatively stable across different samples, reducing quantitative errors caused by differences in gene expression levels. Furthermore, the single-copy nature of the LOC106507823 gene provides a significant advantage in absolute quantitative analysis, offering accurate copy number information and avoiding quantitative biases caused by multi-copy genes. Summary of the Invention

[0005] This invention addresses the shortcomings of existing technologies by providing a detection target, primers and probes, kits, and digital PCR detection method for the porcine LOC106507823 gene.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The application of the porcine LOC106507823 gene target in the preparation of digital PCR detection reagents for porcine components, wherein the porcine LOC106507823 gene target is shown in SEQ ID NO.1. Primer sets and probes designed using the porcine LOC106507823 gene target can provide a digital PCR detection method for porcine components.

[0008] Furthermore, the present invention also provides a primer set and probe for digital PCR detection of the porcine LOC106507823 gene target.

[0009] Preferably, the nucleotide sequences of the primer set and probe are as follows:

[0010] LOC-F: TGGTGAGTCCAACATCGACG;

[0011] LOC-R: CAGATTCAGGGAGAGAGGACAC;

[0012] LOC-P: GAAAGGAGCGGCGGCAGAGG.

[0013] Preferably, the nucleotide sequence of the probe is modified with a fluorescent reporter gene and a fluorescent quencher gene at both ends. Commonly used fluorescent reporter gene and fluorescent quencher gene pairs are as follows: FAM–TAMRA, HEX-BHQ1, Cy5-BHQ2, VIC-MGB-BHQ, ROX-BHQ2, FAM–DABCYL, FAM-BHQ1; preferred LOC-P: FAM-GAAAGGAGCGGCGGCAGAGG-BHQ1.

[0014] Furthermore, the present invention also provides a kit comprising the aforementioned primer set and probe.

[0015] Preferably, the kit includes the following PCR reaction system:

[0016] reagents Final concentration volume ddPCR Supermix for 2× 10.0μL 10 μmol / L forward primer 1.0 μmol / L 2.0μL 10 μmol / L reverse primer 1.0 μmol / L 2.0μL 10 μmol / L probe 0.5 μmol / L 1.0μL DNA template / 2.0μL sterile water / 3.0μL Total volume / 20.0μL

[0017] Furthermore, the present invention also provides the application of the primer set and probe or the kit in the detection of porcine components, especially in the detection of animal tissues and animal-derived products.

[0018] Furthermore, the present invention also provides a digital PCR detection method for porcine components. This method is not a disease diagnosis method. The method includes the following steps: extracting DNA from a sample, performing ddPCR detection on the extracted DNA, and using the primer set and probes for ddPCR detection.

[0019] As a preferred method, the reaction conditions for ddPCR detection are as follows:

[0020]

[0021] As a preferred method, the detection method is suitable for the detection of animal tissues and animal-derived products.

[0022] This invention provides a quantitative detection method for porcine components based on ddPCR. The absolute quantitative characteristics of ddPCR overcome the dependence of qPCR on a standard curve, and it can still stably detect porcine components in complex matrices (such as processed foods), achieving high-throughput, high-sensitivity, and accurate quantitative detection. Accurate quantitative analysis of porcine components can verify the authenticity of food label claims, combat fraud, prevent allergen hazards and ensure food safety, monitor feed safety, provide strong molecular evidence for species identification and forensic investigations, and provide a new and reliable tool for the detection of porcine components in meat and its products, offering technical support for food safety supervision and market order maintenance. Attached Figure Description

[0023] Figure 1 Electrophoresis image of pig genomic DNA (P: pig DNA, M: 250-10000bp Marker).

[0024] Figure 2 The graph shows the qPCR amplification curve of the extracted DNA.

[0025] Figure 3 This is one of the agarose gel electrophoresis images. Figure 3 A is the amplification electrophoresis diagram of sample H1 using primer pairs 1-18. Figure 3 B is the amplification electrophoresis diagram of the mixed sample H2 using primer pairs 1, 2, 3, 7, 9, 10, 11, 12, 16, and 17.

[0026] Figure 4 This is the second image from an agarose gel electrophoresis study. Figure 4 C is the amplification electrophoresis diagram of primer 9. Figure 4 D is the amplification electrophoresis diagram of primer 17.

[0027] Figure 5 Radar graphs showing the Ct values ​​obtained from amplifying six pig breeds using six pairs of primers. P1-P6 represent: Yantai pig, Greenja black pig, Duroc pig, Landrace pig, Pietrain pig, and Large White pig, respectively.

[0028] Figure 6 The amplification efficiency E and correlation coefficient R of 6 pairs of primers and probes. 2 2Ys bar chart - dotted line chart.

[0029] Figure 7 The droplet distribution diagram is used for digital PCR validation of 6 pairs of primer probes.

[0030] Figure 8 For species-specific qPCR amplification curves (pig, cattle, sheep, horse, chicken, duck, goose, pigeon, rabbit, fish, donkey, dog, deer, mouse, fox, quail, ddH2O).

[0031] Figure 9 The results are non-specific qPCR amplification curves for species (Yantai pig, Shaoxing pig, Pietrain pig, Greenjae black pig, Duroc pig, Landrace pig, Jinhua pig, ddH2O).

[0032] Figure 10 This is a droplet diagram showing the annealing temperature of ddPCR.

[0033] Figure 11 To optimize the droplet distribution map for primer-probe concentration ratio.

[0034] Figure 12 This is a map showing the specific droplet distribution of digital PCR for interspecies porcine genomes.

[0035] Figure 13 This is a diagram showing the distribution of nonspecific droplets in the digital PCR of porcine genomes within the same species.

[0036] Figure 14 For dynamic range testing (the logarithm of the predicted copy number is on the x-axis, and the logarithm of the measured copy number is on the y-axis).

[0037] Figure 15 This is a diagram showing the distribution of droplets in a simulated sample using digital PCR detection.

[0038] Figure 16 This is a qPCR amplification curve of a simulated sample.

[0039] Figure 17 The droplet distribution diagrams were used to verify commercially available samples (1-13 represent pork, beef balls 1, lamb skewers, beef balls 2, beef rolls 1, beef rolls 2, beef jerky 1, beef jerky 2, beef skewers, lamb rolls 1, lamb rolls 2, lamb balls, and ddH2O, respectively). Detailed Implementation

[0040] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the protection scope of the present invention.

[0041] 1. Materials and Methods

[0042] 1.1 Materials

[0043] The animal-derived tissues used in the experiment were provided by the Institute of Animal Husbandry, Zhejiang Academy of Agricultural Sciences.

[0044] 1.2 Nucleic acid extraction and its quality evaluation

[0045] Animal-derived components used in the experiment were extracted using an extraction kit from Hangzhou Xinjing Biotechnology Reagents. 1 μL of the extracted DNA solution was analyzed for DNA concentration using a Qubit 2.0 microscope, and purity and salt residue were determined using a NanoDrop 2000. The extracted porcine whole-genome DNA was subjected to agarose gel electrophoresis to assess genome integrity.

[0046] The extracted animal-derived DNA was diluted to 50 ng / ul. Following the requirements of GB / T 38164-2019 "Real-time Fluorescent PCR Method for Detection of Animal-derived DNA from Common Livestock and Poultry," the animal-derived DNA was verified to be correct and to check for cross-contamination.

[0047] 1.2 Bioinformatics Analysis and Primer Design

[0048] Bioinformatics analysis was used to search for porcine-specific sequences in animal-derived genome sequences, and primers were designed for DNA detection and species identification. The bioinformatics analysis process was as follows: 10 sets of porcine genome sequences were downloaded, along with one set each of the following background animal genomes: cattle (4 sets), sheep (2 sets), and donkey, horse, chicken, duck, goose, dog, mouse, rabbit, cat, and fish. Representative porcine genome sequences were BLASTN aligned with other porcine genome sequences and also with representative genome sequences from other animals (after being split into 100bp segments). Sequences present in all porcine genome sequences and meeting the condition of having one and only one matching site (single copy) were selected; sequences that did not have a matching site in the representative genome sequences of other animals were also identified. Based on this, specific sequences longer than 300 bp located in the gene coding region were selected, and one specific gene sequence was selected from each of the 18 chromosomes. Primers were designed for the selected specific sequences using Primer 3 software. The specificity of primer amplification was verified by e-PCR simulation. Based on the above, pig-specific fragment primers were initially screened. The primer sequences were compared back to the gene sequences for further verification. The selected primers were then sent to bioengineering for synthesis.

[0049] 1.3 Primer and probe screening

[0050] 1.3.1 Primer screening for agarose gel electrophoresis

[0051] Eighteen synthesized primer pairs were subjected to conventional PCR amplification and agarose gel electrophoresis screening. Seven breeds of pig DNA (Yantai pig, Pietrain pig, Greenja black pig, Duroc pig, Landrace pig, Jinhua pig, and Large White pig) were used as positive controls. DNA from 15 interspecies animals (cattle, sheep, donkey, horse, chicken, duck, goose, dog, mouse, rabbit, cat, fish, pigeon, quail, and fox) were mixed in five-species groups and labeled H1, H2, and H3 as negative controls. ddH2O was used as a blank control. If no obvious amplification bands were observed in the interspecies mixtures H1, H2, and H3, it indicated that the primers were specific for pig-derived components and could be selected for further screening; if amplification bands were observed, the primers lacked specificity and were discarded. Subsequent screening was performed until 2-3 good primer pairs were selected. Then, interspecies and intraspecies DNA were amplified and electrophoresed with ddH2O to reconfirm the primer specificity.

[0052] 1.3.2 qPCR primer and probe Ct values

[0053] The genes corresponding to primers 9 and 17 are LOC106507823 and SCAND1, respectively. The gene sequences of LOC106507823 and SCAND1 are shown in SEQ ID NO.1 and SEQ ID NO.2. Three probes were designed based on the sequences corresponding to each of the two genes. The extracted DNA from Yantai pigs, Greenja black pigs, Duroc pigs, Landrace pigs, Pietrain pigs, and Large White pigs was diluted to 50 ng / ul. The effectiveness of the six sets of primers and probes was preliminarily judged by the Ct value of qPCR.

[0054] 1.3.3 Primer and probe amplification efficiency

[0055] Porcine genomic DNA at a good concentration of 188 ng / µl was diluted 5-fold, with 6 gradients, each gradient repeated 3 times. Real-time quantitative PCR amplification was performed using 6 sets of primers and probes. A standard curve was obtained by plotting the logarithm of the template concentration on the x-axis and the Ct value obtained during the qPCR reaction on the y-axis. The normal range of amplification efficiency is 90%-110%, with an ideal amplification efficiency of 100%. The slope of the standard curve at this point is -3.32 (the Ct value increases by 3.32 for every 10-fold dilution). An actual slope deviating from -3.32 indicates unsatisfactory amplification efficiency (e.g., the presence of inhibitors, poor primer design).

[0056] 1.3.4 Digital PCR Validation of Primers and Probes

[0057] Six sets of primers and probes were tested using digital PCR to verify the accuracy of the qPCR primer and probe screening results.

[0058] 1.4 Optimization of ddPCR reaction conditions

[0059] The QX 200 droplet digital PCR system (Bio-Rad, Pleasanton, CA, USA) was used to quantify target genes in pigs. The digital PCR detection method was optimized, including the reaction program and sequence optimization, such as annealing temperature, pre-denaturation temperature, time, and primer-probe concentration ratio, to obtain the optimal reaction conditions.

[0060] Optimizing the annealing temperature in digital PCR (dPCR) is a crucial step for experimental success, directly affecting the specific binding of primers to the template, amplification efficiency, and the accuracy of the final quantitative results. Annealing temperature optimization cannot completely compensate for primer design flaws; therefore, determining the ideal amplification efficiency and minimizing non-specific amplification through qPCR experiments plays a vital role in the selection of optimal annealing temperatures. Ten temperature gradients were set, each repeated four times, to screen for the optimal annealing temperature for the digital PCR reaction and improve the accuracy of the quantitative results. Under the selected optimal annealing temperature, the primer-probe concentration ratio was then optimized.

[0061] The original program was adjusted and optimized based on a pre-denaturation temperature of 95℃ and an annealing time of 90s to shorten the reaction time. The pre-denaturation temperature was adjusted from 95℃ to 94℃, and the annealing time was adjusted from 90s to 60s for testing. Different primer and probe concentrations are shown in Table 1.

[0062] Table 1. Combinations of primers and probes for digital PCR

[0063]

[0064]

[0065] 1.5 Method Evaluation

[0066] 1.5.1 Method Specificity Test

[0067] Method specificity includes interspecific specificity and intraspecific nonspecificity. It is determined by the results of positive controls, negative controls, and blank controls. For intraspecific specificity, Green Jaguar Black pigs were used as positive controls, interspecific species (cattle, sheep, horses, chickens, ducks, geese, pigeons, rabbits, fish, donkeys, dogs, deer, rats, foxes, and quails) as negative controls, and ddH2O as a blank control. If Green Jaguar Black pigs showed a positive signal, while interspecific species showed no signal (negative), and the blank control also showed no signal, ruling out contamination, then the interspecific specificity was good, and the experiment was successful and effective. For intraspecific specificity, different breeds of pigs (Yantai pigs, Shaoxing pigs, Pietrain pigs, Green Jaguar Black pigs, Duroc pigs, Landrace pigs, and Jinhua pigs) were used as positive controls, bovine DNA as a negative control, and ddH2O as a blank control. If all bovine DNA samples showed positive droplet signals, while the negative and blank controls showed no positive droplet production, then there was no intraspecific specificity.

[0068] 1.5.2 Linear Dynamic Range Test and Repeatability

[0069] DNA solutions of good quality, measured at a concentration of 39 ng / μL using a Qubit 2.0 fluorometer, were serially diluted for testing. The dilution range was 10–15300 copies / μL, with each concentration tested six times. The mean, standard deviation, and relative standard deviation were statistically analyzed to verify the repeatability and stability of the method. A standard curve was plotted with the logarithm of the theoretical copy number on the x-axis and the logarithm of the actual copy number on the y-axis. The correlation coefficient R0 was used to determine the stability of the method. 2 The correlation between the two factors is determined to ascertain the linear range of the detection method. The repeatability of the ddPCR method is verified by the relative standard deviation between parallel replicates.

[0070] 1.5.3 Limit of Quantitation and Limit of Detection

[0071] The lowest copy number concentration that meets the precision requirements within the linear dynamic range is the limit of quantitation, and the lowest number of molecules that can be clearly distinguished from a negative sample is the limit of detection.

[0072] 1.6 Method Applicability Analysis

[0073] To verify the applicability of the quantitative detection method for porcine components established in this paper, a feasibility assessment was conducted using simulated mixed samples and commercially available samples. DNA extracted from fresh duck tissue was used as a matrix, and DNA extracted from fresh porcine tissue was incorporated into the matrix at volume ratios (0.1%, 10%, and 100%). Digital PCR and qPCR quantification of porcine genes were performed using primers and probes. The detection capability of the established method was verified by comparing qPCR results. The recovery rate was calculated by measuring the copy number using digital PCR to verify the method's resistance to matrix interference. A recovery rate of 85-100% indicates good resistance to matrix interference.

[0074] This experiment also detected porcine-derived components in 11 commercially available samples, including beef and mutton rolls, meat skewers, dried meat, and meatballs. To ensure the rigor of the experiment, duck samples were added as negative controls. Digital PCR amplification was performed on porcine DNA, duck-derived samples, and commercially available samples using pig and duck primers and probes, respectively, to validate the established method.

[0075] 2. Results

[0076] 2.1 Nucleic acid extraction and quality evaluation and validation

[0077] The concentration and purity of the extracted DNA are shown in Table 2. The concentrations of the extracted DNA were all between 20 ng / μL and 200 ng / μL, indicating that relatively ideal DNA could be extracted from different breeder pig tissues. The OD260 / OD280 ratios were generally between 1.8 and 2.0, indicating low residues of impurities such as protein and RNA. The OD260 / OD230 ratios were all greater than 2.0, indicating low residues of impurities such as salt in the nucleic acids, and the quality of the extracted DNA was good.

[0078] Table 2. Ultraviolet spectral data of porcine DNA

[0079] Sample Name Concentration (ng / ul) A260 / A280 A260 / A230 Yantai pig 342.4 1.93 2.17 Pietrain pigs 169.7 1.92 2.15 Green Jia Black Pig 219.9 1.99 2.33 Duroc pig 186.6 1.97 2.30 Changbai pig 129.2 1.98 2.36 Jinhua pig 194.8 1.95 2.17 Big White Pig 67.5 1.97 2.44

[0080] Gel electrophoresis results as follows Figure 1 It can be seen that after the extracted genomic DNA was run on a gel, the bands were single, with good fluorescence intensity and no diffusion, indicating good genomic integrity and meeting the quality requirements.

[0081] The results of animal origin and cross-contamination of DNA used in the gene validation experiment with 18S rRNA gene as internal reference are as follows: Figure 2 As shown, all DNA samples used in the experiment showed logarithmic fluorescence growth, and the fluorescence channels exhibited typical amplification curves. The Ct values ​​were all less than or equal to 35, indicating that animal-derived DNA was extracted. The Ct values ​​of the negative and blank samples were greater than or equal to 40, and they were determined to be negative samples, indicating that there was no cross-contamination between species and that the experiment met the requirements.

[0082] 2.2 Primer and probe screening

[0083] 2.2.1 Primer screening

[0084] The 18 primer pairs obtained from bioinformatics analysis were amplified and electrophoresed with the mixed sample H1. The electrophoresis results after amplification are as follows: Figure 3 As shown in Figure A, primers 1, 2, 3, 7, 9, 10, 11, 12, 16, and 17 did not produce obvious amplification bands after amplification of sample H1. These primers were selected for subsequent specificity verification. Sample H2 was used to amplify and electrophoretically examine the selected primers, and the results are shown below. Figure 3 As shown in B, porcine DNA from seven breeds and three mixed samples were amplified and electrophoresed using primers 9 and 17. The results are as follows. Figure 4 As shown, primers 9 and 17 exhibit good specificity and can be used for further verification and screening.

[0085] Primers 9 and 17 were used to amplify porcine DNA from seven breeds. The PCR amplification products were sent to the Chengdu branch of Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the corresponding amplified target sequences, as shown in Table 3. The results showed that the candidate target sequences had 98% identity with the whole genome sequences, indicating that the primer design was correct and had good specificity. Based on this, probes were designed for primers 9 and 17, with three probes designed for each primer pair for screening. Test1-7 represent the gene sequences of Large White, Duroc, Pietrain, Yantai, Landrace, and Jinhua pigs, respectively.

[0086] Table 3

[0087]

[0088]

[0089] 2.2.2 qPCR primer and probe Ct values

[0090] The genes corresponding to primers 9 and 17 are LOC106507823 and SCAND1, respectively. The gene sequences of LOC106507823 and SCAND1 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The upstream primer for primer 9 is TGGTGAGTCCAACATCGACG, and the downstream primer is CAGATTCAGGGAGAGAGGACACAC. The upstream primer for primer 17 is AAAGAGTGACGTCCGTAGCG, and the downstream primer is CCGAGTGAGGCGTAGGATTCCC. Three probes were designed for each gene based on their corresponding sequences. The extracted DNA from Yantai pigs, Greenja Black pigs, Duroc pigs, Landrace pigs, Pietrain pigs, and Large White pigs was diluted to 50 ng / ul. The effectiveness of the six primer-probe combinations was initially determined by the Ct value of qPCR. The radar graph based on the Ct values ​​is shown below. Figure 5 As shown in the figure, the probes corresponding to primer 9 are generally superior to those corresponding to primer 17. The figure shows that among the three probes corresponding to primers 9 and 17, the Ct values ​​of 9-d and 17-d are significantly lower than the other two groups. Specifically, the Ct value of 9-d is significantly lower than that of 17-d. 9-d has the lowest Ct value among all pig DNA samples (the radar graph is closer to the center), indicating that this primer has good specificity, high amplification efficiency, and strong universality, and can target conserved sequences (such as universal pig genes). The DNA (P1, P2, P3) amplified by all primers shows a shrinking overall inward curve, indicating a high content of the target sequence and good DNA extraction. The higher Ct values ​​of P4, P5, and P6 (far from the center) may correspond to low-abundance targets or non-specific amplification.

[0091] 2.2.3 Amplification efficiency of qPCR primers and probes

[0092] Based on the amplification efficiency of the 6 sets of primers and probes and R 2 The drawing is as follows Figure 6 As shown in the figure, the overall performance of the three probes corresponding to primer 9 is better than that of the three probes corresponding to primer 17. Specifically, the amplification efficiency of 9-d in primer 9 is 100.1%, R... 2 The value was 0.996, and the slope was -3.32. The data in summary indicate that the 9-d primer-probe pair corresponding to porcine genomic DNA achieved ideal amplification efficiency and good reproducibility. This indirectly suggests that the 9-d primer-probe pair has good specificity and was selected for subsequent optimization of the digital PCR method. The nucleotide sequence of the 9-d primer-probe pair is FAM-GAAAGGAGCGGCGGCAGAGG-BHQ1.

[0093] 2.2.4 Digital PCR Validation

[0094] The results of digital PCR testing with 6 sets of primers and probes are as follows: Figure 7 As shown, the experimental results are consistent with the real-time quantitative PCR method. Among the six primer probes, 9-d and 17-d performed better. Compared with 9-d, the fluorescence difference between positive and negative droplets was the largest, and the positive and negative droplets could be effectively separated to the greatest extent. As can be seen from the figure, although both positive and negative droplets can be effectively separated, the precipitation phenomenon is obvious. Therefore, while ensuring the concentration and purity of the DNA used in the experiment are good, further optimization of the digital PCR method is needed.

[0095] 2.2.5 Specificity and Intraspecific Non-specificity of Real-Time PCR Method

[0096] Pigs were used as a positive control, 15 interspecific animals were used as negative controls, and ddH2O was used as a blank control. The results of real-time quantitative PCR are as follows: Figure 8 As shown, only pig DNA showed a clear amplification curve, while no amplification curves were observed for the 15 interspecific animals and the blank, indicating that the selected primers and probes have good interspecific specificity.

[0097] The results of real-time quantitative PCR detection of DNA and blank from 7 pig breeds are as follows: Figure 9 As shown, all seven porcine DNA samples exhibited good amplification curves, while the blank sample showed no amplification curve, ruling out the possibility of contamination. This indicates that the selected primers and probes have good intraspecific nonspecificity.

[0098] 2.3 Establishment of ddPCR method

[0099] The pre-denaturation temperature and annealing time were optimized. The results showed that when the pre-denaturation temperature was adjusted from 95℃ to 94℃, the copy number did not change significantly, but the fluorescence intensity decreased slightly. When the annealing temperature was shortened from 90s to 60s, the positive droplet bands were less concentrated. Therefore, the original conditions were kept unchanged for subsequent optimization.

[0100] Microdroplet plots at 10 annealing temperatures are shown below. Figure 10 As shown, when the annealing temperature is 56℃, the interval between the positive and negative droplet bands is maximized, and the difference in fluorescence intensity is maximized, which can achieve the best possible separation of positive and negative droplets and reduce false positives. This can be further achieved by optimizing the primer-probe concentration ratio, such as... Figure 11 As shown, when the primer and probe concentrations are 1.0 μmol / L and 0.5 μmol / L, the interval between the positive and negative droplet bands is the largest, and the positive detection effect is the best.

[0101] Therefore, after optimization, the droplet digital PCR system for porcine LOC106507823 gene DNA is shown in Table 4, and the droplet digital PCR reaction program is shown in Table 5.

[0102] Table 4. Droplet Digital PCR System

[0103] reagents Final concentration volume ddPCR Supermix for 2× 10.0μL 10 μmol / L forward primer 1.0 μmol / L 2.0μL 10 μmol / L reverse primer 1.0 μmol / L 2.0μL 10 μmol / L probe 0.5 μmol / L 1.0μL DNA template / 2.0μL sterile water / 3.0μL Total volume / 20.0μL

[0104] Table 5. Droplet-based digital PCR reaction procedure

[0105]

[0106]

[0107] 2.4 Method Evaluation

[0108] 2.4.1 Method Specificity Test

[0109] This experiment aimed to evaluate the specificity of a digital PCR detection method developed for the LOC106507823 gene in pigs. The method was validated by detecting positive samples containing the target sequence and various negative samples lacking the target sequence (including samples from interspecies species and template-free controls), demonstrating that the method only produces a specific signal for the target sequence. Results are as follows: Figure 12 As shown, 15 animal-derived DNA samples (numbered 2-15) in the laboratory showed no positive droplet generation, while porcine-derived DNA sample (numbered 1) showed significant positive droplet generation. The results indicate that this method can effectively distinguish between target sequences and non-target sequences, and the porcine-derived target sequence exhibits good interspecific specificity. Figure 13The results showed strong positive droplet production in different pig breeds, indicating good intraspecific nonspecificity of the porcine target sequence. Therefore, the developed digital PCR detection method for the porcine target gene LOC106507823 has high specificity.

[0110] 2.4.2 Linear Dynamic Range Test and Repeatability

[0111] Porcine DNA was serially diluted to a range of 10–15300 copies / µl. The actual copy number concentrations of porcine DNA at the seven gradients are shown in Table 6. As shown in Table 5, after six replicates at each gradient concentration, the relative standard deviations within each gradient group ranged from 1.66% to 11.75%, all less than 25%. These results indicate that the optimized ddPCR method exhibits good reproducibility in the quantitative detection of porcine DNA. The standard curves for predicting and measuring copy numbers are shown below. Figure 14 As shown, R 2 =0.9993, indicating that when the template concentration is between 10-15300 copies / ul, the predicted copy number and the measured copy number show a good linear relationship.

[0112] Table 6 Kinetic range of ddPCR method

[0113]

[0114] 2.4.3 Limit of Quantitation and Limit of Detection

[0115] Porcine genomic DNA was serially diluted to 10 and 5 copies / μL for digital PCR amplification, with each concentration repeated 6 times, as shown in Table 7. When the DNA concentration was as low as 10 copies / μL, a positive signal could still be detected stably, with an RSD of 6.69% (<25%). Therefore, the final limit of quantitation for droplet digital PCR was determined to be 13 copies / μL. When the DNA concentration was as low as 5 copies / μL, positive droplets were detected in only 3 out of 6 replicates. The final limit of detection for droplet digital PCR established in this experiment was 5 copies / μL.

[0116] Table 7

[0117]

[0118] 2.5 Results of Method Applicability

[0119] 2.5.1 Simulated Sample Validation

[0120] The prepared samples (0.1-100%) were subjected to digital PCR and real-time quantitative PCR detection. The results... Figure 15 , 16As shown, comparing the experimental results of the two methods reveals that digital PCR can stably detect the matrix at a mixing ratio of 0.1%, therefore the detection limit of digital PCR is 0.1%. The Ct value of qPCR is 38, indicating a false positive, thus demonstrating that the sensitivity of digital PCR is superior to that of qPCR. The recovery rate, calculated based on the copy number obtained from digital PCR detection, is 85-91%, meeting the requirements and indicating that the digital PCR method has good resistance to matrix interference.

[0121] 2.5.2 Verification of commercially available samples

[0122] Eleven commercially available samples were tested, consisting of beef and mutton products. Label information indicated that sample 2 was made from pork and beef, while samples 3-12 were pure beef and mutton products. The results of digital PCR testing for porcine components in the eleven samples are as follows: Figure 17 As shown, compared with positive sample 1, sample 2 produced a large number of positive droplets, indicating the presence of swine-derived components. Samples 4-12 produced no positive droplets, indicating the absence of swine-derived components, and the detection results are consistent with the corresponding food label information. Sample 3 produced a large number of positive droplets, indicating the presence of swine-derived components in its composition. The experimental results demonstrate that the digital PCR method established in this application can accurately detect swine-derived components in food and has good applicability.

[0123] The foregoing description of embodiments of the present invention, through which those skilled in the art are able to implement or use the present invention, will be readily apparent to those skilled in the art. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novelty disclosed herein.

Claims

1. The application of the porcine LOC106507823 gene target in the preparation of digital PCR detection reagents for porcine components, characterized in that, The porcine LOC106507823 gene target is shown in SEQ ID NO.

1.

2. Digital PCR detection of the primer set and probe for the porcine LOC106507823 gene target as described in claim 1.

3. The primer set and probe according to claim 2, characterized in that, The nucleotide sequences of the primer set and probe are shown below: LOC-F: TGGTGAGTCCAACATCGACG; LOC-R: CAGATTCAGGGAGAGAGGACAC; LOC-P: GAAAGGAGCGGCGGCAGAGG.

4. The primer set and probe according to claim 3, characterized in that, The nucleotide sequence of the probe is modified with a fluorescent reporter gene and a fluorescent quencher gene at both ends, preferably LOC-P: FAM-GAAAAGGAGCGGCGCAGAGG-BHQ1.

5. A kit comprising the primer set and probe as described in claim 2, 3 or 4.

6. The reagent kit according to claim 5, characterized in that, This kit includes the following PCR reaction system: 。 7. The application of the primer set and probe according to claim 2, 3 or 4 or the kit according to claim 5 or 6 in the detection of porcine components, especially in the detection of animal tissues and animal-derived products.

8. A digital PCR method for detecting porcine components, wherein the method is not a disease diagnostic method, characterized in that, The method includes the following steps: extracting DNA from a sample, performing ddPCR detection on the extracted DNA, wherein the primers and probes for ddPCR detection are the primer set and probes described in claim 2, 3 or 4.

9. The digital PCR detection method for porcine components according to claim 8, characterized in that, The reaction conditions for ddPCR detection are as follows: 。 10. The digital PCR detection method for porcine components according to claim 8, characterized in that, The detection method is applicable to the detection of animal tissues and animal-derived products.

Images