C783T SNP (Single Nucleotide Polymorphism) related to grain number per ear of wheat and application thereof
By developing C783T SNP sites and dCAPS markers related to wheat grain number per ear, the problem of the difficulty in applying wheat grain number QTLs in existing technologies has been solved, enabling efficient screening of high-yielding wheat varieties and increasing wheat yield.
Patent Information
- Application Number
- CN202511443211.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-10
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-10-10
AI Technical Summary
Existing technologies make it difficult to effectively utilize QTLs related to the number of grains per ear in wheat for genetic improvement, thus limiting the increase in wheat yield.
This invention provides a C783T SNP locus related to wheat grain number and its application. By designing primer combinations and the restriction endonuclease XhoI, a dCAPS marker is developed for identifying wheat genotypes and screening for varieties with high grain number per spike.
By detecting the genotype of the C783T SNP locus, wheat varieties with high grain number per ear can be effectively screened, providing a new method for molecular marker-assisted selection breeding and improving wheat yield.
Smart Images

Figure CN120945115A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker breeding technology, and in particular to the C783T SNP related to the number of grains per ear of wheat and its application. Background Technology
[0002] Wheat occupies an extremely important position among food crops. Globally, wheat production is approximately 700 million tons annually, accounting for one-third of the world's total food production and providing food for about 30-40% of the global population. Wheat is also my country's second largest staple food crop, with annual consumption reaching 120 million tons. However, my country's annual wheat consumption growth rate exceeds its production growth rate, leading to an increasingly tense supply-demand relationship. With arable land decreasing and the population continuously increasing, the predicament of too many people and too little land remains unresolved. Therefore, increasing wheat production is crucial.
[0003] As one of the three factors constituting wheat yield, the number of grains per spike is influenced not only by the genetic characteristics of the variety but also by the ecological environment and fertilizer and water application throughout the spike differentiation process. Its regulatory potential is significant; therefore, in the current pursuit of high yield, increasing the number of grains per spike has become a breakthrough point and has a substantial direct impact on yield. Studies have found that the number of grains per spike has the greatest impact on wheat yield, and its yield-increasing potential is also the greatest. To date, there have been numerous reports on QTL studies regarding the number of grains per spike. Cui et al. used a KJ-RIL population composed of 188 materials derived from the cross between wheat Kenong 9204 and Jing 411, combined with multi-environment phenotypic data and Wheat660K chip genotyping data for QTL analysis. They detected a QTL associated with KNPS on chromosome 4A, which could explain 8.0–21.2% of the phenotypic variation. Zhou Miaoping et al. used a RIL population of 104 materials constructed from the cross of wheat Wangshuibai × Alondra as their research material. They used SNP markers combined with multi-environment phenotypic data to perform QTL mapping for KNPS. They detected 8 QTLs related to KNPS in the main stem and ear, located on chromosomes 1B, 1D, 3B, 4A, 5D, and 6B, which could explain 9.9–19.9% of the phenotypic variation. They also detected 11 QTLs related to the number of grains per ear, located on chromosomes 1B, 1D, 2B, 3B, 4A, 5D, 6B, and 7A, which could explain 7.5–43.4% of the phenotypic variation. Gu Jingjing et al. used 198 wheat varieties and combined KNPS phenotypic data and 660K SNP chip genotypic data under four environmental conditions to perform QTL mapping. They found that 41 KNPS-related loci were detected on 16 chromosomes other than chromosomes 1D, 3A, 3D, 4B and 4D. A single associated locus could explain 6.19% to 20.83% of the phenotypic variation. Shi et al. used a RIL population of 264 materials derived from the hybridization of wheat-Yangmai 13×C615 to detect 47 KNPS loci on 19 chromosomes excluding 1D and 4D, which could explain 1.53–39.52% of the phenotypic variation. Five marker loci significantly associated with KNPS were detected in multiple environments: BS00022896_51 on chromosome 2A, BobWhite_c10539_201 on chromosome 2D, Excalibur_c73633_120 on chromosome 3B, BS00063906_51 on chromosome 6B, and GENE-4456_153 on chromosome 7B. Lu Bing et al. used wheat material Chuanmai 42 × Chuannong 16 and 127 derived materials to form a RIL population. They detected a QTL controlling KNPS at each of the positions on chromosomes 4A, 7B, 2D and 3D, which could explain 14.55%, 12.1%, 17.41% and 10.73% of the phenotypic variation, respectively.
[0004] Although many QTLs related to wheat grain number have been identified, most QTLs have a small phenotypic contribution, require additive effects to be expressed, and have poor repeatability across different years and environments. Therefore, these QTLs are difficult to apply to the genetic improvement of wheat grain number. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a C783T SNP related to the number of grains per ear of wheat and its application.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.
[0007] A SNP locus associated with the number of grains per ear of wheat, wherein the SNP locus corresponds to the 783rd base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, named C783T SNP. When this locus is C / C homozygous, the corresponding genotype is A; when this locus is T / T homozygous, the corresponding genotype is B; the number of grains per ear is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B.
[0008] On the other hand, the present invention also includes a primer pair for detecting single nucleotide polymorphisms at the above-mentioned SNP sites in the wheat genome, wherein the primer pair is primer pair F1 and R1 consisting of SEQ ID NO: 2 and SEQ ID NO: 3 in the sequence listing, and primer pair F2 and R2 consisting of SEQ ID NO: 4 and SEQ ID NO: 5.
[0009] On the other hand, the present invention also includes a gene detection reagent or gene detection kit for identifying or assisting in the identification of wheat ear grain number traits. The gene detection reagent or gene detection kit is used to detect the above-mentioned SNP sites and includes at least the above-mentioned primer combination and necessary restriction endonuclease components.
[0010] As a preferred embodiment of the present invention, the restriction endonuclease is XhoI enzyme.
[0011] As a preferred embodiment of the present invention, the gene detection reagent or gene detection kit further includes template DNA, buffer solution required for PCR amplification, dNTPs, and other necessary components for gene detection.
[0012] As a preferred embodiment of the present invention, the target DNA fragment amplified by the gene detection reagent or gene detection kit is designed as the 384-1170bp and / or 688-805bp sequence at the 5' end of SEQ ID NO: 1.
[0013] On the other hand, the present invention also includes a method for identifying or assisting in the identification of wheat genotypes, wherein any segment of the wheat genomic DNA to be tested containing the above-mentioned SNP sites is subjected to PCR amplification, and the PCR amplification product is identified by enzyme digestion; the DNA segment amplified by PCR is the 384-1170bp and / or 688-805bp sequence at the 5' end of SEQ ID NO: 1; the specific primer pair for PCR amplification is primer pair F1 and R1 composed of SEQ ID NO: 2 and SEQ ID NO: 3, and primer pair F2 and R2 composed of SEQ ID NO: 4 and SEQ ID NO: 5.
[0014] As a preferred embodiment of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with F1 and R1 primer pairs to obtain PCR products; diluting this PCR product 10 times, using it as a template, amplifying with F2 and R2 primer pairs to obtain PCR products; digesting the obtained PCR product with XhoI enzyme to obtain digested products; if the digested products are two smaller fragments, the wheat to be tested has a C / C genotype at the site, which is genotype A; if the digested products are one larger fragment, the wheat to be tested has a T / T genotype at the site, which is genotype B; the number of grains per ear is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B.
[0015] Finally, the present invention also includes the use of the above-mentioned SNP sites, primers, gene detection reagents or gene detection kits in any of the following (1)-(4):
[0016] (1) Application in breeding of wheat spike grain number-related traits;
[0017] (2) Application in breeding for identifying or assisting in the identification of wheat ear grain number-related traits;
[0018] (3) Application in the preparation, identification or auxiliary identification of wheat spike grain number related traits;
[0019] (4) Application in identifying or assisting in the identification of wheat yield.
[0020] In addition, the present invention also includes various testing products prepared based on the above-mentioned application directions.
[0021] The beneficial effects of adopting the above technical solution are as follows: This invention first provides a C783T SNP locus related to the number of grains per ear in wheat, corresponding to position 783 from the 5' end of SEQ ID NO: 1. By designing a dCAPS marker for this SNP locus, the genotype of this locus was found to be CC or TT. This invention further develops a dCAPS molecular marker based on this locus and provides a method for identifying or assisting in the identification of wheat genotypes. Experiments using a large number of wheat materials have shown that the number of grains per ear in wheat with genotype CC is greater than, or a candidate greater than, the number of grains per ear in wheat with genotype TT. This invention provides a new method for marker-assisted selection breeding of wheat, which is of great significance in agricultural practice and / or related scientific research in the breeding of high-yielding wheat varieties. Attached Figure Description
[0022] Figure 1 This is a schematic diagram of the electrophoresis detection results of the SNP-developed dCAPS-labeled enzyme digestion products of the present invention; wherein, lane C is the band cleaved by XhoI, and lane T is the band that cannot be cleaved by XhoI.
[0023] Figure 2 This is a schematic diagram of the XhoI recognition site.
[0024] Figure 3 This is a schematic diagram of the gene structure and SNP sites of the present invention.
[0025] Figure 4 This is a schematic diagram of gene SNP sites and genotypes in the wheat population material of this invention.
[0026] Figure 5 This is a schematic diagram showing the correlation between gene polymorphism sites and grain number in a natural population.
[0027] Figure 6 This is a schematic diagram illustrating the verification results of the correlation analysis between gene polymorphism sites and grain number in a natural population. Detailed Implementation
[0028] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that, as used in this specification and appended claims, the term "comprising" indicates the presence of the described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" as used in this specification and appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.
[0029] As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrases "if determined" or "if [the described condition or event] is detected" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once [the described condition or event]," or "in response to detection." Furthermore, in the description of this specification and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms “including,” “comprising,” “having,” and variations thereof all mean “including but not limited to,” unless otherwise specifically emphasized.
[0030] Example 1: Detection of SNPs related to wheat ear grain number and their PCR-enzyme digestion polymorphisms
[0031] 1. Discovery of the C783T SNP site
[0032] A SNP was found on chromosome 4A of the wheat genome (iwgsc_refseqv1.0 assembly for Triticum aestivum), corresponding to position 783 from the 5' end of SEQ ID NO: 1, designated as the C783T SNP site. Two genotypes were found at this site in the naturally occurring wheat variant population:
[0033] Genotype A: C
[0034] Genotype B: T
[0035] 2. Specific primers and sequence analysis for amplifying the genomic fragment containing the C783T SNP site.
[0036] Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site:
[0037] F1: ATGAAAGAAGCCCTCCGAGAA (SEQ ID NO: 2);
[0038] R1: TCAGAATAAGGTGCATATCTTCTT (SEQ ID NO: 3);
[0039] F2: CCTGTTTTGAATGTAAGGAC (SEQ ID NO: 4);
[0040] R2: CAAATAACTTCCGGCATGTCTC (SEQ ID NO: 5).
[0041] The sequence from positions 384 to 1170 of SEQ ID NO: 1 was amplified by PCR using primers F1 and R1; the sequence from positions 688 to 805 of SEQ ID NO: 1 was amplified by PCR using primers F2 and R2. Enzyme digestion analysis showed that this polymorphism could be recognized by XhoI.
[0042] 3. Establishment of PCR-restriction polymorphism detection and genotyping methods
[0043] 1) Extract genomic DNA from the wheat to be tested.
[0044] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) consists of: 7 μL ddH2O, 10 μL 2×TaqMix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).
[0045] PCR amplification conditions were as follows: 95℃ for 3 min; 95℃ for 30 s, 54℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min; and stored at 16℃.
[0046] 3) Dilute the PCR product from step 2) 10 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2×TaqMix 10 μL, primer F2 (10 μmol / L) and primer R2 (10 μmol / L) 1 μL, template (20 ng / μL) 1 μL.
[0047] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 54℃ for 30 s, 72℃ for 15 s, for 35 cycles; 72℃ for 10 min, and stored at 16℃.
[0048] 4) Digest the PCR product obtained in step 3) with XhoI enzyme to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified site according to the following method:
[0049] If the enzyme digestion product consists of two or smaller fragments (94 bp), the genotype of the wheat being tested at that locus is C / C; if the enzyme digestion product consists of one or larger fragment (118 bp), the genotype of the wheat being tested at that locus is T / T (e.g., ...). Figure 1 (As shown).
[0050] 5) Based on the results of step 4), wheat is classified into two types, I and II, at the stated site:
[0051] I: C / C (i.e., homozygous genotype A); II: T / T (i.e., homozygous genotype B).
[0052] Note: The part before the " / " indicates the case on one homologous chromosome, and the part after the " / " indicates the case on another homologous chromosome.
[0053] Example 2: Generating natural populations using dCAPS molecular markers and performing correlation analysis with grain number trait.
[0054] Each wheat variety in a natural population consisting of 348 hexaploid wheat accessions was used as a test wheat variety. The wheat amplification products were then sequenced and verified. The results are shown in Table 1.
[0055] Table 1. Information on the polymorphic sites described in natural wheat populations.
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062] Exon capture sequencing was performed on 383 samples, and specific genotyping was conducted on these samples. Genotyping included two cases: homozygous C / C genotype A and homozygous T / T genotype B. For example... Figure 3 Of the 383 materials, 371 materials could be clearly distinguished as homozygous C / C genotype A or homozygous T / T genotype B, while the remaining 12 materials could not be genotyped.
[0063] Furthermore, of these 383 materials, 348 had agronomic trait data from multiple years and locations, while the remaining 35 materials lacked sufficient data to meet the requirements for subsequent analysis. Therefore, as shown in Table 2 and... Figure 4 As shown, only these 348 data points were used in the association analysis between the genetic polymorphism sites in natural populations and the number of grains per ear. However, among these 348 data points, 17 materials did not have genotyping, so the actual number of samples for association analysis was 331. These 331 samples were used to discover the relationship between molecular markers and traits.
[0064] The aforementioned natural wheat populations were planted in 10 different environments. The number of grains per spike for each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the relationship between the number of grains per spike and the polymorphic loci. A mixed linear model plus population structure (MLM+(Q+K)) method was selected for the analysis, with P<0.05 considered significant. The results are shown in Table 2. Figure 3 As shown.
[0065] Table 2. Association analysis results between gene polymorphism sites in natural populations and grain number per ear.
[0066]
[0067] The association analysis results in Table 2 show that the differences in grain number per spike between the two types in the natural population composed of 331 hexaploid wheat accessions shown in Table 1 were statistically significant (P < 0.05). Specifically, type I wheat had a higher grain number per spike than type II wheat. In several environments, type I wheat materials had 1.2, 3.72, 2.76, 2.47, 3.51, 1.24, 2.26, 3.5, 3.88, and 1.3 more grains per spike than type II wheat, respectively. This study of the natural population indicates that type I is a superior genotype for increasing wheat grain number per spike.
[0068] Example 3: Application of dCAPS molecular markers
[0069] To further verify that wheat with homozygous genotype A is greater than or candidate greater than wheat with homozygous genotype B, an association analysis between natural population gene polymorphism sites and grain number was conducted on another 120 materials (Table 3).
[0070] 1. Genotyping
[0071] The genotype of the test material was detected according to the genotype detection method in Example 1.
[0072] Of these 120 data sets, 3 did not have genotyping, so the actual number of samples used for association analysis was 117. These 117 samples were used to verify that there is indeed a link between molecular markers and traits.
[0073] Table 3. Validation of the polymorphic sites described in natural wheat populations.
[0074]
[0075]
[0076] 2. Association analysis of SNP locus genotypes with wheat grain number per ear and related agronomic traits
[0077] The aforementioned natural wheat populations were planted under 10 different environments. The number of grains per spike for each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the relationship between the number of grains per spike and the polymorphic loci. A mixed linear model plus population structure (MLM+(Q+K)) method was selected for the analysis, with P<0.05 considered significant. The results are shown in Table 4. Figure 5 As shown.
[0078] Table 4. Association analysis results between gene polymorphism sites in natural populations and grain number per ear.
[0079]
[0080] The association analysis results in Table 4 confirm that the differences in grain number per spike between the two types of wheat in the natural population composed of 120 hexaploid wheat accessions shown in Table 3 were statistically significant (P < 0.05). Specifically, wheat of type I had a higher grain number per spike than wheat of type II. In several environments, wheat of type I had 0.3, 0.74, 0.24, 0.71, 0.36, 0.46, 0.46, 0.69, 0.65, and 0.73 more grains per spike than wheat of type II, respectively. This study of the natural population indicates that type I is a superior genotype for increasing wheat grain number per spike.
[0081] In summary, this invention discloses a SNP locus associated with wheat grain number per ear and its application. Through genetic variation analysis of the coding region of a natural wheat population, this invention identified a SNP corresponding to position 783 from the 5' end of SEQ ID NO: 1. This SNP has two genotypes: genotype A (C) and genotype B (T). Association analysis showed that, in homozygous types of these two genotypes, the grain number per ear is: wheat homozygous for genotype A > wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting this SNP, wheat with a higher grain number per ear can be identified. This invention provides a new method for marker-assisted selection breeding of wheat, which is of great significance in the breeding of high-yielding wheat varieties or in research.
[0082] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.
Claims
1. A SNP locus associated with wheat ear grain number, characterized in that: The SNP site corresponds to the 783rd base from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, named C783T SNP; when this site is C / C homozygous, the corresponding genotype is A; when this site is T / T homozygous, the corresponding genotype is B; the number of grains per ear is: wheat homozygous genotype A is greater than or candidate greater than wheat homozygous genotype B.
2. A primer combination, characterized in that: For detecting single nucleotide polymorphisms at the SNP sites of claim 1 in the wheat genome, the primer pair is primer pair F1 and R1 consisting of SEQ ID NO: 2 and SEQ ID NO: 3 in the sequence listing, and primer pair F2 and R2 consisting of SEQ ID NO: 4 and SEQ ID NO:
5.
3. A reagent or kit for identifying or assisting in the identification of the number of grains per ear in wheat, characterized in that: The reagent or kit is used to detect the SNP site described in claim 1, and includes at least the primer combination and necessary restriction endonuclease assembly described in claim 2.
4. The gene detection reagent or gene detection kit according to claim 3, characterized in that: The restriction endonuclease is XhoI enzyme.
5. The gene detection reagent or gene detection kit according to claim 3 or 4, characterized in that: The gene detection reagent or gene detection kit also includes template DNA, buffer for PCR amplification, dNTPs, and other necessary components for gene detection.
6. The gene detection reagent or gene detection kit according to claim 3, 4, or 5, characterized in that: The target DNA fragment for PCR amplification by the gene detection reagent or gene detection kit is designed as the 384-1170bp and / or 688-805bp sequence at the 5' end of SEQ ID NO:
1.
7. A method for identifying or assisting in the identification of wheat genotypes, characterized in that: PCR amplification is performed on any DNA fragment in the wheat genomic DNA to be tested that includes the SNP site described in claim 1, and the PCR amplification product is identified by enzyme digestion; the DNA fragment amplified by PCR is the 384-1170bp and / or 688-805bp sequence at the 5' end of SEQ ID NO: 1; the specific primer pair for PCR amplification is primer pair F1 and R1 composed of SEQ ID NO: 2 and SEQ ID NO: 3, and primer pair F2 and R2 composed of SEQ ID NO: 4 and SEQ ID NO:
5.
8. The method according to claim 7, characterized in that: The enzyme digestion includes the following steps: PCR products were obtained by amplification using wheat genomic DNA as a template and F1 and R1 primer pairs; Dilute this PCR product 10 times, use it as a template, and amplify it using F2 and R2 primer pairs to obtain the PCR product. The obtained PCR product is digested with XhoI enzyme to obtain the digested product; if the digested product is two or smaller fragments, the wheat genotype at the site is C / C, and the genotype is A; if the digested product is one or larger fragment, the wheat genotype at the site is T / T, and the genotype is B; the number of grains per ear is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B.
9. The use of the SNP site of claim 1, the primer of claim 2, the gene detection reagent or gene detection kit of any one of claims 3-6 in any one of the following (1)-(4): (1) Application in breeding of wheat spike grain number-related traits; (2) Application in breeding for identifying or assisting in the identification of wheat ear grain number-related traits; (3) Application in the preparation, identification or auxiliary identification of wheat spike grain number related traits; (4) Application in identifying or assisting in the identification of wheat yield.
10. Various testing products prepared based on the application described in claim 9.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) site related to grain number per ear of wheat and application of SNP site
CN118600098A
SNP-C682T related to grain number per ear of wheat and application of SNP-C682T
CN119410814A
SNP (Single Nucleotide Polymorphism) molecular marker related to thousand seed weight of wheat and application thereof
CN120796566A
SNP (Single Nucleotide Polymorphism) molecular marker related to character of ear number per plant of wheat and application of SNP molecular marker
CN120945104A
Cited By
DCAPS molecular marker for identifying character of grain number per ear of wheat and application of dCAPS molecular marker
CN121852588A