Hypoxia response therapeutic VEGFA mRNA and application and stability verification method thereof

Abstract

The invention relates to hypoxia response therapeutic VEGFA (vascular endothelial growth factor A) mRNA (messenger Ribonucleic Acid) and application thereof. The mRNA comprises a 5'end cap, a 5 'UTR (Untranslated Region) containing a Kozak sequence, VEGFA ORF (Open Region Fragment), a 3' UTR containing an RNA (Ribonucleic Acid) binding protein HuR binding site, a RhoBAST fluorescent aptamer at the tail end of the 3 'UTR and a PolyA tail. According to the design, through a HuR hypoxia-dependent nuclear plasma transport mechanism, the stability of mRNA in hypoxic cells is improved by 2.5 times, the protein expression quantity is improved by 2 times, and proliferation of endothelial cells is remarkably promoted. Further disclosed is a VEGFA mRNA delivery system based on engineered extracellular vesicles (EVs): EVs surface modified kidney targeting peptide LTH. The system is efficiently accumulated in ischemic kidneys, VEGFA expression is remarkably enhanced, and abnormal vascular hyperplasia of external renal organs is avoided. Animal experiments prove that the survival rate of a renal ischemia-reperfusion injury model can be increased to 100% by intravenous injection of drug-loaded EVs, and the capillary density is remarkably increased 7 days after treatment. The invention is suitable for treating ischemic diseases, organ ischemia reperfusion injury or chronic wounds and the like, and has the advantages of accurate targeting, hypoxia response, high stability and safety.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and specifically discloses a hypoxia-responsive therapeutic VEGFA mRNA, its application and stability verification method, and further discloses an engineered extracellular vesicle delivery system loaded with the above-mentioned VEGFA mRNA, its preparation method and application. Background Technology

[0002] Vascular endothelial growth factor A (VEGFA) is a key factor in promoting angiogenesis and repair, and plays an important role in the treatment of ischemic diseases. However, existing VEGFA treatments have the following limitations: recombinant protein therapies have short half-lives, require frequent dosing, and have high production costs; traditional gene therapy methods carry the risk of integration, which may lead to genomic instability.

[0003] Messenger RNA (mRNA)-based therapeutic strategies, with their precision and customizable personalized treatment advantages, have become a promising direction in modern medicine. Compared with protein and gene therapy, mRNA therapy has unique advantages, such as rapid expression of target proteins, high designability, and no need for integration into the host genome, thus avoiding the insertion mutation risks that may exist in gene therapy. However, mRNA therapy also faces technical challenges, such as the lack of tissue specificity in conventional mRNA delivery systems, the tendency of VEGFAmRNA to induce angiogenesis in non-ischemic target areas leading to side effects, and the poor stability of mRNA molecules, which are easily degraded in vivo, affecting therapeutic efficacy. Summary of the Invention

[0004] To address the aforementioned issues, this invention discloses a hypoxia-responsive therapeutic VEGFAmRNA, its application, and a method for stability verification. This method overcomes three major technical bottlenecks in existing mRNA therapy: low delivery efficiency, off-target expression in non-target areas, and poor stability. By co-designing spatial targeting and molecular response modules, it achieves precise accumulation and hypoxia-dependent expression of VEGFAmRNA in the ischemic area of ​​the kidney, thereby promoting functional microvascular regeneration while preventing abnormal angiogenesis in non-target organs.

[0005] This invention includes the following technical solutions:

[0006] A hypoxia-responsive therapeutic VEGFAmRNA, comprising:

[0007] (1) Open reading frame (ORF) encoding the VEGFA protein;

[0008] (2) The 5'UTR located upstream of the ORF contains the Kozak sequence;

[0009] (3) The 3'UTR located downstream of the ORF contains a specific binding site for the RNA-binding protein HuR, which is the region of ARE;

[0010] (4) Located at the end of the 3'UTR, it contains the fluorescently lit RNA aptamer RhoBAST for live-cell super-resolution RNA imaging.

[0011] (5) 5' end cap structure and 3' end PolyA tail.

[0012] Furthermore, in the aforementioned hypoxia-responsive therapeutic VEGFAmRNA, the nucleotide sequence of the HuR-specific binding site in the 3'UTR is shown in SEQ ID NO:4 or 5.

[0013] Furthermore, the aforementioned hypoxia-responsive therapeutic VEGFAmRNA exhibits significantly higher mRNA stability under hypoxic conditions compared to normoxic conditions, and a significantly increased expression level of VEGFA protein; the hypoxic conditions are defined as oxygen concentration ≤5%.

[0014] This invention also discloses a method for verifying the stability of the above-mentioned hypoxia-responsive therapeutic VEGFAmRNA, comprising the following steps:

[0015] (1) Transfect the recombinant expression vector containing the VEGFAmRNA into mammalian cells;

[0016] (2) The transfected cells were cultured under hypoxic and normoxic conditions, respectively.

[0017] (3) The expression levels of VEGFAm RNA and protein were detected under hypoxic and normoxic conditions to verify its hypoxia response stability.

[0018] Furthermore, the above-mentioned stability verification method includes at least one of the following detection methods: reverse transcription quantitative polymerase chain reaction (RT-qPCR) to detect mRNA expression level and Western blotting to detect protein expression level.

[0019] The present invention also discloses a pharmaceutical composition comprising the above-mentioned hypoxia-responsive therapeutic VEGFA mRNA cargo and a kidney-targeting peptide-modified extracellular vesicle delivery carrier.

[0020] Furthermore, the above-mentioned drug composition can achieve targeted treatment of the kidney hypoxia-damaged site.

[0021] This invention also discloses the application of the aforementioned hypoxia-responsive therapeutic VEGFA mRNA delivery system in the preparation of a drug for promoting vascular repair, thereby promoting vascular endothelial proliferation and repair. The drug can be used to treat ischemic diseases, organ ischemia-reperfusion injury, or chronic wounds.

[0022] Furthermore, in the above application, the ischemic disease is ischemia-reperfusion acute kidney injury.

[0023] The present invention also discloses a kit comprising the hypoxia-responsive therapeutic VEGFA mRNA as described in any one of claims 1-3, a transfection reagent, and a reagent for detecting VEGFA expression levels.

[0024] This invention also discloses a VEGFA mRNA delivery system based on engineered extracellular vesicles, comprising:

[0025] (1) Loaded hypoxia-responsive therapeutic VEGFAmRNA cargo, whose 3'UTR region contains a HuR-specific binding site (adenine / uracil element region, ARE) 3'UTR sequence;

[0026] (2) The extracellular vesicle membrane surface is modified with kidney-targeting peptide LTH (LTHVVWL), which is connected to the vesicle membrane structure lipid anchor through cholesterol-PEG2000 coupling chain.

[0027] (3) The delivery system accumulates in high amounts in ischemic kidneys and in low amounts in non-ischemic organs, and the expression levels of VEGFA mRNA and protein are significantly higher under hypoxic conditions than in normoxic environments.

[0028] Furthermore, this invention discloses the above-mentioned method for designing hypoxia-responsive VEGFA mRNA sequences and constructing recombinant plasmids.

[0029] Preferably, in this invention, the copy number of VEGFA mRNA in the drug-loaded extracellular vesicles is 41.53 ± 3.40 times that of the empty EV.

[0030] Furthermore, the LTH in this invention is a targeting peptide with high affinity for kidney injury molecule-1 obtained through phage screening technology. Specific technical details have been fully disclosed in our team's prior patent (patent number ZL202011592251.5), and its technical solution is cited here as the basis.

[0031] Furthermore, the above-mentioned extracellular vesicles were modified with PEG-cholesterol polymerized LTH-FITC targeting peptide molecules, with a modification efficiency of 100%.

[0032] The present invention also discloses a method for preparing the above-mentioned delivery system, comprising the following steps:

[0033] (1) Construct a hypoxia-responsive therapeutic VEGFAmRNA expression plasmid, transfect extracellular vesicle-derived cells, and collect cell supernatant 72 h after transfection;

[0034] (2) Extracellular vesicles were purified by low-temperature (4℃) differential centrifugation (500g, 10min; 2000g, 25min; 13500g, 30min; 100,000g, 2h) combined with SEC.

[0035] (3) The target peptide molecules were linked to extracellular vesicles by co-incubation (shaking at 250 rpm for 3 h at 25℃ and then standing at 4℃ for 24 h);

[0036] (4) Use ultrafiltration centrifuge tubes (100kDa molecular weight cutoff) to remove free target peptide molecules and obtain drug-loaded EVs.

[0037] Furthermore, in the above delivery system, the extracellular vesicles are derived from, but are not limited to, human embryonic kidney cell lines (HEK293 and its derivative subtypes).

[0038] This invention also discloses the application of the above-mentioned drug delivery system in the preparation of renal IRI for angiogenesis, with an intravenous injection dose of 2 × 10⁻⁶ daily on days 1, 2, and 3 after injury. 10 Drug-loaded EVs per 8-week-old C57BL / 6J mouse. Three days after treatment, renal VEGFA protein expression increased; seven days after treatment, renal microvascular density significantly increased, with no abnormal angiogenesis in extrarenal organs.

[0039] Furthermore, in the above applications, the hypoxic injury area includes, but is not limited to, areas where HuR nucleoplasmic metastasis occurs, such as areas of renal ischemia, myocardial infarction, cerebral ischemia, and peripheral artery disease ischemia.

[0040] Compared with the prior art, the present invention has the following outstanding advantages:

[0041] 1. Sequence specificity:

[0042] This invention designs a VEGFA mRNA with an ARE sequence in its 3'UTR, which can specifically bind to HuR protein to achieve precise molecular recognition.

[0043] 2. Hypoxia-targeting: Based on the hypoxia-dependent nucleoplasmic transport mechanism of the HuR protein, after transfer, HuR binds to the 3'UTR region of VEGF-AmRNA, protecting it from degradation. This ensures that the mRNA is efficiently and stably translated into protein only in hypoxic-damaged regions. Non-hypoxic target regions are easily degraded by RNases, resulting in low protein expression levels and significantly reducing off-target effects.

[0044] 3. Significant hypoxia stabilization effect: This invention, through the HuR binding mechanism, increases the mRNA expression level in a hypoxic environment by up to 2.5 times and the protein expression level by up to 2 times compared to a normoxic environment;

[0045] 4. Safety: Utilizing non-integrating mRNA technology avoids the risk of genome insertion;

[0046] 5. Traceability: This invention uses RhoBAST fluorescence to illuminate the insertion of aptamer sequences, which can be used for dynamic tracking of mRNA and to evaluate the efficiency of mRNA loading and delivery.

[0047] 6. Customizability: VEGFA variants and UTR sequences can be adjusted according to clinical needs to achieve individualized treatment.

[0048] 7. Dual-targeting synergistic system

[0049] Physical targeting layer: By using genetic engineering to anchor the kidney injury molecule Kim-1 specific targeting peptide (LTHVVWL) on the surface of extracellular vesicles, the accumulation rate of the kidney ischemic area is significantly improved;

[0050] Molecular response layer: A hypoxia-sensitive HuR binding motif is embedded in the 3'UTR of VEGFA mRNA. By utilizing the nuclear-cytoplasmic transfer characteristics of HuR protein in hypoxic cells, the half-life of mRNA is prolonged, thereby achieving spatiotemporal specific expression regulation in the damaged area.

[0051] 8. Advantages of industrialized production

[0052] Highly efficient endogenous drug loading: HEK 293F adopts a mature serum-free suspension culture process, which has low labor costs, high stability, and large EV yield; it utilizes the endogenous vesicle biosynthesis pathway in cells, resulting in high drug loading efficiency and overcoming the exogenous loading problem caused by mRNA length.

[0053] Stable targeted peptide modification process: Targeted peptides are anchored in a specific direction using lipid anchoring technology, with a modification efficiency of up to 100% and a small batch-to-batch variation coefficient.

[0054] GMP-scale production adaptability: The synthesis process of this invention can achieve a fully closed production system in the future, realize the stability of key quality attributes, and develop lyophilized formulations to enhance the stability of drug delivery systems. Attached Figure Description

[0055] Figure 1Designed for VEGFA mRNA sequences. The three mRNAs share the same 5'UTR sequence, coding sequence, and RhoBAST sequence at the 3'UTR end, but differ in their 3'UTR sequences. mRNA1's 3'UTR sequence lacks an ARE sequence; mRNA2's 3'UTR sequence is an ARE-rich HuR hypoxia-binding core sequence; and mRNA3's 3'UTR sequence is an even richer ARE-rich HuR hypoxia-binding extension sequence.

[0056] Figure 2 Molecular construction map of VEGFAmRNA expression plasmids. The three recombinant plasmids (platinum 1, 2, and 3) share a common GV219 vector backbone (containing the ampicillin resistance gene and the origin of replication). The core elements of plasmids 1, 2, and 3 correspond to the mRNA 1, 2, and 3 sequences, respectively.

[0057] Figure 3 This illustrates nuclear-cytoplasmic translocation of HuR cells under hypoxic conditions. The image shows immunofluorescence staining of renal tubular epithelial cells; green fluorescence represents HuR cells, and blue fluorescence represents DAPI cells.

[0058] Figure 4 To assess the hypoxia expression stability of different VEGF-AmRNAs, VEGFA mRNA2 is the dominant sequence in the hypoxia response.

[0059] (A) RT-qPCR was used to detect the expression changes of VEGF-AmRNA in HK-2 in different groups under hypoxic and normoxic conditions;

[0060] (B) The expression changes of VEGF-A protein in the supernatant of HK-2 cells in different groups under hypoxic and normoxic conditions were detected by enzyme-linked immunosorbent assay (ELISA).

[0061] (C) TMR-DN fluorescence confocal imaging was used to detect VEGFA mRNA containing the RhoBAST aptamer in HK-2 cells;

[0062] Figure 5 The HuR inhibitor MS-444 was used to reverse the stability of HuR on VEGFA mRNA2 under hypoxic conditions.

[0063] (A) The effect of different concentrations of MS-444 intervention on VEGFA mRNA expression in HK-2 was detected by RT-qPCR;

[0064] (B) The effect of different concentrations of MS-444 intervention on the expression level of VEGFA protein in the supernatant of HK-2 cells was detected by ELISA.

[0065] Figure 6 Therapeutic VEGFA mRNA 2 promotes the proliferation of hypoxic endothelial cells in response to hypoxia.

[0066] (A) is a schematic diagram of the transwell experiment. For specific implementation details, please refer to Example 3.

[0067] (B and C) show the Ki67 staining and positive rate statistics of endothelial cells;

[0068] (D) Western Blot was used to detect the expression levels of phosphorylated VEGF receptor 2 (p-VEGFR2) and total VEGFR2 in endothelial cells.

[0069] Figure 7 Construction and characterization of EV-based mRNA delivery systems:

[0070] The groupings are defined as follows: EV-NC: Negative Control (NC) with empty vector; EV-NHR: EVs carrying non-hypoxia responsive (NHR) VEGFA mRNA; EV-HR: EVs carrying hypoxia responsive (HR) VEGFA mRNA.

[0071] (A) describes the construction process of an EV-based mRNA delivery system;

[0072] (B) The median particle size of each group of EVs is shown in the nanoparticle size analysis.

[0073] (C) Western Blot validation of EV markers (CD63 / CD9 / Alix positive) and contaminants (GM130 / APOE negative);

[0074] (D) Transmission electron microscopy images showing the morphological differences of each group of EVs;

[0075] (E) Quantification of EV production in each group (particle count / mL cell supernatant);

[0076] (F and G) represent the absolute quantification of VEGFAmRNA loading in each group of EVs by droplet digital PCR (ddPCR);

[0077] (H) represents the modification efficiency of FITC-labeled LTH on the surface of EVs as detected by nanoflow cytometry.

[0078] (I) To show the accumulation changes of DIR-labeled LTH-modified EVs in various organs using in vivo fluorescence imaging;

[0079] Figure 8 To demonstrate that the hypoxia-responsive mRNA delivery system has a significant therapeutic effect on promoting the proliferation of endothelial cells under hypoxic stimulation:

[0080] (A) Confocal microscopy to show the uptake of DID-labeled EVs by hypoxic HK-2 cells;

[0081] (B) RT-qPCR detection of VEGFA mRNA expression in HK-2 after EV intervention in each group;

[0082] (C) ELISA was used to detect the expression level of VEGFA protein in the supernatant of HK-2 cells after EV intervention in each group;

[0083] (D) The effect of HK-2 cell supernatant on endothelial cell viability after EV intervention in each group was detected by CCK-8 assay;

[0084] (E) Western Blot was used to detect the effect of HK-2 cell supernatant after EV intervention on the expression levels of phosphorylated VEGFR2 and total VEGFR2 in endothelial cells;

[0085] Figure 9 The hypoxia-responsive VEGFA mRNA was overexpressed in the kidneys after IRI injury, and no off-target expression was observed in other organs.

[0086] (A) Hur immunofluorescence staining of kidney tissue shows changes in Hur expression after IRI;

[0087] (B) is a schematic diagram of animal experiment design;

[0088] (C) Immunofluorescence staining was used to assess the protein expression of Hur and VEGFA in renal tissue on day 3 of renal ischemia-reperfusion injury (IRI);

[0089] (D) Immunohistochemical staining to detect VEGFA protein in extrarenal organs (liver, spleen, lung) on ​​day 3 of IRI;

[0090] Figure 10 To demonstrate that the hypoxia-responsive mRNA delivery system significantly improves renal angiogenesis without abnormal angiogenesis in extrarenal organs:

[0091] (A) Survival curve analysis of the improvement in survival rate by EV-HR;

[0092] (B) PAS staining on day 7 of IRI shows the improvement of renal tissue damage caused by EV-HR;

[0093] (C) CD31 immunofluorescence staining of kidney tissue on day 7 of IRI shows the improvement of peritubular capillary sparseness by EV-HR;

[0094] (D) Renal sagittal high-resolution ultrasound imaging on day 7 of IRI shows renal microvascular density;

[0095] (E) CD31 immunohistochemical staining of extrarenal organs (liver, spleen, lung) on ​​day 7 of IRI showed abnormal vascular proliferation in extrarenal organs. Detailed Implementation

[0096] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0097] Unless otherwise specified, all reagents or instruments used in the embodiments of this invention are commercially available conventional reagent products.

[0098] Materials and reagents

[0099] Plasmids were purchased from Shanghai Jikai Gene Co., Ltd. HEK 293F cells were purchased from Thermo Fisher Scientific. The human proximal tubule epithelial cell line (HK-2) was purchased from Guangzhou Saiku Biotechnology Co., Ltd. Umbilical vein endothelial cells were extracted from umbilical cord samples from Zhongda Hospital Affiliated to Southeast University (ethics number: 2023ZDSYLL118-P01). C57bL / 6J background wild-type mice were purchased from Beijing Vital River Biotechnology Co., Ltd. The antibody and reagent information used in this invention is as follows: HuR antibody (Abcam, catalog number ab200342; Santa Cruz Biotechnology, catalog number sc-5261), VEGFA antibody (Santa Cruz Biotechnology, catalog number sc-5261), and VEGFA antibody (Santa Cruz Biotechnology, catalog number sc-5261). CruzBiotechnology (sc-7269); Abcam (ab185238); CD31 antibody (abcam, ab281583); pVEGFR2 antibody (CST, Y1175); VEGFR2 antibody (CST, 55B11); CD63 antibody (abcam, catalog number); CD9 antibody (abcam, ab236630); Alix antibody (abcam, ab275377); GM130 (BD, 610822); β-actin (Proteintech, 66099-1|-Ig); MS-444 (MCE, HY-100685); DMSO (Thermo Fisher Scientific, 67-68-5); TMR-DN fluorescent dye (Tetramethylrhodamine). dinitroaniline (Lumiprobe, catalog number 2641), VEGFA ELISA kit (R&D Systems, catalog number DY293B-05), and SonoVe (BRACCO).

[0100] The RT-qPCR primers used are as follows:

[0101] VEGFA mRNA 5'-3' forward primer: AAGGAGGAGGGCAGAATCAT=SEQ ID NO.15

[0102] VEGFA mRNA 5'-3' reverse primer: CCAGGCCCTCGTCATTG = SEQ ID NO.16

[0103] Cell culture and intervention

[0104] HEK293F was cultured using SMM293-TⅡ medium (Sino Biological Company, catalog number A14351-01), OPM-293CD05 medium (Shanghai Aopomai Company, catalog number 81075-001), and GlutaMAX. TM The additive (Thermo Fisher Scientific, catalog number 35050-061) was cultured in a medium prepared at a ratio of 50:50:1 and placed in a vertical CO2 shaking incubator (parameters: 37°C, 8% CO2, 90% humidity, 100 rpm).

[0105] HK-2 cells were routinely cultured in DMEM / F12 medium (Thermo Fisher Scientific, catalog number 25200072) containing 10% fetal bovine serum (Thermo Fisher Scientific, catalog number 11966025), 1% penicillin, streptomycin, and amphotericin B.

[0106] Endothelial cells were routinely cultured using ECM medium (Sciencell, catalog number 1001).

[0107] The hypoxia treatment of HK-2 and endothelial cells was as follows: when the cells grew to 70-80% density, the medium was replaced with serum-free medium. After 24 hours, the hypoxia group was replaced with DMEM glucose-free and serum-free medium (Thermo Fisher Scientific, catalog number 11966025) and placed in a three-gas incubator. The hypoxia culture conditions were 37°C, 5% CO2, 1% O2 and 94% N2.

[0108] plasmid construction

[0109] See Example 1.

[0110] HK-2 plasmid transfection was performed using lipofectamine. TM 3000 (lipo3000, Thermo Fisher Scientific, catalog number L3000015) was used as the transfection reagent, and the transfection medium was opti-MEM medium (Thermo Fisher Scientific, catalog number 31985070). The transfection process is detailed in Example 2.

[0111] HEK293F cell plasmid transfection

[0112] HEK-293F cells were used at a rate of 2 × 10⁻⁶ 6 Seed at a density of 10 cells / mL. Dilute plasmid DNA with Opti-MEM medium to a concentration of 1 μg DNA / 10 mL. 6Cells were cultured, and then PEI MAX-40K transfection reagent (Polysciences, catalog number 24765-1) was mixed in Opti-MEM medium at a ratio of 1 μg DNA: 2 μg PEI. The diluted plasmid and diluted PEI MAX-40K were mixed and allowed to stand for 5 min each. The PEI MAX-40K dilution was added to the plasmid DNA dilution, mixed and allowed to stand for 15 min. Then, the mixture was added dropwise to the cell culture medium (final plasmid concentration 2 μg / mL), shaken well and returned to the incubator.

[0113] Acquisition and purification of drug-loaded EVs

[0114] The cell supernatant was used to obtain and purify drug-loaded EVs by low-temperature (4°C) differential centrifugation (500g 10min; 2000g 25min; 13500g 30min; 100000g 2h) and size exclusion chromatography (SEC).

[0115] Drug-loaded EVs lipid-anchored targeted peptide modification

[0116] Take 1.5 × 10 11 The drug-loaded EVs were co-incubated with 100 μL of a lipid-anchored targeting peptide solution (Enzekangtai Pharmaceutical Co., Ltd., catalog number EA-12-5, concentration 1 mg / mL) at 25°C and 250 rpm for 3 h with shaking. The sample was then incubated at 4°C for 24 h. The sample was then transferred to an ultrafiltration tube (Millipore Pharmaceutical Co., Ltd., catalog number UFC810096, 100 kDa molecular weight cutoff) for purification to remove the free lipid-anchored targeting peptide, yielding the targeted-modified drug-loaded EVs.

[0117] Animal processing

[0118] A mouse model of ischemic acute kidney injury was induced by renal ischemia-reperfusion. Mice were anesthetized with isoflurane, and the bilateral renal pedicles were clamped through a lateral spinal incision for 28 minutes. The arterial clamps were then removed to restore renal blood supply. The mice's body temperature was maintained at 36-37°C throughout the process using a thermostat. After recovery from anesthesia, mice were administered a tail vein injection of 2×10⁻⁶ doses for three consecutive days. 10 The drug-loaded EVs were administered per 8-week-old C57BL / 6J mouse. Mice were sacrificed on days 1, 3, and 7 post-surgery. Blood samples were collected from the retroorbital venous plexus for renal function testing, and kidney tissue was harvested for subsequent molecular biology experiments and pathological staining. Some mice were injected via the tail vein with 100 μL of SonoVine (5 mg / mL) on day 7 post-surgery, and renal super-resolution ultrasound imaging was performed immediately.

[0119] Example 1

[0120] Design and plasmid construction of hypoxia-responsive therapeutic VEGFA mRNA

[0121] Based on clinically validated VEGFA mRNA sequences, the inventors designed a hypoxia-responsive element with a HuR-specific binding motif in the 3'UTR. Through literature review of specific sequences binding to HuR and VEGFA, the applicant screened and designed two ARE sequences of different lengths (mRNA 2 and mRNA 3) that specifically bind to the HuR protein, using mRNA without the ARE sequence as a control (mRNA 1). Figure 1 ).

[0122] 5'UTR sequence:

[0123] 5'7MeGpppG2'OMeGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAA UAUAAGAGCCACC=SEQID NO.1

[0124] Encoded sequence:

[0125] =SEQ ID NO.2

[0126] mRNA 1 3' UTR sequence: No ARE sequence

[0127] GCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCC AGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAA GUCUGAGUGGGCGGC=SEQ ID NO.3

[0128] mRNA 2' 3' UTR sequence: ARE-rich HuR hypoxia-binding core sequence

[0129] AAUUCUACAUACUAAAUCUCUCCUUUUUUAAUUUUAAUAUUUG=SEQ ID NO.4

[0130] mRNA 3'UTR sequence: HuR hypoxia-binding extension sequence rich in more AREs

[0131] UUUAAUUUUGCUAACACUCAGCUCUGCCCUCCCCUGUCCCCACCACACAUUCCUUUGAAAUAAGGUUUCAAUACAUUUACAUACUAUAUAUAUUUGGCAACUUGUGUUUGUAUAUAAAUAUAUAUAUAUAUAUAUGUUUAUGUAUAUAUGUGAUUCUGAUAAAAUAGAC SEQ ID NO.5

[0132] RhoBAST sequence:

[0133] AGAGUCGACAUAGAGGAACCUCCGCGAAAGCGGUGAAGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCCUCAUAACAAGGCCUCCGCGAAAGCGGUGAAGGAGCGGCACAAGGUUAACUGCCGCAGGCCUUGUAUACUCGA CAUAGGAAGACCUCCGCGAAAGCGGUGAAGGAGCGGUGCAAGGUUAACCACCGCAGGUCUUCCAUAAGCAGACCUCCGCGAAAGCGGUGAAGGAGUGGCGCAAGGUUAACCGCCACAGGUCUGCUAUACUCGAGAGA=SEQ ID NO.6 The core VEGFA mRNA sequence of the present invention is: mRNA 2

[0134] 5' cap + [SEQ ID NO:1] + [SEQ ID NO:2] + [SEQ ID NO:4] + RhoBAST sequence + PolyA tail.

[0135] Secondly, recombinant expression plasmids were designed and synthesized based on the VEGFA mRNA sequence for subsequent experiments. Figure 2 The specific steps are as follows: The GV219 vector was digested with restriction endonucleases XhoI and KpnI, reacted at 37℃ for 3 hours, and the linearized fragment was purified by agarose gel electrophoresis. The VEGFA mRNA1, 2, and 3 sequences were amplified by PCR (Note: the VEGFA mRNA1, 2, and 3 sequences are the 5' UTR sequence + coding sequence + mRNA 1 (2 or 3) + RhoBAST sequence mentioned above, without any other nucleotides interspersed) to obtain the target gene fragment of the plasmid. The primer sequences used are as follows:

[0136] mRNA 1 forward primer: ACGGGCCCTCTAGACTCGA GGGGAAATAAGAGAGAAAAGAAG=SEQ ID NO.7;

[0137] mRNA 1 reverse primer: TTAAACTTAAGCTTGGTACCGGAACCTGAGGCGGTTAACCTTGC=SEQ IDNO.8;

[0138] mRNA 2 forward primer: ACGGGC CCTCTAGACTCGAGGGGAAATAAGAGAGAAAAGAAG=SEQ ID NO.9;

[0139] mRNA 2 reverse primer:

[0140] TTAAACTTAAGCTTGGTACCGGAACCTGAGCGCGGTTAACCTTGC=SEQ ID NO.10;

[0141] mRNA 3 forward primer:

[0142] ACGGGCCCTCTAGACTCGAGGGGAAATAAGAGAGAAAAGAAG=SEQ ID NO.11;

[0143] mRNA 3 reverse primer:

[0144] TTAAACTTAAGCTTGGTACCGGAACCTGAGGGCGGTTA ACCTTGC=SEQ ID NO. 12.

[0145] The amplification primers used were designed with homologous recombination sequences added to the 5' end (upstream sequence: GGGAAATAAGAGAGAAAAGAAG=SEQ ID NO.13; downstream sequence: CATAAGCAGACCTCCGCGAAAGCGGTGAAGGAGTGGCGCAAGGTTAACC GCCACAGGTCTGCTATACTCGAGAGA=SEQ ID NO.14). Using these primers to amplify the target gene fragment, the 5' and 3' terminal sequences of the amplification product were completely identical to the terminal sequences of the linearized cloning vector. The linearized vector and the target gene amplification product were mixed at a molar ratio of 1:2 and incubated at 37°C for 30 minutes to complete in vitro circularization. The recombinant product was transformed into Stbl3 competent cells, gently tapped a few times to mix, and incubated on ice for 30 minutes. It was then heat-shocked at 42°C for 90 seconds and incubated in an ice-water bath for 2 minutes. The mixture was then plated on LB agar plates containing ampicillin (100 μg / mL) and incubated upside down at 37°C for 16 hours. Single clones were selected from the plates for PCR identification. Positive clones were sequenced and the results analyzed, showing a 100% sequence accuracy. The correctly cloned bacterial cultures were then expanded and extracted to obtain high-purity plasmids for subsequent experiments. (All steps were completed by Shanghai Jikai Gene Medical Technology Co., Ltd.)

[0146] Example 2

[0147] In vitro validation of hypoxia-responsive therapeutic VEGFA mRNA

[0148] The inventors constructed a hypoxia model (94% N2, 5% CO2, 1% O2) using human renal tubular epithelial cells (HK-2). HK-2 cells were routinely cultured in DMEM-F12 complete medium containing 10% fetal bovine serum at 37°C and 5% CO2. When the cell density reached 70-80%, the hypoxia group was replaced with DMEM glucose-free and serum-free medium, and 10 μM of the HuR inhibitor MS-444 and an equal volume of DMSO were added as a control. After 24 hours of hypoxia in a tri-gas incubator, immunofluorescence showed that under normoxic conditions, HuR protein was mainly localized in the cell nucleus, while after hypoxia, HuR protein shifted from the nucleus to the cytoplasm. MS-444 inhibited this shift. Figure 3 ).

[0149] The inventors selected HK-2 cells with a seeding density of 70-80% and mixed different VEGFA plasmids with lipofectamine. TM Lipo3000 was mixed in Opti-MEM medium at a ratio of 1 μg DNA: 2 μL Lipo3000 and incubated at room temperature for 20 minutes. The complex was then added to HK-2 culture plates (final plasmid concentration 2.5 μg / mL). 6-8 hours after transfection, the medium was replaced with glucose-free and serum-free medium. After 24 hours of hypoxia, cells and cell supernatant were collected, and VEGFA mRNA and protein levels were detected by RT-qPCR and ELISA. Results showed that the mRNA and protein expression levels of plasmid 2 and plasmid 3 groups were higher under hypoxic conditions than under normoxic conditions, while the increase in plasmid 1 group was not significant. Among them, plasmid 2 group showed the most significant fold increase in expression, with mRNA levels increasing 2.5 times compared to the normoxic group. Figure 4 A), protein expression increased 2-fold ( Figure 4 B). Additionally, TMR-DN fluorescence (working concentration 1 μM, incubation at room temperature for 30 minutes) was used to trace VEGFA mRNA containing the RhoBAST aptamer in HK-2 cells. The results showed that plasmid group 2 exhibited the most significant red fluorescence aggregation under hypoxic conditions, with a signal intensity 2.1 times stronger than the normoxic group; plasmid group 3 showed a 1.3-fold increase in fluorescence intensity; while the fluorescence change in plasmid group 1 was not statistically significant. Figure 4 C). The above results indicate that VEGFA mRNA 2 is a hypoxia-stable dominant sequence. To verify the stability of HuR on VEGFA mRNA 2, the addition of the HuR inhibitor MS-444 (5 μM and 10 μM) to glucose-free and serum-free culture medium significantly reduced the expression levels of mRNA and protein in plasmid groups 2, showing a dose-dependent relationship with MS-444. Figure 5 In summary, we selected mRNA 2 as the preferred sequence for validating therapeutic VEGFA mRNAs that respond to hypoxia in HuR.

[0150] Example 3

[0151] Validation of the endothelial cell proliferation-promoting effect of hypoxia-responsive therapeutic VEGFA mRNA

[0152] The inventors verified the efficacy of hypoxia-responsive therapeutic VEGFA mRNA 2 through transwell co-culture experiments. Figure 6 A). Human renal tubular epithelial cells (HK-2) were seeded in the upper chamber of a Transwell culture medium. VEGFA plasmids 1 and 2 were mixed with lipo3000 at a ratio of 1 μg DNA: 2 μL lipo3000 in Opti-MEM medium and incubated at room temperature for 20 minutes. The complexes were then added to the HK-2 medium (final plasmid concentration: 2.5 μg / mL). After 6-8 hours of transfection, the upper chamber was replaced with glucose-free and serum-free medium containing DMSO / MS-444 (10 μM), and the lower chamber was replaced with pre-seeded umbilical vein endothelial cells. Both were subjected to hypoxia for 24 hours. Endothelial cells from the lower chamber were collected for Ki67 staining and phosphorylated VEGFR2 protein detection. The results showed that the proportion of Ki67-positive cells in plasmid group 2 was significantly higher than that in plasmid group 1, while the proportion of Ki67-positive cells in plasmid group 2 decreased after the addition of MS-444. Figure 6 (B and C). Similarly, the phosphorylated VEGFR2 protein / total VEGFR2 protein ratio in plasmid group 2 was significantly higher than that in plasmid group 1, while the expression in plasmid group 2 decreased after the addition of MS-444. Figure 6 D). The above results indicate that under hypoxic conditions, VEGFA mRNA 2 exhibits strong HuR-dependent stability, resulting in the translation of more VEGFA protein, thereby promoting endothelial proliferation.

[0153] In summary, we regard the VEGFA mRNA 2 sequence as the hypoxia-responsive therapeutic VEGFA mRNA sequence indicated in this invention.

[0154] Example 4

[0155] Further in-depth research on the construction and characterization of EV-based mRNA delivery systems

[0156] First, we transfected hypoxia-responsive and non-hypoxia-responsive VEGFA recombinant plasmids into HEK 293F cells. After culturing for 72 hours, we collected the cell supernatant and extracted and purified EVs by differential centrifugation and size exclusion chromatography. Further, we modified the surface of EVs with the kidney-targeting peptide LTH (sequence LTHVVWL = SEQ ID NO.17) using cholesterol-PEG2000 conjugation technology to obtain targeted drug-loaded EVs. Figure 7 A). Nanoparticle size analysis showed that the median particle size of EV-NC, EV-NHR, and EV-HR was 155±5 nm. Figure 7B), Western blotting confirmed that the three groups of EVs expressed positive exosome marker proteins CD63, CD9, and Alix, while the pollutants GM130 and APOE were negative. Figure 7 C). Transmission electron microscopy imaging shows that EVs exhibit a typical cup-shaped morphology and the membrane structure is intact. Figure 7 D). The EV yields of the three groups were stable with no significant differences, all at 1.55 ± 0.5 × 10⁻⁶. 10 Particle count / mL cell supernatant ( Figure 7 E). This indicates that plasmid transfection does not affect the biogenicity and key therapeutic properties of EVs. We performed absolute quantification of VEGFA mRNA in the same number of EVs using ddPCR. The results showed that the VEGFA mRNA copy number in EV-NHR was 41.53±3.40 times higher than that in EV-NC, and in EV-HR it was 43.06±6.68 times higher than that in EV-NC, indicating that both therapeutic plasmids achieved efficient drug loading, while there was no statistically significant difference between EV-NHR and EV-HR. Figure 7 F and G). Nanoflow cytometry results showed that the modification efficiency of FITC-labeled LTH peptide was 100% (F and G). Figure 7 H), and there was no significant difference in modification efficiency among the groups. In vivo fluorescence imaging showed that DIR-labeled LTH-modified EVs accumulated significantly more in the kidneys, while accumulation in other organs decreased (H). Figure 7 I). All the above results demonstrate that the EV-based mRNA delivery system achieves efficient loading and renal targeting of hypoxia-responsive therapeutic mRNAs.

[0157] Example 5

[0158] In vitro validation of the hypoxia response mechanism and efficacy of the mRNA delivery system

[0159] To verify the hypoxia-responsive therapeutic mechanism of the delivery system, DID-labeled engineered EVs were co-incubated with HK-2 cells (see “Materials and Methods”). Confocal microscopy showed no significant difference in the uptake efficiency of EVs within HK-2 cells among the different groups. Figure 8 A). qRT-PCR detection showed that under hypoxic conditions, VEGFA mRNA in HK-2 cells of the EV-HR group was significantly higher than that of the EV-NHR group ( Figure 8 B). ELISA analysis of cell supernatant showed that the secretion of VEGFA protein in the EV-HR and EV-NHR groups was significantly higher than that in the EV-NC group, and the EV-HR group showed nearly twice the level of the EV-NHR group. Figure 8 C) The above results all indicate that under hypoxic conditions in vitro, EVs can successfully load and deliver hypoxic response VEGFA mRNA.

[0160] To further evaluate the efficacy of the delivery system in responding to hypoxia, we intervened with HK-2 cell supernatant to treat endothelial cells and observed its promoting effect on angiogenesis. The CCK-8 assay showed that endothelial cell viability was significantly increased in both the EV-NHR and EV-HR groups after supernatant intervention, with the EV-HR group exhibiting significantly higher cell viability than the EV-NHR group. Figure 8 D). Western blot analysis showed that both the EV-NHR and EV-HR groups significantly activated the VEGFR2 signaling pathway in endothelial cells. The expression level of phosphorylated VEGFR2 (p-VEGFR2) in the EV-HR group was higher than that in the EV-NHR group, while the total VEGFR2 level showed no significant difference. Figure 8 E). The above data confirm that the hypoxia-responsive delivery system (EV-HR) can specifically enhance the synthesis and secretion of VEGFA in the ischemic microenvironment and effectively activate downstream angiogenesis signals.

[0161] Example 6

[0162] In vivo targeting of hypoxia-responsive VEGFA mRNA delivery system

[0163] This embodiment assesses the in vivo distribution of the mRNA delivery system based on a mouse model of renal intrarenal renal intubation (IRI). Immunofluorescence showed that on days 1, 3, and 7 after renal IRI, the ischemic area of ​​the kidney exhibited proximal tubules (Ltl-positive) with increased HuR expression in the cytoplasm of these cells. Figure 9 A). We then randomly divided 40 C57BL / 6J mice into four groups: sham operation group, I / R (ischemia / reperfusion) + EV-NC group, I / R + EV-NHR group, and I / R + EV-HR group. For the first 3 days post-operation, the mice received daily tail vein injections of the aforementioned drug-loaded EVs (2 × 10⁻⁶). 10 Particles / times) Figure 9 B). Immunofluorescence staining of HuR and VEGFA in renal tissue three days post-surgery showed that the EV-HR group had significantly increased VEGFA protein expression in the renal ischemic area (hypoxia), co-localizing with the HuR nuclear-cytoplasmic metastasis region, while the EV-HR group only showed a slightly higher expression level than the model group, indicating that the EV-HR group achieved a stable hypoxic response. Figure 9 C). Furthermore, the expression levels of VEGFA in the liver, spleen, and lung tissues of the EV-HR group were not significantly different from those of the sham-operated group, indicating that the hypoxia-responsive mRNA we constructed avoided deposition in non-hypoxic regions. Figure 9 D). In summary, in vivo experimental data confirm that the hypoxia-responsive VEGFA mRNA delivery system constructed in this invention can achieve efficient and precise specific activation in the hypoxic region of the kidney.

[0164] Example 7

[0165] In vivo validation of the efficacy and safety assessment of the mRNA delivery system

[0166] This embodiment evaluates the therapeutic effect of the mRNA delivery system based on a renal IRI mouse model. Survival curves show that the EV-HR group achieved a 100% survival rate at 7 days post-surgery, significantly higher than the model group (70%) and the EV-NHR group (85%). Figure 10 A). PAS staining of kidney tissue 7 days post-surgery showed ( Figure 10 B), the degree of pathological damage in the EV-HR group was significantly lower than that in the model group, and CD31 staining showed a significant improvement in perivascular capillary density. Figure 10 C), while the EV-NHR group showed no significant improvement. Sagittal super-resolution ultrasound imaging of the kidneys showed a significant decrease in renal microvessel density after IR injury, and a significant increase in renal microvessel density after EV-HR treatment, which was higher than that in the EV-NHR group (C). Figure 10 D). Furthermore, the expression levels of CD31 in the liver, spleen, and lung tissues of the EV-HR group after kidney injury were not significantly different from those in the sham-operated group, indicating that our constructed mRNA delivery system avoided abnormal angiogenesis in other uninjured areas. Figure 10 E). The above data confirm that the hypoxia-responsive delivery system (EV-HR) can significantly increase VEGFA expression in ischemic kidneys and promote angiogenesis without systemic side effects.

[0167] Examples 5-7 demonstrate that this invention achieves precise accumulation and spatiotemporally responsive activation of VEGFA mRNA in the ischemic area of ​​the kidney through the synergistic design of LTH-targeting peptide modification and HuR hypoxia-responsive sequences. In vivo experiments have confirmed that it can significantly restore renal blood flow and avoid non-target organ toxicity, providing an innovative solution for the precision treatment of ischemic diseases.

[0168] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.

Claims

1. A hypoxia-responsive therapeutic VEGFAmRNA, characterized in that, Include: (1) Open Reading Frame (ORF) encoding VEGFA protein; (2) The 5' untranslated region UTR located upstream of the ORF contains the Kozak sequence; (3) The 3'UTR located downstream of the ORF contains a specific binding site for the RNA-binding protein human antigen R (HuR), which is a region rich in adenylate uridine rich element (ARE); (4) Located at the end of the 3'UTR, it contains the fluorescently lit RNA aptamer RhoBAST for live-cell super-resolution RNA imaging. (5) 5' end cap structure and 3' end PolyA tail.

2. The hypoxia-responsive therapeutic VEGFAmRNA according to claim 1, characterized in that, The nucleotide sequence of the HuR-specific binding site in the 3'UTR is shown in SEQ ID NO:4 or 5.

3. The method for verifying the stability of hypoxia-responsive therapeutic VEGFAmRNA as described in any one of claims 1-2, comprising the following steps: (1) Transfect the recombinant expression vector containing the VEGFAmRNA into mammalian cells; (2) The transfected cells were cultured under hypoxic and normoxic conditions, respectively. (3) The expression levels of VEGFAm RNA and protein under hypoxic and normoxic conditions were detected to verify its hypoxia response stability.

4. A pharmaceutical composition comprising the hypoxia-responsive therapeutic VEGFAmRNA of claim 1 or 2, and a pharmaceutically acceptable carrier or delivery system.

5. A VEGF AmRNA delivery system based on engineered extracellular vesicles, characterized in that, Include: (1) Loading the hypoxia-responsive therapeutic VEGFAmRNA as described in claim 1; (2) The extracellular vesicle membrane surface is modified with kidney-targeting peptide LTH, with the amino acid sequence LTHVVWL, which is connected to the vesicle membrane structure lipid anchor through a cholesterol-PEG2000 coupling chain. (3) The delivery system accumulates highly in ischemic kidneys and lowly in non-ischemic organs, and the expression levels of VEGFAm RNA and protein are significantly increased under hypoxic conditions compared to normoxic environments.

6. The delivery system according to claim 5, characterized in that, The extracellular vesicles are derived from, but are not limited to, human embryonic kidney cell lines (HEK293 and its derived subtypes).

7. The delivery system according to claim 5, characterized in that, The copy number of VEGFAmRNA in the drug-loaded extracellular vesicles was 41.53 ± 3.40 times that of the empty EV.

8. A method for preparing the delivery system according to any one of claims 5-7, characterized in that, Includes the following steps: (1) Construct a hypoxia-responsive therapeutic VEGFAmRNA expression plasmid, transfect extracellular vesicle-derived cells, and collect cell supernatant 72 h after transfection; (2) Extracellular vesicles were purified by low-temperature (4℃) differential centrifugation: 500g, 10min; 2000g, 25min; 13500g, 30min; 100,000g, 2h, combined with size exclusion chromatography (SEC). (3) The target peptide molecules were linked to extracellular vesicles by co-incubation, shaking at 250 rpm for 3 h at 25℃ and then standing at 4℃ for 24 h. (4) Use ultrafiltration centrifuge tubes (100kDa molecular weight cutoff) to remove free target peptide molecules and obtain drug-loaded EVs.

9. The use of the hypoxia-responsive therapeutic VEGFAmRNA as described in claim 1 or 2, or the delivery system as described in any one of claims 5-7, in the preparation of a medicament for promoting vascular repair, characterized in that, The drug is used to treat ischemic diseases, organ ischemia-reperfusion injury, or chronic wounds.

10. The use of the drug delivery system according to any one of claims 5-7 in the preparation of a drug that promotes angiogenesis after renal ischemia-reperfusion injury (IRI), characterized in that, The intravenous dose is 2 × 10⁻⁶ per day on days 1, 2, and 3 after injury. 10 In 8-week-old C57BL / 6J mice, drug-loaded EVs per mouse resulted in increased renal VEGFA protein expression 3 days after treatment and significantly increased renal microvascular density 7 days after treatment, without any abnormal vascular proliferation in extrarenal organs.

Images