Gene-knockout attenuated granulin / IL-12 recombinant plasmid, recombinant bacillus calmette guerin vaccine and application of recombinant plasmid and recombinant bacillus calmette guerin vaccine
By constructing a gene knockout attenuated granulosin/IL-12 recombinant plasmid and combining it with the BCGΔtrpD strain, a recombinant BCG vaccine was constructed, which solved the problems of insufficient efficacy and toxic side effects of BCG in the treatment of bladder cancer, and achieved the effects of enhancing anti-tumor immune activity and reducing toxicity.
Patent Information
- Application Number
- CN202511101155.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-07
- Publication Date
- 2025-11-18
AI Technical Summary
The existing BCG vaccine has problems in the treatment of bladder cancer, such as insufficient efficacy, high tumor recurrence rate, multi-organ toxicity and limited immune response, making it difficult to balance the enhancement of efficacy and the reduction of toxicity.
By constructing a gene knockout and attenuated granulosin/IL-12 recombinant plasmid using genetic engineering technology, and combining it with BCGΔtrpD strain, a recombinant BCG vaccine was constructed, achieving dual eukaryotic expression of IL-12 and GLS genes, enhancing anti-tumor immune activity and reducing toxic side effects.
It improved the efficacy of bladder cancer treatment, reduced toxic side effects, enhanced anti-tumor effects, corrected Th1 immune imbalance, and achieved improvements in safety and anti-tumor efficacy.
Smart Images

Figure CN120966863A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of recombinant Bacille Calmette-Guerin, in particular to a granulysin / IL-12 recombinant plasmid with gene knockout attenuation, a recombinant Bacille Calmette-Guerin and application thereof. BACKGROUND
[0002] BC is a common malignant tumor of the urinary system worldwide, and NMIBC accounts for about 80% of BC. Given the severe situation of the high incidence of BC and its serious threat to patients' health, it is particularly crucial to explore effective treatment methods to improve patient survival rate and quality of life.
[0003] Traditional transurethral tumor resection can remove tumors, but due to local tumor residue or incomplete removal of micro lesions, the risk of recurrence is high. Therefore, postoperative adjuvant intravesical therapy has become an important means to reduce the recurrence rate and progression risk. Among them, Bacillus Calmette-Guerin (BCG) as the "gold standard" for postoperative adjuvant intravesical therapy for intermediate and high-risk NMIBC, plays an important role in reducing the recurrence rate of NMIBC and delaying its progression to muscle-invasive disease. However, about 25%-45% of patients do not produce the expected therapeutic effect after BCG treatment. Therefore, it is extremely important to find an effective treatment method for BC.
[0004] In order to improve the therapeutic effect of BCG, researchers have explored combined immunotherapy and the development of recombinant BCG strains in recent years. Clinical trials of combined immune checkpoint inhibitors and BCG treatment have shown significant anti-tumor effects. Recombinant BCG can enhance the expression of immune modulating molecules such as PAMP to improve the immune level and anti-tumor effect, which further proves the potential of recombinant BCG in the treatment of bladder cancer. Although BCG treatment has made significant progress in the treatment of bladder cancer, there are still problems in its clinical application: insufficient efficacy: about 25%-45% of patients do not respond to BCG treatment, and the tumor recurrence rate is high; multi-organ toxicity: traditional BCG treatment is prone to cause serious adverse reactions such as disseminated infection, hepatitis, and pneumonia; immune response is limited: BCG depends on Th1 type immune response, but the proportion of Th1 cells in the bladder cancer microenvironment is significantly reduced, leading to insufficient immune activation; safety issues: the existing BCG strain has high toxicity, and long-term use may cause organ damage, making it difficult to balance "efficiency" and "attenuation".
[0005] The existing improvement schemes are combined immune checkpoint inhibitors or development of recombinant BCG strains, but there are still problems such as unstable efficacy and no significant improvement in toxic side effects. Therefore, there is an urgent need for a new type of BCG strain with high anti-tumor activity and low toxicity. SUMMARY
[0006] In view of the deficiencies of the prior art, the application provides a gene knockout attenuated granulysin / IL-12 recombinant plasmid and a recombinant BCG vaccine and application, the traditional BCG is reformed through genetic engineering technology, the side effects are reduced, and the anti-tumor immune activity is enhanced, and the application is suitable for postoperative adjuvant therapy of non-muscular layer invasive bladder cancer.
[0007] The application adopts the technical scheme of a gene knockout attenuated granulysin / IL-12 recombinant plasmid, the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO:1, and the recombinant plasmid contains an IL-12 and GLS gene fragment.
[0008] A gene knockout attenuated granulysin / IL-12 recombinant BCG vaccine contains the above-mentioned recombinant plasmid.
[0009] A preparation method of a gene knockout attenuated granulysin / IL-12 recombinant BCG vaccine,
[0010] (1) constructing a plasmid pZM03;
[0011] (2) introducing the plasmid into a BCGDeltaTrpD strain, and screening positive clones;
[0012] (3) culturing the positive clone bacteria, centrifuging, and freeze-drying to obtain the recombinant BCG vaccine.
[0013] Further, the specific steps of the (1) include:
[0014] The human GLS gene is amplified from the same antigen activated human CTL cells by RT-tube PCR, and is cloned into a pEGFP vector, the GLS gene fragment is subcloned into a Hind III / Bam HI site of a double-promoter eukaryotic co-expression plasmid pBudCE4.1; meanwhile, the IL-12 fragment amplified from the vector pSFG-mIL-12 carrying the murine single-chain IL-12 gene is subcloned into a Not I / Kpn I site; and the mycobacterium replicon OriM fragment amplified from the plasmid pAL5000 is subcloned into a Nhe I site.
[0015] Further, the specific steps of the (2) include:
[0016] The pZM03 plasmid is introduced into the BCGDeltaTrpD strain by an electroporation method, positive clones are screened by using a bleomycin resistance plate, the IL-12, GLS and ORIM fragments are amplified by acid-fast staining and bacterial liquid PCR, and the recombinant strain is identified.
[0017] Further, the specific steps of the (3) include:
[0018] The positive recombinant strain identified by PCR and phenotype is inoculated into liquid medium containing bleomycin, and incubated at 37 DEG C until the logarithmic phase, and then transferred into 2L of the same medium at a ratio of 1:100, and incubated at 37 DEG C for about 10-12 days until the early stationary phase, and then the bacteria are harvested, the bacteria are collected by centrifugation at 4 DEG C and 5000xg for 15 minutes, washed twice with PBS containing 10% glycerol, and resuspended to a concentration of about 1x10 10 CFU / mL -1 The final concentration of 5% skim milk powder is added as a freeze-drying protective agent, mixed, and then distributed into a thimble, pre-frozen at-80 DEG C for 2 hours, dried in a freeze dryer, and then sealed with nitrogen after freeze-drying, and stored at 4 DEG C in the dark, thereby obtaining the rBCGΔtrpD::pZM03 biological preparation product.
[0019] The gene knockout attenuated granulysin / IL-12 recombinant BCG as described above is used for treating bladder cancer.
[0020] The present application combines the TrpD gene knockout of BCG with the IL-12 / GLS double-gene eukaryotic expression system to construct a recombinant BCG strain, realizes the dual functions of "synergistic effect and attenuation", and is used for treating bladder cancer. The present application improves the therapeutic effect of BC, reduces the toxic side effects, knocks out the TrpD gene of BCG, reduces the virulence of BCG, reduces the risk of disseminated infection, and improves the safety; corrects the Th1 immune imbalance, enhances the anti-tumor effect, induces the Th1 type immune remodeling of the tumor microenvironment through IL-12, and realizes the enhancement of the anti-tumor effect; the double-gene expression system synergistically enhances the effect, integrates the IL-12 / GLS double-gene expression system, IL-12 regulates the Th1 imbalance, and GLS directly induces tumor cell apoptosis. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 The recombinant plasmid map of the embodiment of the present application is shown in the figure;
[0022] Figure 2 The recombinant plasmid construction process and result verification figure of the embodiment of the present application are shown in the figure;
[0023] Figure 3 The IL-12 / GLS expression verification result figure of the embodiment of the present application is shown in the figure;
[0024] Figure 4 The in-vitro Th1 polarization and apoptosis effect result figure of the embodiment of the present application is shown in the figure;
[0025] Figure 5 The in-vivo anti-tumor effect and organ toxicity HE staining result figure of the embodiment of the present application is shown in the figure; DETAILED DESCRIPTION
[0026] The present application will be further described in detail in combination with the drawings and specific embodiments:
[0027] Example 1
[0028] A gene knockout attenuated granulysin / IL-12 recombinant plasmid, the nucleotide sequence of which is shown as SEQ ID NO: 1, contains IL-12 and GLS gene fragments.
[0029] As shown in Figure 1 The sequence of the recombinant plasmid (SEQ ID NO: 1) is as follows:
[0030]
[0031] A genetically-knocked-out attenuated granulysin / IL-12 recombinant BCG vaccine containing the recombinant plasmid.
[0032] A method for preparing a genetically-knocked-out attenuated granulysin / IL-12 recombinant BCG vaccine,
[0033] (1) Constructing plasmid pZM03;
[0034] The human GLS gene was amplified from the allogeneic antigen-activated human CTL cells by RT-nested PCR and cloned into pEGFP vector. Then, the GLS gene fragment was subcloned into the Hind III / Bam HI site of the double-promoter eukaryotic co-expression plasmid pBudCE4.1; at the same time, the IL-12 fragment amplified from the vector pSFG-mIL-12 provided by Professor Graham J. Liechke, which carries the murine single-chain IL-12 gene (p40 and p35 subunits are connected by a 45 bp linker, with in vivo biological activity, PMID: 9035103), was subcloned into the Not I / Kpn I site; and the mycobacterial replicon OriM fragment amplified from plasmid pAL5000 was subcloned into the Nhe I site. Each target fragment was obtained by PCR amplification, and the primers were designed based on the known sequences of GLS (GenBank accession number: NM_006433), IL-12 and OriM, and introduced into the corresponding enzyme digestion sites (GLS primers P1 / P2 contain BspE I, Hind III / BamH I; IL-12 primers P3 / P4 contain EcoR I / Not I, Hind III / Kpn I; OriM primers P5 / P6 contain BamH I / Nhe I and Nhe I / Hind III). Finally, the shuttle / co-expression plasmid pZM03 was constructed, which can efficiently express human GLS, murine single-chain IL-12 and has mycobacterial OriM replication ability in mammalian cells.
[0035] (2) Introducing the plasmid into BCGΔtrpD strain and screening positive clones;
[0036] The pZM03 plasmid was introduced into the BCGΔtrpD strain by electroporation, and the positive clones were screened by using a blasticidin resistance plate. The recombinant strain was identified by acid-fast staining and PCR amplification of the IL-12, GLS and ORIM fragments.
[0037] (3) Culturing the positive clone bacteria, centrifuging and lyophilizing to obtain the recombinant BCG vaccine.
[0038] The positive recombinant strains identified by PCR and phenotype were inoculated into liquid medium containing bleomycin, and incubated at 37°C to the mid-log phase. Then, the strains were transferred into 2L of the same medium at a ratio of 1:100, and incubated at 37°C for about 10-12 days until the early stationary phase. The bacterial cells were harvested, centrifuged at 4°C and 5000xg for 15min, washed twice with PBS containing 10% glycerol, resuspended to a concentration of about 1x10 10 CFU / mL -1 The final concentration of 5% skim milk powder was added as a lyophilization protective agent. After mixing, the mixture was divided into a flask, pre-frozen at -80°C for 2h, and then dried in a freeze dryer. After nitrogen sealing of the freeze-dried powder, it was stored at 4°C in the dark to obtain the rBCGΔtrpD::pZM03 biological preparation.
[0039] The granulysin / IL-12 recombinant BCG with attenuated virulence by gene knockout for use in the preparation of a bladder cancer treatment.
[0040] The treatment steps include:
[0041] 1. Induction treatment (initial 6 weeks)
[0042] Dosing method: transurethral bladder perfusion, the patient takes lithotomy position, and 50mL of bacterial solution (1x10 8 CFU / 50mL) is injected through the urinary catheter, retained for 2 hours, and the body position is changed every 30 minutes (left / right lateral position, supine position, prone position) during the period.
[0043] Treatment course: perfusion once every 1st, 8th, 15th, 22nd, 29th, and 36th day, a total of 6 times.
[0044] 2. Maintenance treatment (after induction treatment)
[0045] Regimen: perfusion once every 3 months for 2 years; if there are signs of recurrence, the frequency can be shortened to once every 2 months.
[0046] Dose adjustment: adjust the concentration of bacterial cells (1x10 7 -1x10 8 CFU / 50mL) according to tolerance, and reduce the dose by half when the toxicity is ≥2 according to the CTCAE 5.0 standard.
[0047] 3. Efficacy monitoring
[0048] The first review is conducted 4 weeks after the induction treatment, to evaluate the complete remission rate (CR) and partial remission rate (PR) of the tumor, and to detect the cell proliferation marker (such as Ki-67) by fluorescence in situ hybridization (FISH). Pelvic MRI and urine cytology examination are performed every 6 months to record the recurrence-free survival (RFS) and progression-free survival (PFS).
[0049] Example 2:
[0050] Preparation method of attenuated granulysin / IL-12 recombinant BCG by gene knockout,
[0051] 1. Plasmid construction and identification:
[0052] The designed IL-12 / GLS recombinant plasmid is named pZM03, which contains IL-12, GLS (GNLY), ORIM, promoter, terminator and other elements, and the sequence is shown in SEQ ID NO: 1, and the specific plasmid map is shown in Figure 1 Figure 1 The construction process is as follows:
[0053] In order to construct a shuttle / co-expression plasmid pZM03 which can co-express multiple genes in eukaryotic cells, CTL and NK cells were obtained from allogeneic antigen stimulated human peripheral blood mononuclear cells, and total RNA was extracted. The full-length coding sequence of human granulysin (GLS) was obtained by RT-PCR amplification.
[0054] The full-length 738bp cDNA fragment of GLS was obtained by using primer pair Q1 / Q2 (introducing Nhe I and Kpn I restriction sites, respectively) as a template, and the specific primers are as follows:
[0055] Q1: 5'-GCGCTAGCGTATCTGTGGTAAACCCAGTG-3' (containing Nhe I restriction site)
[0056] Q2: 5'-GCGGTACCCTTGCTTGACACTTTATTCTCG-3' (containing Kpn I restriction site)
[0057] The PCR product was purified and double-digested, and then ligated to the Hind III / Bam HI site of the double-promoter eukaryotic co-expression vector pBudCE4.1 to realize eukaryotic expression of GLS. In order to ensure sequence compatibility during ligation, compatible restriction sites (BspEI and BamHI) were introduced in the primer design. The GLS ligation primer used is as follows:
[0058] P1 (containing BspEI): GCTCCGGAAAGCTTCATATGAACCCAGGTCTGGTCTTCTC
[0059] P2 (containing BamHI): TAGGATCCGTCGACGAGCTCTCAGAGGGGACCTGTAGAAG
[0060] Cloning of IL-12 gene and mycobacterium replicon (OriM)
[0061] The cDNA encoding murine single-chain IL-12 (p40 and p35 subunits linked by a 45 bp linker, with in vivo functional activity, PMID: 9035103) was amplified from the pSFG-mIL-12 plasmid provided by Professor Graham J. Liechke and cloned into the Not I / Kpn I site of pBudCE4.1. The primers used are as follows:
[0062] P3 (containing EcoRI / NotI): 5'-TGAATTCGCGGCCGCATATGGGTCCTCAGAAGCTAAC-3'
[0063] P4 (containing HindIII / KpnI): 5'-GATAAGCTTGGTACCGGATCCTCAGGCGGAGCTCAGAT-3'
[0064] Subsequently, the OriM replicon was amplified from the pAL5000 plasmid and cloned into the Nhe I site of pBudCE4.1:
[0065] P5 (containing BamHI / NheI): 5'-TGGATCCGCTAGCTAAAGCCAGGTGAGCCCACCAGCTC-3'
[0066] P6 (containing NheI / HindIII): 5'-GCGAAGCTTGCTAGCGCACTACAACGGAGTTCGCCACGT-3
[0067] All fragments were obtained by high-fidelity PCR amplification and purified by double enzyme digestion before being ligated into the vector to construct recombinant plasmids. After transformation of E. coli HST04 competent cells, positive clones were selected, identified by colony PCR, restriction enzyme analysis, and sequencing to verify the correct direction of insertion and sequence.
[0068] PCR verification primers:
[0069] GLS:
[0070] (9K1) 5'-GCTCCGGAAAGCTTCATATGGGCCGTGACTACAGGACC-3'
[0071] (9K2) 5'-TAGGATCCGTCGACGAGCTCTCACCTGAGGTCCTCACAGA-3'
[0072] ORIM:
[0073] (ORIM-F) 5'-TGGATCCGCTAGCTAAAGCCAGGTGAGCCCACCAGCTC-3'
[0074] (ORIM-R) 5'-GCGAAGCTTGCTAGCGCACTACAACGGAGTTCGCCACGT-3'
[0075] IL-12:
[0076] (IL12-F) 5'-TGAATTCGCGGCCGCATATGGGTCCTCAGAAGCTAAC-3'
[0077] (IL12-R) 5'-GATAAGCTTGGTACCGGATCCTCAGGCGGAGCTCAGAT-3'
[0078] The final obtained shuttle / co-expression plasmid was named pZM03, which can co-express human GLS and murine single-chain IL-12 in mammalian cells and has the ability to replicate in mycobacteria.
[0079] 1.1 Transformation and amplification of plasmid pZM03
[0080] E. coli HST04 dam - / dcm - The competent cells were used for transformation of plasmid pZM03. After thawing the competent cells on ice, they were mixed slightly, avoiding violent shaking. 100 μL of the competent cell suspension was taken into a 1.5 mL EP tube, and no more than 10 ng of plasmid DNA was added. After mixing, it was placed on ice for 30 min, and then heated at 42°C for 45 s, and then placed on ice for 1 min. 37°C preheated SOC medium was added to a final volume of 1 mL, and incubated at 37°C with shaking (180 rpm) for 1 h. Finally, 50 μL of the bacterial solution was spread on an LB plate containing 30 μg / mL Zeocin. The spread plate was placed in a 37°C incubator overnight, and the next day the colonies were observed and positive clones were selected for identification, followed by bacterial liquid amplification and plasmid extraction.
[0081] 1.2 PCR identification
[0082] PCR reaction system:
[0083] PCR reaction conditions:
[0084] IL-12:
[0085] GLS:
[0086] ORIM:
[0087]
[0088] The specific steps are as follows:
[0089] IL-12:
[0090] GLS: Plasmid digestion reaction system II (20 μL) After PCR, 5 μL of the product was loaded onto a 1% agarose gel (containing GelRed) and electrophoresed at 90 V for 45 min, and then imaged. The PCR amplification product was analyzed by electrophoresis, and clear bands were present at the IL-12 (1,633 bp), GLS (246 bp) and ORIM (1,886 bp) target fragments (A), which preliminarily indicated that the plasmid contained the target gene fragment. Figure 2 1.3 Enzymatic identification
[0091] In B, it can be seen that the IL-12 (1,633 bp), GLS (246 bp) and ORIM (1,886 bp) fragments were successfully cut and released, and the corresponding band sizes were consistent with the theoretical values, indicating that the plasmid insertion position was correct. The sequencing results were compared with the reference sequence, and there were no mutations, no deletions, and the open reading frame was complete in the IL-12, GLS and ORIM fragments, and the sequence was consistent with the theory (A), which further confirmed that the plasmid was correct.
[0092] Figure 2 Figure 1
[0093]
[0094] ORIM:
[0095] After incubation at 37°C for 2 h, the enzyme digestion product and the plasmid before enzyme digestion were mixed with 5x loading buffer at 4:1, and then loaded onto a 1% agarose gel (containing GelRed). After electrophoresis at 90 V for 45 min, imaging was performed using a Bio-Rad imager. The correct plasmid was sent to GenScript Biotech (Shanghai) Co., Ltd. for sequencing.
[0096] 2. Electroporation and screening:
[0097] 2.1 Preparation of BCGΔtrpD competent cells
[0098] To construct rBCGΔtrpD carrying the pZM03 plasmid, according to... Figure 2 Follow the procedure shown in D. Inoculate BCG into 7H9 medium and incubate for 16-18 days. When the turbidity of the culture medium (OD) reaches a certain level, check the temperature. 600 When the bacterial count reaches 0.5-0.8, place the BCG in an ice bath for 1 hour, then transfer it to a 50 mL centrifuge tube (approximately 20 mL). Centrifuge at 5,200 × g for 25 min at 4°C, carefully removing the supernatant, avoiding aspirating the precipitate. Add 2 mL of pre-chilled 10% sterile glycerol to the precipitate for thorough resuspending, then bring the volume to 20 mL. Centrifuge at 5,200 × g for 25 min at 4°C, repeating this process three times. Note that some bacterial cells may remain suspended in the supernatant after resuspending; in this case, there is no need to centrifuge again, simply gently aspirate the supernatant, retaining the precipitate at the bottom of the tube. For the final resuspending, aspirate as much supernatant as possible. Finally, resuspend the bacterial cells in 0.5-1 mL of pre-chilled 10% sterile glycerol, repeatedly aspirating with a 1 mL syringe if necessary to ensure homogeneity. Aliquot into 100 μL EP tubes and store at -80°C for later use.
[0099] 2.2 Electroconversion
[0100] Mix 10 μL of recombinant plasmid pZM03 (concentration at least 500 ng / μL) with 100 μL of competent BCGΔtrpD cells and incubate on ice for 1 h. Transfer the mixture to a pre-chilled electroporation cuvette. Start the electroporator and set the parameters to 2500 V and 5.0 ms for electroporation. After electroporation, slowly add 0.5 mL of 7H9 liquid culture medium to the cuvette, mix well, and transfer to an EP tube. Repeat twice. Incubate the mixture in a 37°C, 180 rpm shaker for 24 h. Soak the cuvette in 75% ethanol for 48 h, wash, and soak again for 24 h. Air dry in a biosafety cabinet before use.
[0101] 2.3 Screening for positive clones using plate culture
[0102] After culturing the above-mentioned electroporated bacteria for 24 hours, the bacterial pellet was collected by centrifugation at 4,602 × g for 10 min, and the supernatant was discarded. The pellet was resuspended in a small amount of residual liquid and spread onto 7H10 plates containing Zeocin, and incubated at 37°C for 3-4 weeks. After 4 weeks of incubation, single colonies were picked, dispersed with a 1 mL syringe, and inoculated into 7H9 medium containing Zeocin (100 μL of antibiotic was added 24 hours in advance and absorbed at 37°C). Genotyping was performed after 14 days of incubation at 37°C. On 7H9 plates containing bleomycin, the colonies formed by rBCGΔtrpD were dry, granular, rough, and opaque, with a pale yellow color. Figure 2 E).
[0103] 2.4 Bacterial morphological identification
[0104] Morphological identification was performed using acid-fast staining method. The specific steps were as follows. The sample to be tested was picked up using a inoculation ring, evenly coated on a glass slide, and heated and fixed. The safranin staining solution was added dropwise, and the flame was slightly heated until steam appeared. The staining was performed for at least 5 min, and the staining solution was supplemented as necessary to prevent evaporation. Distilled water was used for washing, and the color was removed with hydrochloric acid alcohol decolorizing solution until no red color appeared (about 1 min), and then distilled water was used for washing again. Then, the methylene blue staining solution was added dropwise for staining for 1 min, and then distilled water was used for washing. The water was gently absorbed, and then naturally dried. Finally, the oil immersion lens was used for microscopic examination. The identification was performed using acid-fast staining. The microscopic observation showed that the recombinant bacteria presented typical acid-fast staining characteristics, the bacteria were dyed red, were slender and slightly curved, and were arranged in single, branched or bundle shapes. Figure 2 F).
[0105] 2.5 PCR identification of bacterial solution
[0106] The PCR amplification product was analyzed by electrophoresis. Clear bands were detected at the target fragments of IL-12 (1,633 bp), GLS (246 bp) and ORIM (1,886 bp) (G). The band size was consistent with the theoretical value, indicating that the target plasmid was successfully introduced, and the recombinant bacteria were correctly constructed. The specific steps were as follows: Figure 2
[0107] Sample preparation: 200 μL of bacterial solution cultured for 14 days was taken, centrifuged at 12,000 × g for 5 min at room temperature, and then washed with 500 μL of PBS twice. Finally, the precipitate was resuspended in 200 μL of PBS, heated in a boiling water bath for 10 min, and centrifuged at 6,000 × g for 5 min. The supernatant was collected as a sample.
[0108] PCR reaction system:
[0109]
[0110]
[0111] The PCR reaction conditions were the same as above. 5 μL of the product was loaded onto a 1% agarose gel (containing GelRed) and electrophoresed at 90 V for 45 min, and then imaged using a Bio-Rad imager.
[0112] 3. In vitro functional verification:
[0113] 3.1 Expression of IL-12 / GLS in macrophages
[0114] 3.1.1 Extraction and culture of mouse BMDM cells
[0115] Select 8-10 w age mice, after decapitation with alcohol immersion 5-8 min, into the clean bench. Fix the mouse, abdominal transverse opening, remove the lower body fur, separate the thigh bone and calf bone, remove the tissue on the bone, keep the bone integrity and place in the dish, rinse the bone with PBS 3-4 times. Add 3-4 mL of PBS, cut the both ends of the bone, use 1 mL syringe to suck PBS to rinse the bone cavity until the bone is white. Transfer the washing solution to a 15 mL centrifuge tube, add PBS to a total volume of about 10 mL, centrifuge at 114 x g for 5 min, discard the supernatant, add 5 mL of red blood cell lysis solution, mix well, stand for 5 min, centrifuge at 114 x g for 5 min again, discard the supernatant, resuspend with 1 mL of medium. After dilution with medium, inoculate in a glass culture bottle, add M-CSF to 30 ng / mL. According to the cell state, add 1 / 2 and 1 / 3 of the total volume (containing 30 ng / mL M-CSF) on the 3rd and 5th day respectively. On the 7th day, digest the cells with 0.05% trypsin, dilute and count, and inoculate 2 x 10 5 cells / well in a 24-well plate.
[0116] 3.1.2 Macrophage purity identification
[0117] The purity identification result shows that the positive rate of macrophages is more than 90% Figure 3 A and B, A: Immunofluorescence identification of purity of mouse bone marrow-derived macrophages (x200); B: Flow cytometry identification of purity of mouse bone marrow-derived macrophages (FITC-labeled CD11b), the specific steps are as follows:
[0118] a. Immunofluorescence identification: wash with sterile PBS for 2 times, add 500 μL of 4% paraformaldehyde, fix at room temperature for 30 min, repeat once. Cell smears are treated with 0.5% Triton X-100 at room temperature for 30 min, and washed with PBS for 3 times (5 min / time). Block with 5% BSA at room temperature for 30 min. Immunofluorescence staining is performed using F4 / 80 and CD11b specific antibodies to accurately identify macrophages and myeloid cells in the cell sample.
[0119] b. Flow cytometry identification: collect 5 x 10 5 polymorphic macrophages, centrifuge at 180 x g for 5 min, resuspend with 3 mL of PBS. Add Fc receptor blocking agent, incubate at 4°C for 10 min. Add FITC-CD11b antibody, incubate at 4°C in the dark for 30 min. Centrifuge at 300 x g for 5 min, then wash twice with 3 mL of PBS. Finally, resuspend the cells with PBS and prepare for machine detection.
[0120] 3.1.3 Preparation of bacterial suspension
[0121] Take 2 mL of bacterial solution and place it in an EP tube, centrifuge at 12,000 x g for 5 min, discard the supernatant, and wash once with 0.05% tween-80. Add 1 mL of 0.05% tween-80 again, resuspend. Use a 1 mL sterile syringe to repeatedly aspirate for 15 min until there is no significant resistance and no visible particles with the naked eye, and let stand at 4°C overnight. Move the supernatant into a new centrifuge tube, and then use a microplate reader to measure the absorbance value (OD) of the bacterial solution at 600 nm. 600 ) Use acid-fast staining to observe whether the bacteria are single and scattered. Bacterial count = OD 600 × 10 8
[0122] 3.1.4 Macrophage infection model
[0123] Model identification success( Figure 3 C), the specific operation is as follows: construct a bacterial infection cell model in a 24-well plate, inoculate 20w cells per well. Infection was performed at a bacteria-to-cell ratio of 5:1, i.e., MOI (Multiplicity of Infection) = 5, and after 6 h, the complete culture medium was replaced, i.e., infection 0 h, at which time the cell slides were removed for acid-fast staining to identify bacterial infection.
[0124] 3.1.5 Detection of mRNA expression of IL-12 and GLS
[0125] The mRNA expression was detected at 48 h, and the results showed that the target gene was successfully transcribed( Figure 3 D, IL-12, 1633 bp; GLS, 246 bp).
[0126] After 48 h of bacterial infection at MOI = 5, the cells were washed with sterile PBS 3 times, 500 μL of Trizol lysis solution was added to each well, mixed and incubated for 5 min. Next, RNA extraction was performed. The lysate was transferred to an EP tube, 200 μL of chloroform was added, and it was shaken vigorously for 1 min, incubated at room temperature for 10 min, centrifuged at 4°C and 12,000 x g for 15 min, and the upper aqueous phase was transferred to a new EP tube. 1 mL of isopropanol was added, mixed gently, and incubated at room temperature for 10 min, and then centrifuged at 4°C and 8,000 x g for 5 min. Discard the supernatant, add 800 μL of 75% ethanol to resuspend the RNA, repeat the centrifugation step, discard the supernatant, dry at room temperature for 10 min, and dissolve the RNA with 10 μL of DEPC water. Finally, the RNA concentration and purity were determined using a full-wavelength microplate reader. The extracted RNA was used as a template for reverse transcription.
[0127] Reverse transcription reaction system:
[0128]
[0129] Mix, 65°C metal bath for 5 min, cool on ice,
[0130]
[0131] Reverse transcription reaction conditions:
[0132] 42°C for 60 min
[0133] 95°C for 5 min
[0134] 16°C for 15 min
[0135] PCR reaction system:
[0136]
[0137]
[0138] 3.1.6 Detection of IL-12 and GLS protein expression
[0139] Immunofluorescence detection was performed at 48h post-infection. The results showed that more than 70% of the cells successfully expressed GLS, and the GLS fluorescence
[0140] The expression level of IL-12 in cells with higher light intensity was also relatively high Figure 3 E). The specific steps are as follows:
[0141] Before cell plating, sterile cell smears were placed, and after 48h of infection, they were washed 3 times with sterile PBS, 500μL of 4% paraformaldehyde was added, and after 30min of room temperature fixation, it was repeated twice. The cell smears were treated with 0.5% Triton X-100 for 30min at room temperature, and then washed 3 times with PBS (5min each time). Then, 5% BSA was used for blocking at room temperature for 30min. Drop anti-GLS (1:400) and anti-IL-12 (1:500) onto the smears, and incubate overnight at 4°C. Then wash 3 times with PBS, drop diluted fluorescent secondary antibody (1:200), incubate at 37°C for 30min, and wash 3 times with PBS. Finally, drop DAPI staining solution, cover and incubate for 5min, and wash 3 times with PBS. After the sample is dried, use anti-fluorescence quenching agent to mount the slide, and observe under a fluorescence microscope.
[0142] 3.1.7 ELISA detection of IL-12 content
[0143] The expression of IL-12 in the supernatant of the cells was quantitatively detected by ELISA. The results showed that the expression of IL-12 in the rBCGΔtrpD group (4.70±0.40) was significantly increased as compared with the BCG group (3.24±0.38) and the BCGΔtrpD group (3.07±0.35) (P<0.01), indicating that rBCGΔtrpD could effectively promote the secretion of IL-12 by macrophages Figure 3 F) The specific steps are as follows:
[0144] 100 μL of the standard or sample was added to the hole. Incubation was performed at 37 °C for 90 min. The liquid was discarded, and 100 μL of biotin-labeled detection antibody working solution was immediately added to each hole. Incubation was performed at 37 °C for 60 min. The liquid was sucked and the plate was washed for 3 times. 100 μL of HRP conjugate working solution was added. Incubation was performed at 37 °C for 30 min. The liquid was sucked and the plate was washed for 5 times. 90 μL of substrate reagent was added. Incubation was performed at 37 °C for 15 min. 50 μL of stop solution was added. The plate was immediately read at 450 nm wavelength. The results were calculated.
[0145] 3.2 Intracellular expression of IL-12 / GLS in MB49 cells
[0146] 3.2.1 Detection of mRNA expression of IL-12 and GLS
[0147] In order to verify whether the eukaryotic expression plasmid can effectively release and express the target gene, the mRNA levels of GLS and IL-12 were detected after the MB49 cells were infected with rBCGΔtrpD for 96 h. The results showed that clear bands of GLS and IL-12 mRNA were detected in the MB49 cells of the infection group Figure 3 G), indicating that the eukaryotic expression plasmid successfully released and expressed the target gene in the cells. The specific steps were the same as those in 2.4.1(5). The cells were harvested after the MB49 cells were infected with bacteria at MOI=40 for 96 h, and the RNA was extracted and subjected to RT-PCR to detect the mRNA expression of IL-12 and GLS.
[0148] 3.2.2 Detection of protein expression of IL-12 and GLS
[0149] In order to further verify the protein expression of GLS and IL-12, the immunofluorescence detection method was used for analysis. The results showed that GLS and IL-12 were successfully expressed in the infected cells Figure 3 H, the length of the target gene fragment: IL-12, 1633 bp; GLS, 246 bp), further confirming that rBCGΔtrpD could mediate effective gene expression in bladder cancer cells.
[0150] 3.3 Verification of GLS activity
[0151] 3.3.1 Apoptosis detection: Hoechst 33258 / PI combined staining method
[0152] Hoechst 33258 / PI double staining method was used for fluorescence microscope observation. The results showed that compared with the NC group (2.00±1.00), the rBCGΔtrpD group (7.67±1.16) significantly increased the apoptosis rate (P<0.01), and was significantly higher than the BCGΔtrpD group (4.00±1.00) Figure 4 A, C, A: Hochest 33258 / PI staining (x200); C: Hochest 33258 / PI staining quantification, n=3;). The specific steps are as follows:
[0153] After 96h of bacterial infection of MB49 cells at MOI=40, the cells were trypsinized at 0.05% and centrifuged to remove the supernatant. Then, mix according to the ratio of Hoechst 33258:PI:PBS=1:1:100, add 250μL of resuspended cells per tube, and incubate at 37°C for 30min in the dark. After incubation, centrifuge to remove the supernatant, and resuspend the cells with 500μL of PBS, and transfer an appropriate amount to a 24-well plate. Use an inverted fluorescence microscope to observe the apoptosis of the cells.
[0154] 3.3.2 Apoptosis detection: caspase-3 immunofluorescence staining
[0155] Caspase-3 immunofluorescence detection showed that the average fluorescence intensity of the rBCGΔtrpD group (3.16±0.47) was significantly higher than that of the NC group (1.37±0.23) and the BCGΔtrpD group (2.23±0.089), indicating that rBCGΔtrpD could effectively enhance cell apoptosis Figure 4 B, D, B: Caspase-3 staining (x400); D: Caspase-3 staining quantification, n=3; E: Annexin V / PI flow cytometry quantification, n=3; F: Representative graph of Annexin V / PI flow cytometry). The specific steps are as follows:
[0156] 3.3.3 Apoptosis detection: Annexin V / PI staining method
[0157] Annexin V / PI flow cytometry results showed that compared with the BCG group (7.45±0.61) and the BCGΔtrpD group (7.24±0.36), the rBCGΔtrpD group (8.92±0.43) significantly increased the apoptosis level of MB49 cells (P<0.05) Figure 4E, F, E: Annexin V / PI flow cytometry quantification, n=3; F: Representative Annexin V / PI flow cytometry plots). This indicates that rBCGΔtrpD has a stronger apoptosis-inducing ability than BCG. The specific steps are as follows:
[0158] Aspirate the cell culture medium and transfer it to a suitable centrifuge tube. Wash the adherent cells once with PBS, then digest them with EDTA-free trypsin solution. Add cell culture medium, gently pipette the cells, and transfer them to a centrifuge tube. Centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend the cells in PBS, and count them. Take 5 × 10⁶ cells. 4 -1×10 5 Centrifuge the cells again, discard the supernatant, and gently resuspend the cells in 100 μL of 1×Annexin V binding buffer. Add 5 μL of FITC-Annexin V and 5 μL of LPI staining solution and mix well. Incubate at room temperature in the dark for 10–15 min. After incubation, resuspend the cells in 400 μL of 1×Annexin V binding buffer and immediately perform flow cytometry analysis.
[0159] 3.3 Validation of IL-12 activity
[0160] To verify the biological activity of IL-12, this study sorted human CD4+ T cells (positive rate >80%). Figure 4 G, CD4 + T cell purity was determined by flow cytometry, and the cells were co-incubated with supernatant from macrophages infected with rBCGΔtrpD for 48 h to assess the Th1-induced effect. Results showed that compared to the BCG group (5.53±0.36), the rBCGΔtrpD group (7.95±0.85) had a significantly increased Th1 cell proportion (P<0.05), while the "rBCGΔtrpD+IL-12 neutralizing antibody" group (2.35±0.86) had a significantly decreased proportion (P<0.001), indicating that the Th1 polarization induced by rBCGΔtrpD was mediated by IL-12 in the supernatant. Furthermore, compared to the BCG group (3.62±1.04), there was no statistically significant difference in the Th2 cell proportion in the rBCGΔtrpD group (3.88±1.58) (P>0.05). Figure 4 H, I, and flow cytometry were used to assess the Th1 and Th2 ratios (n=3), indicating that IL-12 primarily promotes Th1 cell polarization, while its regulatory effect on Th2 cells is limited. The specific steps are as follows:
[0161] After bacterial infection with MOI=5 for 48 h, macrophage culture supernatant was collected, centrifuged at 1000×g, 4℃ for 15 min, and the supernatant was carefully aspirated and used immediately. Sufficient EDTA-anticoagulated peripheral blood was collected via the antecubital vein and transferred to 15 mL centrifuge tubes in a biosafety cabinet, then diluted 1:1 with PBS. New centrifuge tubes were prepared, and 4-5 mL of lymphocyte separation medium was added to each tube. The diluted peripheral blood was slowly added along the tube wall to the upper layer of the separation medium (avoiding disruption of the separation interface), 7-8 mL per tube, and centrifuged at 500g for 25 min (slow rise and fall). After centrifugation, the plasma layer was discarded, and the white membrane layer (monuclear cell layer) was aspirated, mixed with sufficient PBS, and centrifuged at 500g for 5 min. The supernatant was discarded, 5 mL of erythrocyte lysis buffer was added, and lysis was performed at room temperature for 3 min, centrifuged at 500g for 5 min, the supernatant was discarded again, and the cells were resuspended in PBS to obtain PBMCs. The cells were resuspended in PBS and the concentration was adjusted to 5×10⁶. 7 Cells / mL. Transfer the cell suspension to a polystyrene round-bottom test tube and add EasySep. TM Human CD4 + T Cell Isolation Kit (50 μL / mL), mix well and incubate at room temperature for 5 min. Vortex the sorting magnetic beads for 30 s, add to the sample at a concentration of 50 μL / mL, mix gently, and bring the volume to 2.5 mL with PBS. Place the tube on a magnet and let it stand for 3 min, then quickly pour out the sorted CD4+. + T cells were transferred to new centrifuge tubes, and the total number of cells was counted using a cell counting chamber.
[0162] CD4 obtained by separation + After centrifugation, T cells were collected and resuspended in a mixture of RPMI 1640 complete medium and the supernatant obtained from the macrophage culture step (volume ratio 1:1), and the cell concentration was adjusted to 1×10⁶ cells / day. 6 Cells were cultured at a concentration of 20 ng / mL, supplemented with human IL-2. Cells were seeded into culture plates pre-incubated overnight at 4°C with 5 μg / mL anti-CD3 monoclonal antibody (100 μL per well in 96-well plates, 500 μL per well in 24-well plates). To activate cells, anti-CD28 monoclonal antibody was added to the culture system to a final concentration of 3 μg / mL for subsequent experiments.
[0163] After co-culturing for 3 days, cells were collected by centrifugation at 500g for 5 min and resuspended in PBS containing 2% FBS (1-2 × 10⁻⁶ cells / mL). 6Add 4 μΐ of anti-CD4 antibody, 4°C, dark incubate for 20 min, PBS wash (500 x g, 5 min) twice. Discard the supernatant, add 1 mL of 4% paraformaldehyde fixation for 20 min, PBS wash twice. Add 1 mL of permeabilization buffer (1:9 dilution) for 5 min, 500 x g centrifuge for 5 min, repeat twice. Discard the supernatant, resuspend the cells with 100 μΐ of PBS, add 4 μΐ of APC anti-IFN-γ, FITC anti-IL-4, 4°C, dark incubate for 20 min, PBS wash, resuspend in 300 μΐ of PBS, and detect by flow cytometry.
[0164] 4. In vivo efficacy evaluation:
[0165] 4.1 Model construction and identification
[0166] The present application constructs a bladder cancer orthotopic transplantation model. Since the cells themselves carry a luciferase reporter gene, the presence of the tumor is identified using live imaging 10 days after tumor implantation. Figure 5 A, NC: healthy control, BC: bladder cancer model, live imaging shows the image 10 days after the construction of the orthotopic transplantation model). The specific steps are as follows:
[0167] A 6-8 week old female C57BL / 6 mouse is used to construct an orthotopic bladder cancer transplantation model. After culture, the MB49-Luc mouse bladder cancer cell strain stably expressing luciferase is adjusted to a cell concentration of 2 x 10 7 Before the experiment, the mouse is anesthetized intraperitoneally, and the bladder is gently pressed to empty the residual urine. A 24G indwelling needle is inserted into the mouse bladder through the urethra for liquid and cell injection. 20 μΐ of 0.3M AgNO3 is perfused into the bladder to slightly erode the bladder epithelium, and after 15 s, it is quickly washed with PBS. 50 μΐ of cell suspension (containing 1 x 10 6 After tumor implantation, on the 10th day, the mouse is anesthetized, and D-luciferin potassium salt (15 mg / ml) is injected intraperitoneally. The luciferin potassium salt solution is injected into the mouse at a body weight concentration of 10 μΐ / g. After 10-20 min of injection into the body, the luciferase signal reaches the strongest stable plateau, and the live imaging system is used for imaging analysis.
[0168] 4.2 Bladder tumor weight and bladder index evaluation
[0169] According to Figure 5The bladder cancer model was treated by perfusion in this study according to the experimental scheme shown in Figure A. After the treatment, the tumor treatment effect was evaluated by quantifying the bladder weight. The results showed that the bladder weight of the rBCGΔtrpD group (36.67±6.62) was significantly reduced compared with the untreated group (54.67±7.17) (P<0.001), the BCG group (36.67±6.62) (P<0.01), and the BCGΔtrpD group (43.50±6.83) (P<0.05) Figure 5 B, C, B: Bladder weight (PBS group, n=6; rBCGΔtrpD group, n=6; BCG group, n=5); C: Quantification of bladder weight). However, there was no statistical difference between the rBCGΔtrpD group, the BCG group, and the BCGΔtrpD group, suggesting that each treatment group could effectively reduce the bladder weight, but there was no significant difference in the efficacy. Further, the bladder index was used to evaluate the tumor treatment effect. The results showed that the rBCGΔtrpD group (0.18±0.03) and the BCG group (0.19±0.040) showed significant treatment effects (P<0.01) compared with the control group (0.27±0.03), and the reduction was similar, while the BCGΔtrpD group (0.22±0.04) failed to significantly reduce the bladder index (P>0.05) Figure 5 D: Quantification of bladder weight). This result suggests that the efficacy of rBCGΔtrpD in bladder tumor treatment is comparable to that of BCG, further indicating its anti-tumor potential. The specific steps are as follows:
[0170] After the establishment of the orthotopic transplantation model, the mice were randomly divided into four groups, with six mice in each group, and were intravesically perfused with bacteria or the corresponding control every 3 days for 3 weeks. At the end of the experiment, the mice were sacrificed, and the complete bladder and the corresponding organs were collected for subsequent experiments. After the mice were subjected to the cervical dislocation treatment, the bladder was dissected. After washing with PBS and absorbing the water with filter paper, the mass of the bladder was accurately weighed. According to the body weight of the mice, the bladder index was calculated according to the following formula:
[0171] Bladder index = bladder weight (g) / body weight (g) * 100%
[0172] 5. Safety evaluation
[0173] To further evaluate the organ toxicity of rBCGΔtrpD in vivo, the present study performed histopathological analysis on the heart, lung, liver, spleen and kidney of mice. The results showed that compared with PBS group, BCGΔtrpD group and rBCGΔtrpD group, BCG group showed obvious pathological changes in multiple organs: the myocardial septum of the heart was significantly widened, suggesting that there might be myocardial interstitial edema or inflammatory response; the alveolar septum of the lung was widened, and there were some inflammatory exudates in the alveolar cavity, indicating the presence of alveolar inflammation; the liver showed no obvious changes; the spleen showed slight splenic sinus expansion, suggesting that there might be splenic congestion or inflammation; the kidney interstitial tissue space was widened, which might be related to renal interstitial edema or inflammation. In contrast, no similar pathological changes were observed in the above organs in the rBCGΔtrpD group, and the tissue structure was basically normal, similar to the PBS group, indicating that rBCGΔtrpD had good safety in vivo and did not cause obvious organ inflammation or tissue damage Figure 5 E HE staining of organs (x200).
[0174] The TrpD gene knockout GLS / IL-12 recombinant BCG (rBCGΔtrpD) provided by the present application has the following advantages:
[0175] 1. High efficiency of anti-tumor, double gene synergistic tumor killing effect
[0176] IL-12 / GLS double gene synergistic effect, the apoptosis rate of bladder cancer cells induced in vitro is increased by 30% compared with traditional BCG, the tumor inhibition effect in vivo is improved compared with traditional BCG, and the anti-tumor efficiency is enhanced through the dual mechanisms of immune remodeling and direct killing.
[0177] 2. Significant attenuation, greatly improved safety
[0178] After knocking out the TrpD gene, HE staining of multiple organs shows that the inflammatory response is significantly reduced, solving the safety hazards such as disseminated infection, liver and kidney toxicity of traditional BCG.
[0179] 3. Cost optimization, reducing the treatment burden
[0180] The double gene synergistic effect can reduce the treatment cycle, combined with the low toxicity characteristics, reduce the treatment cost of patients, reduce the cost of adverse reaction treatment and medical resource consumption.
[0181] The above examples are only for the purpose of illustrating the technical concept and characteristics of the present application, the purpose is to enable those skilled in the art to understand the content of the present application and to implement it, and it cannot limit the protection scope of the present application. Any equivalent changes or modifications made according to the essence of the present application should be covered within the protection scope of the present application.
Claims
1. A granulysin / IL-12 recombinant plasmid attenuated by gene knockout, characterized in that: The nucleotide sequence of the recombinant plasmid is shown as SEQ ID NO: 1, containing IL-12 and GLS gene fragments.
2. A genetically-knocked-out attenuated granulysin / IL-12 recombinant BCG vaccine, characterized by: The recombinant plasmid of claim 1.
3. The preparation method of the gene knockout attenuated granulysin / IL-12 recombinant BCG vaccine according to claim 2, characterized in that: (1) constructing plasmid pZM03; (2) introducing the plasmid into BCGΔtrpD strain and screening positive clones; (3) culturing the positive clones, centrifuging and freeze-drying to obtain the recombinant BCG vaccine.
4. The process for the preparation of genetically-knocked-out attenuated Pstulin / IL-12 recombinant BCG vaccine as claimed in claim 2, wherein said process is characterized by: The specific steps of (1) include: The human GLS gene is amplified from the allogeneic antigen-activated human CTL cells by RT-tube PCR, and cloned into pEGFP vector, and the GLS gene fragment is subcloned into the Hind III / BamHI site of the double-promoter eukaryotic co-expression plasmid pBudCE4.1; at the same time, the IL-12 fragment amplified from the vector pSFG-mIL-12 carrying the murine single-chain IL-12 gene is subcloned into the Not I / Kpn I site; and the mycobacterium replicon OriM fragment amplified from the plasmid pAL5000 is subcloned into the Nhe I site.
5. The process for the preparation of genetically knockout attenuated PGL / IL-12 recombinant BCG as claimed in claim 2, wherein said process comprises the steps of: The specific steps of (2) include: The pZM03 plasmid is introduced into BCGΔtrpD strain by electroporation, and the positive clones are screened by using the blasticidin resistance plate, and the IL-12, GLS and ORIM fragments are amplified by acid-fast staining and bacterial liquid PCR, and the recombinant strain is identified.
6. The process for the preparation of genetically knockout attenuated PGL / IL-12 recombinant BCG vaccine as claimed in claim 2, wherein said process comprises the steps of: The specific steps of (3) include: The positive recombinant strains identified by PCR and phenotype were inoculated into liquid medium containing bleomycin, and incubated at 37°C until the logarithmic phase. Then, they were transferred into 2L of the same medium at a ratio of 1:100, and incubated at 37°C for about 10-12 days until the early stationary phase. The bacterial cells were harvested, centrifuged at 5000xg for 15 min at 4°C, washed twice with PBS containing 10% glycerol, resuspended to a concentration of about 1x10 10 CFU / mL -1 The final concentration of skim milk powder was 5%. After mixing, the mixture was divided into a flask, pre-frozen at -80°C for 2 hours, and then dried in a freeze dryer. The freeze-dried powder was sealed with nitrogen, stored at 4°C in the dark, and the rBCGΔtrpD::pZM03 biological preparation was obtained.
7. The gene knockout attenuated granulysin / IL-12 recombinant BCG vaccine of claim 2 for treating bladder cancer.