Hph resistance gene knockout box based on gme5 gene editing, genetically engineered bacterium and application of hph resistance gene knockout box and genetically engineered bacterium
By modifying the gme5 gene locus of *Candida bumblebee*, knocking out the negative regulatory factor, and integrating lactone-transferase and fatty acid transferase genes, a high-yield lactone-type sophorolipid engineered strain was constructed. This solved the problems of low yield and high cost of separation and purification of lactone-type sophorolipids, achieving efficient and low-cost production of sophorolipids.
Patent Information
- Application Number
- CN202511292226.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-11
- Publication Date
- 2025-11-18
AI Technical Summary
Existing *Candida baccata* strains have low yields of lactone-type sophorolipids and high isolation and purification costs, limiting their large-scale application.
By modifying the gme5 gene locus, knocking out the gme5 gene, a negative regulator of sophorolipid production, and integrating the lactone-transferase gene sble and the fatty acid transferase gene alcs, a genetically engineered bacterium that produces high levels of lactone-type sophorolipids was constructed.
It significantly increases the proportion of lactone-type sophorolipids in total sophorolipids, reduces production costs, achieves a total sophorolipid content of 358.77 g/L, with lactone-type content accounting for more than 74%, simplifies the production process, and reduces the difficulty of separation and purification.
Smart Images

Figure CN120966869A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and relates to an hph resistance gene knockout cassette, genetically engineered bacteria and application thereof, in particular to a genetically engineered bacteria with high yield of lactone sophorolipid obtained by modifying gme5 gene site in Bombtriglyceride yeast, and the genetically engineered bacteria is used for fermentation production of lactone sophorolipid. BACKGROUND
[0002] Sophorolipid is a secondary metabolite produced by non-pathogenic yeast, and has the highest yield among all known biosurfactants. Compared with chemical surfactants, biosurfactants have the advantages of environmental protection, biodegradability, low toxicity, non-sensitization, etc., and can be produced by microbial fermentation process using industrial and agricultural waste, and have biological renewability. Sophorolipid has diverse structures and wide functions, and has been applied to many industrial fields such as oil exploitation, mineral extraction, environmental remediation, agriculture, medicine, papermaking, textile, food and cosmetics, and gradually expanded to emerging fields such as nanotechnology and new materials.
[0003] Starmerella bombicola is a yeast strain that can produce sophorolipids at a high yield. It ferments glucose and vegetable oil to produce acid-type and lactone-type sophorolipids. Lactone-type sophorolipids have unique molecular structures and multifunctional properties, which have shown significant advantages in various fields. Its strong biological activity, such as selective anti-tumor and broad-spectrum antibacterial effects, as well as excellent physical and chemical properties, including stability under high temperature and extreme pH conditions and high emulsifying capacity, make it irreplaceable in scenarios such as targeted therapy in medicine, oil production enhancement, and development of environmentally friendly materials. Especially as a green surfactant, it can effectively replace traditional chemicals, thereby significantly reducing environmental burden. However, its industrialization process still faces key bottlenecks. The proportion of lactone-type products in the natural strain is usually only 50%, and the cost of separation and purification accounts for more than 60% of the total cost. In addition, the cost pressure caused by the reliance on high-priced vegetable oil as raw material restricts its large-scale application. Therefore, it is necessary to strengthen the expression of lactonization genes in the strain through synthetic biology technology, develop a low-cost substrate fermentation process, and build an efficient separation system to break through the production barriers and fully release its potential in high-end markets such as anti-cancer drug carriers and bio-based functional materials. Patent CN118497250A discloses an engineered strain for high-yield lactone-type sophorolipids, a construction method and application thereof. The application obtains a double-knockout strain ΔrlpΔleu3 by knocking out the pH-responsive protein rlp gene and the leu3 transcription factor gene that regulates branched-chain amino acid synthesis in the wild strain of S. bombicola CGMCC1576, and then overexpresses the lactonization enzyme gene lipB using the endogenous strong promoter of enoyl reductase Peno in S. bombicola to obtain an engineered strain for high-yield lactone-type sophorolipids. The total sophorolipid yield is 80.69 g / L, and the proportion of lactone-type sophorolipids is 67.53%. Although the total sophorolipid yield and the proportion of lactone-type sophorolipids have been improved to some extent compared to the original level, there is still room for further optimization.
[0004] In view of the above, the present application is proposed. SUMMARY
[0005] To overcome the shortcomings of the prior art, the present application provides a gme5 gene editing-based hph resistance gene knockout cassette, a genetically engineered strain and its application. The present application modifies the gme5 gene site of Starmerella bombicola, knocks out the gme5 gene related to sophorolipid production, and integrates the lactonization enzyme gene sble and the fatty acid transferase gene alcs at the gme5 gene site to obtain a genetically engineered strain for high-yield lactone-type sophorolipids, which can significantly increase the proportion of lactone-type sophorolipids in total sophorolipids and reduce production costs.
[0006] To achieve the above-mentioned purpose, the technical solution adopted by the present application is:
[0007] In a first aspect, the present application provides a gme5 gene editing based hph resistance gene knockout cassette, comprising a recombinant DNA construct with a nucleotide sequence as shown in SEQ ID NO: 1, which targets and replaces an endogenous gme5 gene with a nucleotide sequence as shown in SEQ ID NO: 2 by homologous recombination.
[0008] As a preferred embodiment of the present application, the hph resistance gene knockout cassette is hph resistance gene knockout cassette gme5::hph, which further comprises a hph resistance screening gene.
[0009] In a second aspect, the present application further provides a recombinant expression cassette, comprising an expression unit selected from one of the following groups:
[0010] (a) P TEF1 -sble expression unit, comprising a lactonohydrolase gene sble operably linked to a P TEF1 promoter, with a nucleotide sequence as shown in SEQ ID NO: 3;
[0011] (b) P TEF1 -alcs expression unit, comprising a fatty acid transferase gene alcs operably linked to a P TEF1 promoter, with a nucleotide sequence as shown in SEQ ID NO: 5;
[0012] (c) P TEF1 -sble-P gpd -alcs dual expression unit, comprising a lactonohydrolase gene sble operably linked to a P TEF1 promoter and a fatty acid transferase gene alcs operably linked to a P gpd promoter, with a nucleotide sequence as shown in SEQ ID NO: 7; TEF1 -sble-P gpd -alcs;
[0013] Wherein, integration of the expression unit results in replacement of the endogenous gme5 gene.
[0014] As a preferred embodiment of the present application, the expression unit is P TEF1 -sble expression unit, with a nucleotide sequence as shown in SEQ ID NO: 4, which is integrated into the gme5 gene site for expression of lactonohydrolase.
[0015] As a preferred embodiment of the present application, the expression unit is P TEF1 -alcs expression unit, with a nucleotide sequence as shown in SEQ ID NO: 6, which is integrated into the gme5 gene site for expression of fatty acid transferase.
[0016] As a preferred embodiment of the present application, the expression unit is P TEF1 -sble-P gpd -alcs double expression unit, the nucleotide sequence of which is shown in SEQ ID NO: 8, which is integrated into the gme5 gene site for expressing lactonohydrolase and fatty acid transferase.
[0017] As a preferred embodiment of the present application, the recombinant expression cassette is a lactonohydrolase expression cassette gme5::P TEF1 -sble, which is integrated into the gme5 gene site by P TEF1 The promoter-regulated lactonohydrolase gene sble is used for efficient expression of lactonohydrolase.
[0018] As a preferred embodiment of the present application, the recombinant expression cassette is a fatty acid transferase expression cassette gme5::P TEF1 -alcs, which is integrated into the gme5 gene site by P TEF1 The promoter-regulated fatty acid transferase gene alcs is used for expression of fatty acid transferase.
[0019] As a preferred embodiment of the present application, the recombinant expression cassette is a lactonohydrolase and fatty acid transferase expression cassette gme5::P TEF1 -sble-P gpd -alcs, which is integrated into the gme5 gene site by P TEF1 The promoter-regulated lactonohydrolase gene sble and P gpd The promoter-regulated fatty acid transferase gene alcs are used for expression of lactonohydrolase and fatty acid transferase.
[0020] In a third aspect, the present application further provides a recombinant vector comprising the hph resistance gene knockout cassette or the recombinant expression cassette.
[0021] In a fourth aspect, the present application further provides a genetically engineered bacterium, which is obtained by integrating the hph resistance gene knockout cassette or the recombinant expression cassette into the gme5 gene site of a starting bacterium of Starmerella bombicola ATCC22214, wherein the integration results in replacement of the endogenous gme5 gene.
[0022] As a preferred embodiment of the present application, the Starmerella bombicola ATCC22214 has a preservation number of CCTCC NO: M20232260.
[0023] In a fifth aspect, the present application further provides a method for constructing a genetically engineered bacterium, comprising:
[0024] The gme5 gene site in the starting strain of the bee-borne Candida sonorensis is integrated with the hph resistance gene knock-out cassette or the recombination expression cassette; wherein the integration causes the endogenous gme5 gene to be replaced.
[0025] Specifically, the method for constructing the genetically engineered bacteria comprises:
[0026] (1) using the hph resistance gene knock-out cassette gme5::hph, knocking out and replacing the gme5 gene of the bee-borne Candida sonorensis with the recombination DNA construct shown in SEQ ID NO: 1, to construct the genetically engineered bacteria SL-1;
[0027] (2) using the lactonizing enzyme expression cassette gme5::P TEF1 -sble, knocking out and replacing the gme5 gene of the bee-borne Candida sonorensis with the lactonizing enzyme gene sble regulated by the natural strong promoter P TEF1 , to construct the genetically engineered bacteria SL-2; the expression level of the sble gene is increased to increase the proportion of lactone sophorolipids in the total product;
[0028] (3) using the fatty acid transferase expression cassette gme5::P TEF1 -alcs, knocking out and replacing the gme5 gene of the bee-borne Candida sonorensis with the long-chain fatty acid transport protein gene alcs regulated by the natural strong promoter P TEF1 , to construct the genetically engineered bacteria SL-3; the expression level of the alcs gene is increased to increase the total yield of sophorolipids;
[0029] (4) using the lactonizing enzyme and fatty acid transferase expression cassette gme5::P TEF1 -sble-P gpd -alcs, knocking out and replacing the gme5 gene of the bee-borne Candida sonorensis with the lactonizing enzyme gene sble and the fatty acid transferase gene alcs regulated by the natural strong promoters P TEF1 and P gpd , to construct the genetically engineered bacteria SL-4; the expression levels of the sble and alcs genes are simultaneously increased to increase the yield and the proportion of lactone sophorolipids.
[0030] In a sixth aspect, the present application further provides a use of the genetically engineered bacteria in the fermentation production of sophorolipids.
[0031] In a seventh aspect, the present application further provides a fermentation production method of high-yield lactone sophorolipids, comprising fermenting and producing sophorolipids by using the genetically engineered bacteria.
[0032] As the preferred embodiment of the present application, the fermentation production method comprises: adding fermentation medium in a fermentation tank, culturing the genetically engineered bacteria through two-stage seed expansion, inoculating 10% into the fermentation medium, adjusting the pH value to 3.0-5.0, starting fermentation, fermentation temperature 25-35℃, stirring speed 200-600rpm, maintaining the relative value of dissolved oxygen in the fermentation tank at 25-45%; adding a certain amount of feed medium every 6 hours after 24 hours of fermentation to strengthen the nutrition supply, and finally realizing the efficient synthesis and enrichment of lactone sophorolipids in the fermentation broth through 120-150 hours of systematic regulation.
[0033] As the preferred embodiment of the present application, the composition of the fermentation medium comprises: glucose 50-60g / L, yeast powder 3-5g / L, potassium dihydrogen phosphate 0.5-1.5g / L, dipotassium hydrogen phosphate trihydrate 0.08-0.15g / L, magnesium sulfate heptahydrate 0.5-1.0g / L, copper sulfate pentahydrate 40-60mg / L, ferrous sulfate heptahydrate 5-15mg / L, citric acid monohydrate 3-7g / L, corn syrup dry powder 1-3g / L, oil 30-40g / L.
[0034] As the preferred embodiment of the present application, the fermentation medium and the seed medium need to be sterilized, and the sterilization method is the conventional operation in the art without special requirements.
[0035] As the preferred embodiment of the present application, the two-stage seed expansion is: inoculating the Bombtrigosemidiflava into the seed medium (liquid volume 100 mL / 250 mL flask), culturing at 30℃, 220rpm for about 24 hours to obtain the first-stage seed liquid, then inoculating the first-stage seed liquid into the seed medium again (liquid volume 1 L / 3 L flask) at a 10% inoculation amount, culturing at 30℃, 220rpm for about 8 hours to form the bacterial suspension, which is the second-stage seed liquid.
[0036] As the preferred embodiment of the present application, the composition of the seed medium comprises: glucose 15-25g / L, yeast powder 8-12g / L, and peptone 15-25g / L.
[0037] As the preferred embodiment of the present application, the composition of the selection medium comprises: 1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) glucose, and 0.5-1 g / L g / L hygromycin agar medium.
[0038] As the preferred embodiment of the present application, the composition of the feed medium is 800g / L glucose 18L, and oleic acid 8L.
[0039] As the preferred embodiment of the present application, the method of adding the feed medium is: adding 1L of glucose and 0.5L of oleic acid every 6 hours after 24 hours of fermentation.
[0040] The total content of sophorolipids produced by the genetically engineered bacteria and the fermentation production method is more than 320 g / L.
[0041] Compared with the prior art, the technical scheme of the present application has the following advantages:
[0042] 1. The present application solves the technical bottleneck of high cost of separating lactonic sophorolipids and acidic sophorolipids, and constructs an engineered strain for synthesizing high-yield lactonic sophorolipids by directional modification of the bee-born Candida bombicola through genetic engineering strategy, and synergistically strengthens the activity of lactonization enzyme and the fatty acid transport capacity, so that the proportion of lactonic sophorolipids is maximized.
[0043] 2. The fermentation process provided by the present application is simple and easy to operate, and the proportion of single configuration product in the final product is high, which greatly simplifies the process difficulty of producing high-lactonic sophorolipids, greatly improves the feasibility of producing high-lactonic sophorolipids with the same production equipment, and reduces the production cost. BRIEF DESCRIPTION OF DRAWINGS
[0044] Figure 1 It is a sophorolipid metabolic pathway diagram and modification site.
[0045] Figure 2 It is a plasmid hph-pG map.
[0046] Figure 3 It is a plasmid P TEF1 -TtrpC-hph-pG map.
[0047] Figure 4 It is a plasmid P TEF1 -sble-TtrpC-hph-pG map.
[0048] Figure 5 It is a plasmid P TEF1 -alcs-TtrpC-hph-pG map.
[0049] Figure 6 It is a plasmid P TEF1 -sble-P gpd -alcs-TtrpC-hph-pG map.
[0050] Figure 7For the control group sophorolipid liquid chromatogram.
[0051] Figure 8 For the control group sophorolipid liquid chromatogram.
[0052] Figure 9 For the control group sophorolipid liquid chromatogram.
[0053] Figure 10 For the control group sophorolipid liquid chromatogram.
[0054] Figure 11 For the control group sophorolipid liquid chromatogram. DETAILED DESCRIPTION
[0055] The present application can be further described in the following Examples and Comparative Examples. Other advantages and benefits of the present application will become apparent to those skilled in the art, upon consideration of the following detailed description of the application, taken in conjunction with the accompanying drawings.
[0056] It should be noted that the process equipment or devices not specifically mentioned in the following examples are all conventional equipment or devices in the art.
[0057] It should be understood that the one or more method steps mentioned in the present application do not exclude the presence of other method steps before and after the mentioned combination steps or the insertion of other method steps between the mentioned steps, unless otherwise specified; it should also be understood that the combination connection relationship between the one or more devices mentioned in the present application does not exclude the presence of other devices before and after the mentioned combination devices or the insertion of other devices between the mentioned two devices, unless otherwise specified. Moreover, unless otherwise specified, the numbering of each method step is only a convenient tool to identify each method step, and is not intended to limit the arrangement order of each method step or to limit the scope of the present application, and the change or adjustment of the relative relationship, without substantial change of the technical content, is also considered as the scope of the present application.
[0058] The present application will be further described in conjunction with specific examples, but the scope of protection of the present application is not limited thereto.
[0059] In the following examples, the final concentration of hygromycin in the culture medium is 0.5-1 g / L, and the final concentration of spectinomycin in the L B The final concentration of spectinomycin in the culture medium is 0.05 mg / L.
[0060] The composition of the fermentation medium comprises: glucose 50-60 g / L, yeast powder 3-5 g / L, potassium dihydrogen phosphate 0.5-1.5 g / L, dipotassium hydrogen phosphate trihydrate 0.08-0.15 g / L, magnesium sulfate heptahydrate 0.5-1.0 g / L, copper sulfate pentahydrate 40-60 mg / L, ferrous sulfate heptahydrate 5-15 mg / L, citric acid monohydrate 3-7 g / L, corn syrup dry powder 1-3 g / L, oil 30-40 g / L.
[0061] The composition of the seed medium comprises: glucose 15-25 g / L, yeast powder 8-12 g / L, and protein peptone 15-25 g / L.
[0062] The composition of the LB medium comprises: yeast powder 4-6 g / L, protein peptone 8-12 g / L, and sodium chloride 4-6 g / L.
[0063] The composition of the YPD medium comprises: 1% (w / v) yeast extract, 2% (w / v) protein peptone, and 2% (w / v) glucose.
[0064] The selection medium is YPD medium, and 0.5-1 g / L hygromycin and 2% agar powder are added.
[0065] The primer sequence information used in the examples is shown in Table 2.
[0066] Table 1: Genes involved in gene editing and corresponding pathways
[0067] Gene name Pathway involved sble Lactone-type sophorolipid synthesis alcs Fatty acid transport gme5 Sophorolipid production-related negative regulator hph Hygromycin resistance gene
[0068] Table 2: Primer sequence Primer name Primer sequence (5'-3') gme5-for CAGTACCTATTAGATAATATTTATTACGTGATATTCGC gme5-rev GAGCAAGGAACTGCCACTGATC hph-for CTTGATTGGACGCGACGG GTTGTTGCTGGAGTCTC ]]> hph-rev CGGGTTTTCGAGAACGAAATACAGGCT GTGCGTTTTATTCTGTC ]]> gme5-5'flanking-for CCCGGCCTTAATTCTT CAGTACCTATTAGATAATATTTATTACGT ]]> gme5-5'flanking-rev CTTGCAGATGAGACTCCAGCAA CAACCCGTCGCGTCCAATCAAGATTC ]]> gme5-3'flanking-for GACAGAATAAAACGCACAGCCT GTATTTCGTTCTCGAAAACCCGGG ]]> gme5-3'flanking-rev GAGTTTCATCTCCTCTCCTGAGTTGGAG GAGCAAGGAACTGCCACTGATC ]]> P TEF1 -for]] CTTGATTGGACGCGACGG TGTCCTATGGCTTCTGC ]]> P TEF1 -rev]]> CGTTGGGATTCAAATGGTCT CAAATCATTTTCAAATTAAG ]]> Ttrpe-for GAATCCCAACGGATCCACATT GGCGGATTGAGAGCAAATC ]]> Ttrpc-rev CTTGCAGATGAGACTCCAGCAACAA CAGCCGAAAATCTTTCAAGCACGA ]]> sble-for AAAAAAACTTAATTTGAAAA ATGCTGGCTCTGTTTTTTTCGCTTGCGC <!-- 5 -->]]> sble-rev GTTGGGATTCAAATGGTCTCAAA TCATGTATGAGTTGAGTTTAC ]]> alcs-for CTTAACCAAAAAACTTAATTTGAAAA ATGAGTGGATTAGAGATTGCTGCGGCGG ]]> alcs-rev GATTCAAATGGTCTCAAATCA TTAGAGCTTGTGTCGCCCAT ]]> pG-for GAATCTTGATTGGACGCGACGG GTTGTTGCTGGAGTCTCATCTGCAAG ]]> pG-alcs-rev CAGCAATCTCTAATCCACTCATTT GTGTAGAGTTGTTTTTGTTGTTAAGT ]]> alcs-p TEF1 -rev GGCAAAGCAGAAGCCATAGGACATCA TTAGAGCTTGTGTCGCCCATTCTC ]]> gme5-VF GAGTTTCACATCTGTTTTTCCAC gme5-VR GGTGTGAGTCAACCTGATCC
[0069] Note: The underlined part in Table 2 is the sequence of the non-homologous arm of the gene.
[0070] Example 1: HPLC-CAD determination of sophorolipids
[0071] HPLC conditions:
[0072] Column: NUCLEODUR C18 Gravity (3 μm, 4.6×150 mm)
[0073] Mobile phase: A: H2O+0.05%FA, B: ACN+0.05%FA
[0074] Gradient: 0-40 min, 40%-75% B
[0075] Column temperature: 35°C
[0076] Flow rate: 1 mL / min
[0077] CAD detector: default parameters unchanged
[0078] Diluted 5 times with ethanol, sample volume: 5 μL.
[0079] Example 2: Construction of gene knockout cassette with hph resistance selection marker
[0080] (1) The genomic DNA of S. bombicola (purchased from Zhi Lizhongte (Wuhan) Biotechnology Co., Ltd.) was used as the template, and the gme5 genomic fragment was obtained by PCR amplification (denaturation: 98 ℃, 30 s, annealing 51 ℃, 30 s, extension 72 ℃, 5 min) using gme5-for and gme5-rev as primers. The nucleotide sequence is shown as SEQ ID NO: 9. The 5' flanking fragment of the upstream region was amplified by PCR using gme5-5' flanking-for and gme5-5' flanking-rev as primers, and the 3' flanking fragment of the downstream region was amplified by PCR using gme5-3' flanking-for and gme5-3' flanking-rev as primers. The pan7-1 plasmid (source Michael Bromley (Addgene plasmid # 188741; http: / / n2t.net / addgene:188741; RRID: Addgene_188741, nucleotide sequence as shown in SEQ ID NO: 10) was used as the template, and the hph resistance gene fragment was obtained by PCR amplification (denaturation: 98 ℃, 30 s, annealing 51 ℃, 30 s, extension 72 ℃, 5 min) using hph-for and hph-rev as primers, that is, the knockout plasmid hph-pG.
[0081] (2) Finally, the 5' flanking, 3' flanking and hph resistance gene fragments were connected by a seamless cloning reaction to replace the SMR + -pTarget to obtain the knockout plasmid hph-pG, and the plasmid map is shown in Figure 2 . Using the plasmid hph-pG as the template, the gme5 gene site integration hph resistance gene knockout cassette gme5::hph (sequence as shown in SEQ ID NO. 1) can be obtained by amplification using primers gme5-5' flanking-for and gme5-3' flanking-rev. The gene knockout cassette with a resistance selection marker is constructed by the above method, and the shortest time is 1 day.
[0082] Example 3: Construction of GME5 gene knockout strain
[0083] (1) A single colony of *S. bombicola* was inoculated into a 250 mL shake flask containing 25 mL of YPD medium (composition of 1% (w / v) yeast extract, 2% (w / v) peptone, and 2% (w / v) glucose) and cultured at 30 ℃ and 300 rpm for 18 h to obtain the culture medium.
[0084] (2) Inoculate the culture medium from the previous step into a 250 mL shake flask containing 50 mL of YPD medium at a volume of 2% (v / v), and culture the cells at 30 ℃ and 120 rpm until OD. 600 The value should be between 1 and 2. Transfer the bacterial culture to a 50 mL centrifuge tube, centrifuge at 3000 g and 4 °C for 5 min to collect the bacterial cells. Resuspend the precipitate in 50 mL of ice-cooled sterile water, centrifuge at 3000 g and 4 °C for 5 min, and discard the supernatant. Resuspend the precipitate again in 50 mL of ice-cooled sterile water and centrifuge. Resuspend the bacterial precipitate in 4 mL of ice-cold 1 M sterile sorbitol solution, centrifuge at 3000 g and 4 °C for 5 min, and discard the supernatant. Resuspend the precipitate in 4 mL of freshly prepared 0.1 M lithium acetate solution (3500 μL water, 400 μL 1 M lithium acetate, 100 μL 1 M DTT), incubate at room temperature for 15 min, centrifuge at 3000 g and 4 °C for 5 min, and discard the supernatant. Resuspend the bacterial precipitate in 4 mL of ice-cold 1 M sterile sorbitol solution, centrifuge at 3000 g and 4 °C for 5 min, and discard the supernatant. Suspend the bacterial cells in 1 M sorbitol solution, place on ice, and use as soon as possible. Transfer 50 μL of this yeast suspension to a centrifuge tube, add 3–5 μg of the DNA knockout cassette fragment gme5::hph (sequence shown in SEQ ID NO.1), mix thoroughly, and pre-cool on ice for 5 min. Transfer the mixture to an electroporation cuvette with a 0.2 cm gap and incubate on ice for 5 min. Then, apply a 5 ms pulse and 2.5 kV pulse to the mixture using a Bio-Rad electroporator. Remove the cuvette, immediately add ice-cooled 1 M sorbitol, gently mix, transfer to a 1.5 mL centrifuge tube, and incubate at 30 °C for 1 h. Spread 100 μL of the mixture onto selective medium and incubate at 30 °C for approximately 1 week. The selective medium consisted of 1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) glucose, 0.5 g / L hygromycin, and 2% agar powder.
[0085] (3) The grown single colony was subjected to liquid amplification culture, and then the genomic DNA was extracted. The wild type strain and the selected single colony genomic DNA were used as templates, and gme5-VF / gme5-VR was used as primers for PCR amplification. The amplified DNA fragments were detected. The length of the DNA fragment amplified by the single colony genomic DNA template was slightly larger than that of the constructed knockout cassette, which proved that the target gene knockout engineering strain (SL-1 strain) was obtained.
[0086] Example 4: P TEF1 Promoter overexpression vector construction
[0087] (1) Construction of P TEF1 -TtrpC-hph-pG plasmid: S. bombicola genome as template, P TEF1 -for and P TEF1 -rev primers were used to amplify the P TEF1 promoter sequence; the Ttrpc terminator sequence was amplified from the plasmid pSilent-1 using the primers Ttrpc-for and Ttrpc-rev; the PCR fragment was ligated to the vector hph-pG plasmid by homologous recombination, and then transformed into E. coli DH5a (source: Beijing TSINGKE TSC-C01 Trelief® 5a Chemically Competent Cell), and screened on spectinomycin plates, and the correct P TEF1 -TtrpC-hph-pG plasmid was obtained by sequencing verification, and the plasmid map is shown in Figure 3 .
[0088] (2) Construction of P TEF1 -sble-TtrpC-hph-pG plasmid: S. bombicola genome as template, sble-for and sble-rev primers were used to amplify the sble gene fragment; the PCR fragment was ligated to the vector P TEF1 -TtrpC-hph-pG plasmid by homologous recombination, and then transformed into E. coli DH5a, and screened on spectinomycin plates, and the correct P TEF1 -sble-TtrpC-hph-pG was obtained by sequencing verification, and the plasmid map is shown in Figure 4 . The obtained plasmid was subjected to PCR amplification with gme5-5' flanking-for and gme5-3' flanking-rev primers, and the obtained DNA fragment was the lactonase expression cassette gme5::P TEF1 -sble (the sequence is shown in SEQ ID NO. 4).
[0089] (3) Construction of P TEF1 -alcs-TtrpC-hph-pG plasmid: alcs gene fragment was amplified with alcs-for and alcs-rev primers using S. bombicola genome as template; the PCR product was ligated to vector P TEF1 -TtrpC-hph-pG plasmid, and then transformed into E. coli DH5a, screened by spectinomycin plates, and verified by sequencing to obtain correct P TEF1 -alcs-TtrpC-hph-pG plasmid, and the plasmid map is shown in Figure 5 The obtained plasmid was subjected to PCR amplification with gme5-5'flanking-for and gme5-3'flanking-rev primers, and the obtained DNA fragment was the fatty acid transferase expression cassette gme5::P TEF1 -alcs (the sequence is shown in SEQ ID NO. 6).
[0090] (4) Construction of P TEF1 -sble-P gpd -alcs-TtrpC-hph-pG plasmid: alcs gene fragment was amplified with alcs-for and alcs-P TEF1 -rev primers using S. bombicola genome as template, and pG promoter fragment was amplified with primers pG-for and pG-alcs-rev using plasmid P TEF1 -TtrpC-hph-pG as template; the PCR product was ligated to vector P TEF1 -sble-P gpd -alcs-TtrpC-hph-pG plasmid, and then transformed into E. coli DH5a, screened by spectinomycin plates, and verified by sequencing to obtain correct P TEF1 -sble-P gpd -alcs-TtrpC-hph-pG plasmid, and the plasmid map is shown in Figure 6 The obtained plasmid was subjected to PCR amplification with gme5-5'flanking-for and gme5-3'flanking-rev primers, and the obtained DNA fragment was the lactonase and fatty acid transferase expression cassette gme5::P TEF1 -sble-P gpd -alcs (the sequence is shown in SEQ ID NO. 8).
[0091] Example 5: Culture of sble overexpression strain
[0092] (1) S. bombicola single colony was inoculated into a 250 mL shake flask containing 25 mL YPD medium and incubated at 30 °C, 300 rpm for 18 h.
[0093] (2) The culture from step (1) was inoculated into a 250 mL shake flask containing 50 mL YPD medium at 2% (v / v) and the cells were incubated at 30 °C, 120 rpm until the OD 600 between 1 and 2. The cell suspension was transferred to a 50 mL centrifuge tube and the cells were collected by centrifugation at 3000 g, 4 °C for 5 min. The cell pellet was resuspended in 50 mL ice-chilled sterile water, centrifuged at 3000 g, 4 °C for 5 min, and the supernatant was discarded. The cell pellet was resuspended in 50 mL ice-chilled sterile water and centrifuged. The cell pellet was resuspended in 4 mL ice-chilled 1 M sterile sorbitol solution, centrifuged at 3000 g, 4 °C for 5 min, and the supernatant was discarded. The cell pellet was resuspended in 4 mL ice-chilled 1 M sterile sorbitol solution, centrifuged at 3000 g, 4 °C for 5 min, and the supernatant was discarded. The cell pellet was resuspended in 1 M sorbitol solution, placed on ice, and used as soon as possible. 50 μL of the yeast suspension was pipetted into a centrifuge tube, and 3-5 μg of the DNA fragment gme5::P TEF1 -sble (the sequence is shown in SEQ ID NO. 4) was added to the yeast suspension and mixed well, and the mixture was placed on ice for 5 min. The mixture was transferred to an electroporation cup with a 0.2 cm gap, and placed on ice for 5 min. Then, the mixture was subjected to a pulse of 5 ms and 2.5 kV using an electroporator (Bio-Rad). The electroporation cup was removed, and ice-chilled 1 M sorbitol was added, mixed gently, and then transferred to a 1.5 mL centrifuge tube, and the mixture was incubated at 30 °C for 1 h. 100 μL of the mixture solution was spread on a selective medium and incubated at 30 °C for about 1 week. For the selection medium, agar medium containing 1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) glucose, and 0.5 g / L hygromycin was used.
[0094] (3) Genomic DNA was extracted from the grown single colonies after liquid amplification culture. PCR amplification was performed using the genomic DNA of the wild-type strain and the selected single colonies as templates, with gme5-VF / gme5-VR as primers. The amplified DNA fragments were then detected. Sequencing confirmed the successful insertion of the overexpressed fragment, thus confirming the successful acquisition of the Candida albicans genetically engineered strain SL-2.
[0095] Example 6: Construction of ALCS overexpression strain
[0096] (1) A single colony of *S. bombicola* was inoculated into a 250 mL shake flask containing 25 mL of YPD medium and cultured at 30 °C and 300 rpm for 18 h.
[0097] (2) Inoculate the culture medium from the previous step into a 250 mL shake flask containing 50 mL of YPD medium at a volume of 2% (v / v), and culture the cells at 30 ℃ and 120 rpm until OD. 600 The value should be between 1 and 2. Transfer the bacterial culture to a 50 mL centrifuge tube, centrifuge at 3000 g and 4 °C for 5 min to collect the bacterial cells. Resuspend the precipitate in 50 mL of ice-cooled sterile water, centrifuge at 3000 g and 4 °C for 5 min, and discard the supernatant. Resuspend the precipitate again in 50 mL of ice-cooled sterile water and centrifuge. Resuspend the bacterial precipitate in 4 mL of ice-cold 1 M sterile sorbitol solution, centrifuge at 3000 g and 4 °C for 5 min, and discard the supernatant. Resuspend the precipitate in 4 mL of freshly prepared 0.1 M lithium acetate solution (3500 μL water, 400 μL 1 M lithium acetate, 100 μL 1 M DTT), incubate at room temperature for 15 min, centrifuge at 3000 g and 4 °C for 5 min, and discard the supernatant. Resuspend the bacterial precipitate in 4 mL of ice-cold 1 M sterile sorbitol solution, centrifuge at 3000 g and 4 °C for 5 min, and discard the supernatant. Suspend the bacterial cells in 1 M sorbitol solution, place on ice, and use as soon as possible. Transfer 50 μL of this yeast suspension to a centrifuge tube, and add 3–5 μg of the transformation DNA fragment gme5::P. TEF1alcs (sequence as shown in SEQ ID NO. 6) were mixed well and pre-cooled on ice for 5 min. The mixture was transferred to an electrotransformation cuvette with a gap of 0.2 cm, and placed on ice for 5 min. Then, a pulse of 5 ms and 2.5 kV was applied to the mixture using an electrotransformation apparatus (Bio-Rad). The electrotransformation cuvette was removed and immediately added with ice-cooled 1 M sorbitol, mixed gently and then transferred to a 1.5 mL centrifuge tube, and the mixture was allowed to stand at 30 °C for 1 h. 100 μL of the mixture solution was spread on a selective medium and incubated at 30 °C for about 1 week. For the selection medium, an agar medium containing 1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) glucose and 0.5 g / L hygromycin was used.
[0098] (3) The grown single colonies were subjected to liquid amplification culture, and then the genomic DNA was extracted. The wild type strain and the selected single colony genomic DNA were used as templates, and PCR amplification was performed using gme5-VF / gme5-VR as primers. The amplified DNA fragments were detected. The DNA fragment obtained by amplification using the single colony genomic DNA as a template was verified by sequencing to confirm that the overexpression fragment was successfully inserted, which proved that the Candida gene engineering strain SL-3 was obtained.
[0099] Example 7: Construction of sble, alcs overexpression strain
[0100] (1) The S. bombicola single colony was inoculated into a 250 mL shake flask containing 25 mL YPD medium, and cultured at 30 °C, 300 rpm for 18 h.
[0101] (2) The culture solution of the above step was inoculated into a 250 mL shake flask containing 50 mL YPD medium at a rate of 2% (v / v), and the cells were cultured at 30 °C, 120 rpm until the OD 600Values were between 1 and 2. The bacterial liquid was loaded into a 50 mL centrifuge tube, and the bacteria were collected by centrifugation at 3000 g and 4 ℃ for 5 min, then the precipitate was resuspended with 50 mL of ice-cooled sterile water, centrifuged at 3000 g and 4 ℃ for 5 min, and the supernatant was discarded; the precipitate was resuspended with 50 mL of ice-cooled sterile water and centrifuged again. The bacterial precipitate was resuspended in 4 mL of ice-cold 1 M sterile sorbitol solution, centrifuged at 3000 g and 4 ℃ for 5 min, and the supernatant was discarded. The precipitate was suspended with 4 mL of freshly prepared 0.1 M lithium acetate solution (3500 μL of water, 400 μL of 1 M lithium acetate, and 100 μL of 1 M DTT), and after standing at room temperature for 15 min, the precipitate was centrifuged at 3000 g and 4 ℃ for 5 min, and the supernatant was discarded. The bacterial precipitate was resuspended in 4 mL of ice-cold 1 M sterile sorbitol solution, centrifuged at 3000 g and 4 ℃ for 5 min, and the supernatant was discarded. The bacteria were suspended with 1 M sorbitol solution, placed on ice, and used as soon as possible. 50 μL of the yeast suspension was taken into a centrifuge tube, 3-5 μg of the DNA fragment gme5::P TEF1 -sble-P gpd -alcs (the sequence is shown in SEQ ID NO. 8) was added, and the mixture was uniformly mixed and pre-cooled on ice for 5 min. The above mixture was transferred to an electroporation cup with a gap of 0.2 cm, and placed on ice for 5 min. Then, an electric pulse of 5 ms and 2.5 kV was applied to the mixture using an electroporator (Bio-Rad). The electroporation cup was taken out, and ice-cooled 1 M sorbitol was immediately added. After gentle mixing, the mixture was transferred to a 1.5 mL centrifuge tube, and the mixture was allowed to stand at 30 ℃ for 1 h. 100 μL of the mixture solution was spread on a selective medium, and cultured at 30 ℃ for about 1 week. For the selection medium, agar medium containing 1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) glucose, and 0.5 g / L hygromycin was used.
[0102] (3) The grown single colonies were subjected to liquid amplification culture, and the genomic DNA was extracted. The wild-type strain and the selected single colony genomic DNA were used as templates, and PCR amplification was performed with gme5-VF / gme5-VR as primers. The amplified DNA fragments were detected. The DNA fragment obtained by amplification with the single colony genomic DNA as the template was verified by sequencing to confirm that the overexpression fragment was successfully inserted, which proved that the Candida genetic engineering strain SL-4 was obtained.
[0103] Example 8: 50 L bioreactor fermentation of the Candida genetic engineering strain SL-4
[0104] The process for preparing sophorolipids from industrial-grade oleic acid by fermentation of Candida bacteria is as follows:
[0105] (1) Seed medium: 20 g / L peptone, 10 g / L yeast powder, 20 g / L glucose.
[0106] (2) Fermentation medium: glucose 60 g / L, Angel yeast powder YP100 4 g / L, potassium dihydrogen phosphate 1 g / L, potassium phosphate dibasic trihydrate 0.11 g / L, magnesium sulfate heptahydrate 0.7 g / L, copper sulfate pentahydrate 50 mg / L, ferrous sulfate heptahydrate 10 mg / L, citric acid monohydrate 5 g / L, corn syrup dry powder 2 g / L, industrial grade oleic acid 35 g / L.
[0107] (3) Feed medium: 800 g / L glucose 18 L, industrial grade oleic acid 8 L.
[0108] (4) 2 bottles of 100 mL seed medium were divided into 2 3 L shake flasks (1 L liquid volume), the fermentation medium was prepared in 20 L in a 50 L fermentation tank, the feed medium was prepared in 2 bottles of 9 L glucose in 10 L feed bottles, 1 bottle of 8 L industrial grade oleic acid in 10 L feed bottles, and all the media were prepared and sterilized at high temperature for use.
[0109] (5) Seed culture: 2 mL of Candida yeast containing bacteria in the bacteria preservation tube in the -80°C refrigerator was inoculated into the sterilized 100 mL seed medium, and the temperature was 30°C, the rotation speed was 220 rpm, and the fermentation culture was carried out for 24 h, to obtain the first level seed liquid, then the first level seed liquid was inoculated into the new sterilized 1 L seed medium at a inoculation amount of 10%, and the fermentation culture was carried out at a temperature of 30°C and a rotation speed of 220 rpm for 6-8 h to form a bacterial suspension, and the OD 600 was measured to be about 2.0, which was the second level seed liquid.
[0110] (6) Preparation of sophorolipids: the second level seed liquid was inoculated into the fermentation medium at a inoculation amount of 10%, the pH value was adjusted to 3.50, the fermentation was started, the fermentation temperature was 30°C, the initial stirring rotation speed was 220 rpm, the dissolved oxygen value of the fermentation tank was maintained at 30-35% for 0-48 h, the dissolved oxygen value of the fermentation tank was maintained at 35-40% for 48-96 h, and the dissolved oxygen value of the fermentation tank was maintained at 40-45% for 96-138 h. 1 L of glucose and 500 mL of industrial grade oleic acid feed medium were added every 6 h after 24 h, and the composition of the feed medium was 800 g / L glucose 18 L, industrial grade oleic acid 8 L. The fermentation was ended at 137 h, and sophorolipid fermentation liquid 35 L was obtained.
[0111] The sophorolipid content and the ratio of lactone and acid type in the fermentation liquid were detected according to the method in Example 1, and the results are shown in Figure 7 , Figure 8~Figure 11 which is the liquid chromatography result graph (wherein, Figure 8The liquid chromatogram of sophorolipids in the control group; Figure 9 The liquid chromatogram of sophorolipids in the SL2 group; Figure 10 The liquid chromatogram of sophorolipids in the SL3 group; Figure 11 The liquid chromatogram of sophorolipids in the SL4 group (the horizontal coordinate is time, and the vertical coordinate is intensity). The total content of sophorolipids in the SL-2 fermentation liquor was about 330 g / L, the proportion of lactone type was 70.45%, the total content of sophorolipids in the SL-3 fermentation liquor was about 370 g / L, the proportion of lactone type was 45.67%, and the total content of sophorolipids in the SL-4 fermentation liquor was 358.77 g / L, the proportion of lactone type was 74.07%, which increased by 24.29%. The above data can show that the genetically engineered bacteria SL-4 has the best comprehensive performance, and both the content of sophorolipids and the proportion of lactone type are significantly improved, which can be seen that the gme5 gene site is integrated by P TEF1 The lactonizing enzyme gene sble and the fatty acid transferase gene alcs regulated by the promoter P gpd The lactonizing enzyme gene sble and the fatty acid transferase gene alcs regulated by the promoter P
[0112] The above examples are intended to illustrate the embodiments disclosed in the present application and should not be construed as limiting the present application. In addition, various modifications listed herein and changes in the methods and compositions of the invention are obvious to those skilled in the art without departing from the scope and spirit of the present application. Although the present application has been specifically described in conjunction with various specific preferred embodiments of the present application, it should be understood that the present application should not be limited to these specific embodiments. In fact, various modifications as described above to obtain the invention that are obvious to those skilled in the art should be included in the scope of the present application.
Claims
1. A method based on gme5 Gene editing hph Resistance gene knockout cassette, characterized in that, The hph The resistance gene knockout cassette contains a recombinant DNA construct with the nucleotide sequence shown in SEQ ID NO:1, which targets and replaces endogenous regulatory factors through homologous recombination. gme5 Genes, the regulatory factors gme5 The nucleotide sequence of the gene is shown in SEQ ID NO:
2.
2. A recombinant expression cassette, characterized in that, It contains expression units selected from one of the following groups: (a) P TEF1 - sble Expression unit: contains P TEF1 Promoter-operable linked lactotransferase genes sble Its nucleotide sequence is shown in SEQ ID NO:3; (b) P TEF1 - alcs Expression unit: contains P TEF1 Promoter-operable linked fatty acid transferase genes alcs Its nucleotide sequence is shown in SEQ ID NO:5; (c)P TEF1 - sble -P gpd - alcs Dual expression unit: containing P TEF1 Promoter-operable linked lactotransferase genes sble and P gpd Promoter-operable linked fatty acid transferase genes alcs Its nucleotide sequence is shown in SEQ ID NO:7; P TEF1 - sble -P gpd - alcs ; Wherein, the integration of the expression units leads to endogenous gme5 The gene was replaced.
3. The recombinant expression cassette according to claim 2, characterized in that: When the expression unit is (a), the P TEF1 - sble The nucleotide sequence of the expression unit is shown in SEQ ID NO:4, and it is used for integration into the regulatory factor. gme5 Gene locus and expression of lactonelase; When the expression unit is (b), the P TEF1 - alcs The nucleotide sequence of the expression unit is shown in SEQ ID NO:6, and it is used for integration into... gme5 Gene loci and expression of fatty acid transferase; When the expression unit is (c), the P TEF1 - sble -P gpd - alcs The nucleotide sequence of the dual expression unit is shown in SEQ ID NO:8, and it is used for integration into the regulatory factor. gme5 Gene loci and expression of lactonease and fatty acid transferase.
4. A recombinant vector, characterized in that, Includes the claims 1 hph The resistance gene knockout cassette or the recombinant expression cassette as described in any of claims 2 to 3.
5. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria used *Candida bumblebee* as the starting strain, and the regulatory factors in the starting strain... gme5 Gene site integration as described in claim 1 hph The resistance gene knockout cassette, or the recombinant expression cassette as described in any one of claims 2-3, wherein the integration results in endogenous regulatory factors. gme5 The gene was replaced.
6. The application of the genetically engineered bacteria according to claim 5 in the fermentation production of sophorolipids.
7. A fermentation method for producing high-yield lactone-type sophorolipids, characterized in that, This includes the production of sophorolipids by fermentation using the genetically engineered bacteria described in claim 5.
8. The fermentation production method for high-yield lactone-type sophorolipids according to claim 7, characterized in that, include: Fermentation medium was added to the fermenter. The genetically engineered bacteria were inoculated into the fermentation medium at a ratio of 10% after two-stage seed culture. The pH was adjusted to 3.0–5.0, and fermentation began. The fermentation temperature was 25–35℃, the stirring speed was 200–600 rpm, and the dissolved oxygen relative value in the fermenter was maintained at 25–45%. After 24 hours of fermentation, the culture medium was added quantitatively every 6 hours. Finally, the synthesis and enrichment of lactone-type sophorolipids in the fermentation broth were achieved through systematic regulation over 120–150 hours. The fermentation medium comprises: glucose 50-60 g / L, yeast powder 3-5 g / L, potassium dihydrogen phosphate 0.5-1.5 g / L, dipotassium hydrogen phosphate trihydrate 0.08-0.15 g / L, magnesium sulfate heptahydrate 0.5-1.0 g / L, copper sulfate pentahydrate 40-60 mg / L, ferrous sulfate heptahydrate 5-15 mg / L, citric acid monohydrate 3-7 g / L, corn steep liquor powder 1-3 g / L, and oil 30-40 g / L.
9. The fermentation production method for high-yield lactone-type sophorolipids according to claim 8, characterized in that, The two-stage seed culture is as follows: *Candida bumblebee* is inoculated into a seed culture medium and cultured at 30°C and 220 rpm for 12-36 hours to obtain a primary seed liquid. Then, the primary seed liquid is inoculated again into the seed culture medium at a 10% inoculation rate and cultured at 30°C and 220 rpm for 6-12 hours to form a bacterial suspension, i.e., a secondary seed liquid. The seed culture medium consists of: glucose 15-25 g / L, yeast extract 8-12 g / L, and peptone 15-25 g / L.
10. The fermentation production method for high-yield lactone-type sophorolipids according to claim 8, characterized in that, The feed culture medium consists of 18L of 800g / L glucose and 8L of oleic acid.
Citation Information
Patent Citations
High-yield lactone sophorolipid engineering bacterium as well as construction method and application thereof
CN118497250A
Method for producing sophorolipid through fermentation of candida mycoderma bacteria and application of sophorolipid
CN118547029A