Deleted mutant nucleic acid and application thereof in herbicide resistance

Abstract

The invention relates to a deleted mutant nucleic acid and application thereof in herbicide resistance. The deletion mutation occurs in a promoter of the rice OsHPPD gene, the length of a deletion sequence is at least 10 bp, A in an initiation codon ATG of the OsHPPD gene is taken as a 0 site, and at least 2041-2032 sites of basic groups located on the upstream of the initiation codon ATG are deleted. According to the application disclosed by the invention, the rice can obtain resistance to HPPD inhibitor herbicides by deleting part of sequences in the promoter of the rice OsHPPD gene, so that the application has great application values in guaranteeing agricultural production safety and improving the use efficiency of the herbicides.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of nucleic acid, in particular to a deletion mutant nucleic acid and its application in herbicide resistance. BACKGROUND

[0002] In agricultural production, the use of herbicides is of great significance to improve crop yield and reduce labor costs. However, with the long-term and large-scale use of herbicides, the problem of weed resistance is increasingly prominent, leading to decreased herbicidal effect and even phytotoxicity. In order to solve this problem, scientists have been working to develop new herbicides and corresponding herbicide-resistant crop varieties. Among them, 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor herbicides have attracted widespread attention due to their high efficiency, low toxicity, and environmental friendliness. This type of herbicide inhibits the activity of HPPD enzyme, blocks the carotenoid biosynthesis pathway, and causes the leaves of weeds to turn white and eventually die. HPPD inhibitor herbicides are mainly used in upland crops such as corn, wheat, and barley, but ordinary rice is highly sensitive to them, and even a small amount of application can cause rice seedlings to appear white symptoms or even die. Therefore, creating HPPD inhibitor herbicide-resistant rice varieties is of great application value for ensuring agricultural production safety and improving herbicide use efficiency. SUMMARY

[0003] One of the present application provides a deletion mutant nucleic acid, wherein the deletion mutation occurs in the promoter of the rice OsHPPD gene, the length of the deleted nucleic acid sequence is at least 10 bp, and the 0th A in the start codon ATG of the gene is deleted at least the bases from 2041 to 2032 upstream of the start codon ATG. OsHPPD

[0004] That is, as long as the 10 bp bases (TCAATTTGAC, the sequence is shown as SEQ ID No. 12) containing the 2041 to 2032 bases upstream of the start codon ATG are deleted, the rice will produce resistance to HPPD inhibitor herbicides.

[0005] In one specific embodiment, the length of the deleted nucleic acid sequence is 10 bp to 54 bp, and the 0th A in the start codon ATG of the gene is deleted at least the bases from 2041 to 2032 upstream of the start codon ATG. OsHPPD ​The A in the gene start codon ATG is 0, and the deleted nucleic acid occurs at the site from 2046 to 1993 upstream of the start codon ATG. That is, the longest deletion sequence can be a 54 bp GTAAGTCAATTTGACACTGCAGCCCTCCTGGTCCGTTTCTGGATGGGCATATGC sequence (as shown in SEQ ID No. 13) containing a 10 bp TCAATTTGAC (as shown in SEQ ID No. 12); it can also be a sequence containing a 10 bp TCAATTTGAC (as shown in SEQ ID No. 12) in any one of the 54 bp GTAAGTCAATTTGACACTGCAGCCCTCCTGGTCCGTTTCTGGATGGGCATATGC (as shown in SEQ ID No. 13); it can also be a combination of a sequence containing a 10 bp TCAATTTGAC (as shown in SEQ ID No. 12) in any one of the 54 bp GTAAGTCAATTTGACACTGCAGCCCTCCTGGTCCGTTTCTGGATGGGCATATGC (as shown in SEQ ID No. 13) and any other length sequence in the 54 bp GTAAGTCAATTTGACACTGCAGCCCTCCTGGTCCGTTTCTGGATGGGCATATGC (as shown in SEQ ID No. 13).

[0006] In one specific embodiment, the sequence of the deleted nucleic acid is 10 bp in length and is located at the site from 2041 to 2032 upstream of the start codon ATG. OsHPPD The A in the gene start codon ATG is 0, and the deleted nucleic acid occurs at the site from 2046 to 1993 upstream of the start codon ATG.

[0007] In one specific embodiment, the sequence of the deleted nucleic acid is 54 bp in length and is located at the site from 2041 to 2032 upstream of the start codon ATG. OsHPPD The A in the gene start codon ATG is 0, and the deleted nucleic acid occurs at the site from 2046 to 1993 upstream of the start codon ATG.

[0008] In one specific embodiment, the sequence of the nucleic acid before the deletion mutation is as shown in SEQ ID No. 5.

[0009] The second aspect of the present application provides the use of the deletion mutant nucleic acid according to any one of the first aspect of the present application in rice resistant to HPPD inhibitor herbicides.

[0010] In one specific embodiment, the herbicide is mesotrione.

[0011] In one specific embodiment, the variety of the rice is Nangjing 46.

[0012] The third invention provides a method for accumulating HPPD inhibitor-resistant herbicides in rice, which involves deleting HPPD inhibitors from the rice genome through gene editing or homologous recombination. OsHPPD This is achieved by obtaining a deletion mutation nucleic acid as described in any one of the present invention, using a portion of the bases in the gene promoter.

[0013] In one specific embodiment, the gene editing system is a CRISPR / Cas12i3 system.

[0014] In one specific embodiment, the method includes the following steps: 1) Obtain the pHZLib-Cas12i3 vector, or the pHZ33 and pUbi-IEE-Cas12i3 vector; 2) Obtain a crRNA sequence or target sequence for gene editing, wherein the crRNA sequence is shown in SEQ ID No. 6; and the target sequence is located at positions 34 to 56 of the sequence shown in SEQ ID No. 6. 3) The crRNA sequence is cloned into the pHZLib-Cas12i3 vector to obtain pHZLib-Cas12i3-crRNA; or the target sequence is cloned into the pHZ33 vector to obtain the pHZ33-Spacer vector, and then the pHZ33-Spacer is integrated with the pUbi-IEE-Cas12i3 vector into a single vector to obtain pUbi-IEE-Cas12i3-HZ33-Spacer; 4) pHZLib-Cas12i3-crRNA or pUbi-IEE-Cas12i3-HZ33-Spacer were transformed into Agrobacterium and used to infect rice callus tissue to screen for rice lines resistant to HPPD inhibitor herbicides.

[0015] In one specific embodiment, the rice variety is Nanjing 46.

[0016] In one specific embodiment, the pHZLib-Cas12i3 vector is constructed by the following operations: 1) replacing the DR-crRNA-BsaI-BsaI-DR element in pHZ33 with the suicide gene ccdB to obtain the pHZ33-ccdB vector; 2) integrating pHZ33-ccdB with pUbi-IEE-Cas12i3 into a single vector to obtain the pHZLib-Cas12i3 vector.

[0017] Beneficial effects of the present invention: The present invention discovers that by deleting rice OsHPPDA portion of the promoter sequence of a gene can induce resistance in rice to HPPD inhibitor herbicides, which is of great application value for ensuring agricultural production safety and improving herbicide application efficiency. Deletion mutations can be achieved using the CRISPR / Cas12i3 system, or through other CRISPR / Cas systems, gene editing, or homologous recombination. Attached Figure Description

[0018] Figure 1 A schematic diagram of the CRISPR / Cas12i3 knockout vector, namely pHZLib-Cas12i3.

[0019] Figure 2 For rice OsHPPD A schematic diagram of the target sites for the non-coding region regulatory elements.

[0020] Figure 3 This is a schematic diagram of pHZLib-Cas12i3-crRNA (Pool01) to pHZLib-Cas12i3-crRNA (Pool06).

[0021] Figure 4 Sanger sequencing was used to identify allele variant types in the selected resistant plant H4-#34.

[0022] Figure 5 Sanger sequencing was used to identify allele variant types in the selected resistant plant H4-#67.

[0023] Figure 6 The resistance phenotypes of H4-#34-54, H4-#34-10, H4-#67-80 and H4-#67-28 T2 generation plants and wild-type control (CK) after spraying with mesotrione. Detailed Implementation

[0024] The present invention will be further described in detail below through preferred embodiments, but these embodiments do not constitute a limitation thereof.

[0025] Unless otherwise specified, the strains, plasmids, and reagents used in the embodiments of this invention can all be purchased commercially.

[0026] All synthesized nucleic acids were outsourced to Beijing Qingke Xinyue Biotechnology Co., Ltd. Construction of pHZLib-Cas12i3 recombinant plasmid.

[0027] With plasmid pHZLib2 (containing ccdBUsing the gene (CN2017112944154) as a template, and ccdB-F1 (as shown in SEQ ID No. 1) and ccdB-R1 (as shown in SEQ ID No. 2) as primers, PCR amplification was performed using high-fidelity enzyme I-5™ 2×High-Fidelity Master Mix (purchased from Kronin (Beijing) Biotechnology Co., Ltd.). The PCR fragment was recovered and was 809 bp in size. ccdB Gene fragment. Using plasmid pHZ33 (CN2024117722206) as a template, and phz33-outer-F (as shown in SEQ ID No. 3) and phz33-outer-R (as shown in SEQ ID No. 4) as primers, PCR amplification was performed using high-fidelity enzyme I-5™ 2×High-Fidelity Master Mix (purchased from Kloning (Beijing) Biotechnology Co., Ltd.). The PCR fragment was recovered, which was a linearized vector backbone fragment of approximately 2.8 kb in size. The fragment was then processed using the ClonExpress® II One Step Cloning Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). ccdB The gene fragment was infused with the linearized vector backbone fragment to obtain the vector pHZ33-ccdB. In pHZ33-ccdB, the DR-crRNA-BsaI-BsaI-DR element in pHZ33 was replaced with the suicide gene ccdB.

[0028] pHZ33-ccdB was linearized by digestion with Nhe I, and then cloned into pUbi-IEE-Cas12i3 (CN2024117722206) via Gateway's LR reaction to obtain pHZLib-Cas12i3. A schematic diagram of the main components of its plasmid is shown below. Figure 1 As shown.

[0029] OsHPPD Construction of gene plasmid libraries.

[0030] OsHPPD The gene and its upstream and downstream nucleic acid sequences (as shown in SEQ ID No. 5) were obtained from the MSU / TIGR Rice Genome Database (https: / / rice.uga.edu / ). The bases from positions 1 to 2411 at the 5' to 3' end constitute the promoter region, positions 2412 to 2479 form the 5' UTR, and positions 2480 to 3630 are... OsHPPD The exon portion of the gene (where positions 2480 to 2482 are the start codon ATG), positions 3631 to 4388 are the intron portion, and positions 4389 to 4578 are...OsHPPD The exon portion of the gene, from position 4579 to 4920, is the 3'UTR portion.

[0031] Will OsHPPD Gene editing of the non-coding regions (promoter, 3'UTR, and introns) of genes was divided into six libraries (Pool04 covers bases 176 to 817 of the sequence shown in SEQ ID No. 5, Pool03 covers bases 818 to 1327, Pool02 covers bases 1328 to 1886, Pool01 covers bases 1887 to 2479, and Pool05 covers...). OsHPPD The 3'UTR region of the gene, covered by Pool06 OsHPPD Each library contains 22 to 39 crRNA sequences (including the target sequence, conserved repetitive sequences in the CRISPR / Cas12i3 system guide RNA located at both ends of the target sequence, and sequences flanking the conserved repetitive sequences to facilitate PCR amplification). The location of the target sequence as shown in SEQ ID No. 5 and a schematic diagram of the screening and identification process for resistant lines are shown below. Figure 2 The sequence of oligonucleotide 9, OsHPPD-Pool04-crRNA9, in Pool04 is shown in SEQ ID No. 6; the sequence of oligonucleotide 24, OsHPPD-Pool04-crRNA24, in Pool04 is shown in SEQ ID No. 7 (the target sequence is the reverse complementary sequence in SEQ ID No. 5). A total of 162 crRNA oligonucleotide sequences were synthesized.

[0032] Using an equal volume and concentration of each oligonucleotide sequence from each library as a template, and Array-F1 (as shown in SEQ ID No. 8) and Array-R1 (as shown in SEQ ID No. 9) as primers, PCR amplification was performed using I-5™ 2×High-Fidelity Master Mix. The PCR products were recovered to obtain the crRNA of the OsHPPD gene in each library. The vector pHZLib-Cas12i3 was digested with Bsa I, and approximately 15.8 kb of the vector backbone was recovered (releasing the ccdB gene fragment). Using 2×MultiF Seamless Assembly Mix, the crRNA of the OsHPPD gene in each library was cloned into a 15.8 kb vector backbone (i.e., the ccdB gene in the pHZLib-Cas12i3 vector was replaced with the crRNA of the OsHPPD gene in each library), and named pHZLib-Cas12i3-crRNA(Pool01), pHZLib-Cas12i3-crRNA(Pool02), pHZLib-Cas12i3-crRNA(Pool03), pHZLib-Cas12i3-crRNA(Pool04), pHZLib-Cas12i3-crRNA(Pool05), and pHZLib-Cas12i3-crRNA(Pool06). A schematic diagram of their plasmid mapping is shown below. Figure 3 As shown in the figure. Twenty colonies were randomly selected from each library for sequencing, with a 100% accuracy rate.

[0033] Rice transformation and screening and identification of nicosulfuron-resistant rice using the pHZLib-Cas12i3-crRNA(Pool01) to pHZLib-Cas12i3-crRNA(Pool06) plasmid library.

[0034] 1) Rice callus induction: Hulled mature Nanjing 46 rice seeds were treated with 50% commercial disinfectant for 30 minutes, then washed 3 to 5 times with sterile water. The seeds were then transferred to sterile petri dishes, and excess water was absorbed with sterile absorbent paper. The seeds were placed on MSD solid medium (4.43 g / L MS powder (Murashige and Skoog medium); 30 g / L sucrose; 2 ml / L 2,4-dichlorophenoxyacetic acid; 8 g / L agar powder; pH 5.7) and cultured in a light-controlled environment for 10 days to induce callus formation. The embryo and bud of the seeds were removed, and the callus tissue was transferred to a new MSD plate and cultured for 5 days until it was ready for Agrobacterium transformation.

[0035] 2) Agrobacterium transformation: Six plasmid libraries, pHZLib-Cas12i3-crRNA (Pool01) to pHZLib-Cas12i3-crRNA (Pool06), were transformed into Agrobacterium strain EHA105 via electroporation, constructing six EHA105 libraries containing all the above crRNA plasmid libraries. The six Agrobacterium libraries were then washed with sterile water and subjected to OD240-245 ... 600 Between steps 1 and 2, Agrobacterium was collected from each bacterial bank by centrifugation and resuspended in MSD liquid medium to adjust its OD value. 600 =0.2, to obtain the bacterial suspension for each bacterial cell.

[0036] 3) Agrobacterium infection of rice callus: Place the callus tissue in the bacterial suspension of each of the above 6 bacterial banks for 30 minutes; then remove the bacterial suspension, transfer the callus tissue to sterile absorbent paper to remove excess bacterial suspension, and then transfer the callus tissue to a new MSD solid medium containing 100 μmol / L acetylsyl syringone, and incubate at room temperature in the dark for 2 to 3 days.

[0037] 4) Screening of resistant rice callus: After dark culture, the callus tissue was transferred to MSD solid medium (100 mg / L termethin; 50 mg / L hygromycin B) and cultured for 2 weeks to 2 months until resistant callus appeared on the surface of the callus tissue; the medium was changed every 2 weeks.

[0038] 5) Differentiation and rooting of resistant callus: Resistant callus tissue was transferred to regeneration medium (4.43 g / L MS powder; 30 g / L sucrose; 25 g / L sorbitol; 0.5 mg / L 1-naphthaleneacetic acid; 3 mg / L 6-benzylaminopurine; 100 mg / L termethin; 50 mg / L hygromycin B; 12 g / L agar powder; pH=5.7), and then transferred every 7 to 10 days until seedlings were formed. The seedlings were then transferred to 1 / 2 MS medium (2.21 g / L MS powder; 15 g / L sucrose; 8 g / L agar powder; pH5.7) to root, obtaining T0 generation rice plants. The obtained T0 generation rice plants were placed in a greenhouse for growth until self-pollination and T0 generation seeds were harvested.

[0039] 6) Identification of herbicide-resistant lines: All collected T0 generation seeds were sown on 1 / 2 MS medium supplemented with 0.1 μmol / L nicosulfuron for nicosulfuron resistance screening. After rooting, T1 generation rice plants were obtained. These T1 generation plants were then grown in a greenhouse until self-pollination and seed harvesting. The corresponding T0 generation lines of the obtained T1 generation nicosulfuron-resistant rice lines were identified. Results showed that the nicosulfuron-resistant rice lines originated from Pool04, with line numbers H4-#34 and H4-#67. Line H4-#34 was obtained by editing OsHPPD-Pool04-crRNA9; line H4-#67 was obtained by editing OsHPPD-Pool04-crRNA24.

[0040] 7) Genomic DNA Extraction: During the growth of T0 and T1 generation rice plants, approximately 0.1 g of leaves from each plant were harvested, flash-frozen in liquid nitrogen, and then ground using a grinder. 600 μL of 2× cetyltrimethylammonium bromide (CTAB) DNA extraction buffer (containing 1 / 1000 β-mercaptoethanol) was added, and the mixture was vortexed and lysed at 65°C for 45 min. 500 μL of chloroform was added, and the mixture was vigorously shaken to form an emulsion. The emulsion was centrifuged at 14000 rpm for 10 min at ambient temperature. After centrifugation, the supernatant was transferred to a 1.5 ml centrifuge tube, and an equal volume of isopropanol was added. The mixture was inverted and centrifuged at 14000 rpm for 10 min. The supernatant was discarded, and the white precipitate was washed with 700 μL of 70% ethanol aqueous solution. The tube was centrifuged at 14000 rpm for 5 min, the supernatant was discarded, and the tube was air-dried in a fume hood for 10 min. Dissolve the DNA in 30 μL of ultrapure water to obtain genomic DNA solutions for the T0 and T1 generations of each plant. Store the DNA solutions at -20°C.

[0041] 8) PCR amplification and sequencing detection of mutation sites: Primer pairs OsHPPD-F4 (as shown in SEQ ID No. 10) and OsHPPD-R4 (as shown in SEQ ID No. 11) were designed for identifying mutation sites in H4-#34 and H4-#67. Using genomic DNA solutions from H4-#34 and H4-#67 T0 and T1 generation plants as templates, and OsHPPD-F4 and OsHPPD-R4 as primer pairs, PCR amplification was performed using 2 × Rapid Taq Master Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The PCR products were then directly sequenced by Sanger sequencing.

[0042] Sanger sequencing results for H4-#34 (passport 0) showed a deletion mutation compared to the wild-type. Specifically, it exhibited a -54 bp / -10 bp biallelic deletion mutation.OsHPPD The A in the gene start codon ATG is at position 0, with a 54 bp deletion at positions 2046 to 1993 upstream of A, and a 10 bp deletion at positions 2041 to 2032 upstream of A. (See results below.) Figure 4 .

[0043] Sanger sequencing results for H4-#34 identified homozygous mutations, namely H4-#34-54, with a -54 bp / -54 bp deletion mutation occurring at positions 2046 to 1993 upstream of the start codon, and H4-#34-10, with a -10 bp / -10 bp deletion mutation occurring at positions 2041 to 2032 upstream of the start codon. (See [link to relevant documentation]). Figure 4 .

[0044] Sanger sequencing results for H4-#67 (passport 0) showed that H4-#67 also exhibited deletion mutations compared to the wild-type. Specifically, it contained biallelic deletion mutations of -80 bp / -28 bp. OsHPPD In the gene start codon ATG, position A is 0, with an 80 bp deletion at positions 2299-2220 upstream of A, and a 28 bp deletion at positions 2302-2275 upstream of A. (See...) Figure 5 .

[0045] Sanger sequencing results for H4-#67 identified homozygous mutations: H4-#67-80, with a -80 bp / -80 bp deletion mutation occurring at positions 2299-2220 upstream of the start codon, and H4-#67-28, with a -28 bp / -28 bp deletion mutation occurring at positions 2302-2275 upstream of the start codon. (See [link to relevant documentation]). Figure 5 .

[0046] 9) Verification of herbicide resistance in mutant lines: The commercial herbicide nicosulfuron suspension (purchased from Hangzhou Yingtai Biotechnology Co., Ltd.) was diluted with tap water to obtain a nicosulfuron diluted solution. The concentration of this diluted solution was 8 times the recommended field application dose. T1 generation seeds of H4-#34-54, H4-#34-10, H4-#67-80, and H4-#67-28 were sown in nutrient pots to obtain corresponding T2 generation plants. Wild-type rice was sown simultaneously as a negative control. When the rice plants grew to 2-3 leaves in the greenhouse, the nicosulfuron diluted solution was sprayed using a mobile sprayer. The plants were then continued to be cultivated in the greenhouse. The growth of the T2 generation plants was observed after 14 days. Figure 6The results showed that wild-type negative control rice seedlings exhibited bleaching and gradual death under the action of nicosulfuron, while the T2 generation plants of H4-#34-54, H4-#34-10, H4-#67-80, and H4-#67-28 all showed normal growth and green plant characteristics, indicating nicosulfuron resistance. Therefore, this demonstrates that editing (disruption) of these two regulatory region sequences induced herbicide resistance in rice.

Claims

1. A deletion mutant nucleic acid, said deletion mutation occurring in rice OsHPPD In the promoter of a gene, the length of the deleted nucleic acid sequence is at least 10 bp, and it is in the range of... OsHPPD The A in the gene start codon ATG is at position 0, and at least the bases located at positions 2041 to 2032 upstream of the start codon ATG are deleted.

2. The deletion mutant nucleic acid according to claim 1, characterized in that, The length of the deleted nucleic acid sequence ranged from 10 bp to 54 bp, and was... OsHPPD The A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2046 to 1993 upstream of the start codon ATG.

3. The deletion of the mutant nucleic acid according to claim 2, characterized in that, The deleted nucleic acid sequence is 10 bp in length, and... OsHPPD The A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2041 to 2032 upstream of the start codon ATG; and / or The deleted nucleic acid sequence is 54 bp in length, and... OsHPPD The A in the gene start codon ATG is at position 0, and the deleted nucleic acid occurs at positions 2046 to 1993 upstream of the start codon ATG.

4. The deletion mutant nucleic acid according to any one of claims 1 to 3, characterized in that, The sequence of the nucleic acid before deletion mutation is shown in SEQ ID No.

5.

5. The use of the deleted mutant nucleic acid according to any one of claims 1 to 4 in rice HPPD inhibitor herbicides.

6. The application according to claim 5, characterized in that, The herbicide is nicosulfuron.

7. The application according to claim 5, characterized in that, The rice variety mentioned is Nanjing 46.

8. A method for accumulating HPPD inhibitor-resistant herbicides in rice, which involves deleting HPPD inhibitors from the rice genome through gene editing or homologous recombination. OsHPPD This is achieved by obtaining a deletion mutant nucleic acid as described in any one of claims 1 to 4 from a portion of the bases in the gene promoter.

9. The method according to claim 8, characterized in that, The method includes the following steps: 1) Obtain the pHZLib-Cas12i3 vector, or the pHZ33 and pUbi-IEE-Cas12i3 vector; 2) Obtain a crRNA sequence or target sequence for gene editing, wherein the crRNA sequence is shown in SEQ ID No. 6; and the target sequence is located at positions 34 to 56 of the sequence shown in SEQ ID No.

6. 3) The crRNA sequence is cloned into the pHZLib-Cas12i3 vector to obtain pHZLib-Cas12i3-crRNA; or the target sequence is cloned into the pHZ33 vector to obtain the pHZ33-Spacer vector, and then the pHZ33-Spacer is integrated with the pUbi-IEE-Cas12i3 vector into a single vector to obtain pUbi-IEE-Cas12i3-HZ33-Spacer; 4) pHZLib-Cas12i3-crRNA or pUbi-IEE-Cas12i3-HZ33-Spacer were transformed into Agrobacterium and used to infect rice callus tissue to screen for rice lines resistant to HPPD inhibitor herbicides.

10. The method according to claim 8, characterized in that, The rice variety mentioned is Nanjing 46.

Images