Method for screening resistance genes of apple fruits to boring pests
By combining transcriptome analysis and quantitative real-time PCR detection with the Gateway cloning system and Agrobacterium-mediated transient transformation, the problem of low efficiency in screening insect-resistant genes in apple fruits was solved, enabling rapid and accurate gene screening and verification, which is applicable to research on various fruit pests.
Patent Information
- Application Number
- CN202511094647.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-06
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-08-06
AI Technical Summary
Existing technologies are insufficient for efficiently screening genes that enable apple fruits to resist borers, and traditional methods are time-consuming and inefficient, making it difficult to meet the needs of verifying the function of insect-resistant genes at the fruit level.
Transcriptome analysis was performed on changes in gene expression in apples after pest damage. Combined with quantitative real-time PCR detection, expression vectors were constructed using the Gateway cloning system, Agrobacterium-mediated transient transformation was performed, and gene expression was detected by RT-qPCR. In addition, gene function was evaluated by pest bioassay.
This method enables rapid and accurate screening of functional genes that confer resistance to apple borers, shortens the experimental cycle, improves screening efficiency, and ensures the accuracy and reliability of screening results. It is applicable to research on various fruit pests.
Smart Images

Figure CN120966958A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant disease and pest control technology, specifically relating to a method for screening resistance genes to borer pests that bore into apple fruits. Background Technology
[0002] apple( Malus domestica Apples are one of the most widely cultivated and important fruit crops worldwide, possessing high economic value. However, apple production faces various pest infestations, among which the pear fruit moth (… Grapholita molesta ), Peach fruit moth ( Carposina sasakii Apple codling moth ( Cydia pomonella The citrus fruit fly (Bactrocera dorsalis) is a serious borer pest that damages apple fruit. Its larvae primarily bore into the fruit, causing rot, reduced quality, and yield loss. Currently, the control of these borers mainly relies on chemical pesticides, such as organophosphates and pyrethroids. However, long-term use of chemical pesticides not only easily leads to increased pesticide resistance in pests but also poses potential threats to the environment and human health. Therefore, developing biological control strategies based on plant-resistant insect genes has become a research hotspot.
[0003] In recent years, the role of plant secondary metabolites in insect resistance has received widespread attention. Studies have shown that certain genes can regulate secondary metabolic pathways in plants, thereby enhancing their resistance to pests. However, current research on the function of insect-resistant genes in apples is limited, especially at the fruit level, and effective methods for verifying their insect-resistant functions are lacking. Furthermore, existing gene function studies largely rely on model plants (such as Arabidopsis thaliana or tobacco), and these research systems are difficult to directly apply to the screening and verification of insect-resistant genes in fruit trees.
[0004] Therefore, establishing a method for verifying the function of insect-resistant genes in apple fruits has significant scientific research value and industrial application potential.
[0005] Currently, plant gene function research mainly relies on transgenic stable expression systems, such as Agrobacterium-mediated genetic transformation. However, genetic transformation in fruit trees typically requires a long culture period, resulting in lengthy experimental cycles and low efficiency, making it difficult to meet the needs of efficient gene function verification. In contrast, transient expression systems can achieve efficient gene expression in plant tissues within a short time and have been widely used in plants such as Arabidopsis thaliana and tobacco, but their application in apple fruits is still in the exploratory stage. Therefore, the establishment of a transient transformation system and gene function verification system for apple fruits will provide new technical support for the screening and application of insect-resistant genes in apples. Summary of the Invention
[0006] The present application aims at efficiently and accurately evaluating the influence of target genes on the growth and development of pests.
[0007] The present application firstly provides a method for screening genes resistant to boring pests of apple fruits, which is to analyze the expression changes of related genes after apple is damaged by boring pests through transcriptome analysis, to find out the pest resistance related genes from the biosynthesis pathway of secondary metabolites through expression analysis, and to screen out the differentially expressed genes related to boring pests from the genes.
[0008] Furthermore, the method uses fluorescence quantitative PCR detection method for expression analysis.
[0009] The present application also provides a method for verifying the pest resistance function of differentially expressed genes to boring pests of apple fruits, which comprises the following steps: 1) total RNA extraction and cDNA synthesis are performed on the studied apple; 2) the overexpression vector and the silencing vector of the tested gene are constructed by using the vector in the Gateway kit; 3) the recombinant vector is transformed into apple fruits by Agrobacterium mediation, and the gene expression is detected by RT-qPCR; 4) the overexpression line and the interference line after transformation are used as experimental fruits, and the untransformed fruits are used as control fruits, the larvae of boring pests are introduced into the fruits, the influence of the larvae on the growth and development, the fecundity and the mortality of boring pests is evaluated, and the function of the genes is verified.
[0010] The present application also provides a use of the screened genes, which is to improve the resistance of apple fruits to boring pests.
[0011] This invention improves screening efficiency by rapidly identifying functional genes resistant to apple borers, significantly enhancing screening effectiveness. The method is highly operable, employing the Gateway cloning system to construct expression vectors, making it simple, reproducible, and suitable for large-scale functional gene screening experiments. By directly inoculating transgenic apple fruits with insects and combining this with RT-qPCR analysis of gene expression levels, this invention achieves a combination of phenotypic and molecular validation, ensuring the accuracy and reliability of the screening results. It saves time and resources; compared to traditional field insect resistance identification, this method shortens the experimental cycle, reduces field trials and resource consumption, and improves experimental efficiency. It is applicable to research on various fruit pests, exhibiting good versatility. This method can be used not only to screen for resistance genes in apples against specific borers but can also be extended to research on other fruit trees or fruit crops and related pests. It provides theoretical support for the breeding of insect-resistant varieties; the resistance genes obtained through screening can provide reliable candidate gene resources and theoretical basis for subsequent apple insect-resistant breeding, demonstrating promising agricultural application prospects. Attached Figure Description
[0012] Figure 1 This is a graph showing the results of the upregulation pathways of Luli, Jonagold, and Venus gold KEGG enrichment after feeding by the codling moth in Example 2 of the present invention.
[0013] Figure 2 This is a heatmap of gene expression levels under different treatments provided in Example 2 of the present invention.
[0014] Figure 3 This is a schematic diagram of the apple perforation provided in Embodiment 4 of the present invention.
[0015] Figure 4 As provided in Embodiment 4 of the present invention CYP Gene expression levels after interference (left) and overexpression (right).
[0016] Figure 5 This is a flowchart of the instantaneous conversion provided in Embodiment 4 of the present invention.
[0017] Figure 6 The interference provided in Embodiment 4 of the present invention CYP The effects of genes on mortality rate, average weight, and average body length of codling moth larvae.
[0018] Figure 7 The overexpression provided in Embodiment 4 of the present invention CYP The effect of genes on mortality rate, average weight, and average body length of codling moth larvae is shown in the figure.
[0019] Figure 8 The three-headed codling moth (left) feeding on the 293 vector control apple provided in Example 4 of this invention and feeding overexpression CYPCarpophilic C. pomonella (right) morphological comparison chart of gene apple.
[0020] Figure 9 Carpophilic C. pomonella (left) and the interference CYP Carpophilic C. pomonella (right) morphological comparison chart of gene apple. DETAILED DESCRIPTION
[0021] The application will be further described below in conjunction with specific examples. In the following examples, the operations not described in detail are all routine biological experimental operations, which can be carried out with reference to the Handbook of Molecular Biology Experiments and existing published journal articles, etc., or according to the instructions of the reagent kit and product. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.
[0022] The Agrobacterium used in the application is GV3101, purchased from Shanghai Shengong Bioengineering Co., Ltd.; the E. coli competent cell OmniMAX2-T1 used is a competent cell, purchased from Bomeide Biological Company; the E. coli vector is pMD19-T, purchased from TaKaRa Company; the BP reaction entry vector is pDONR221 vector, which is a gift from Professor Zhang Jie and Professor Yao Yunceng of Beijing Agricultural University; the Gateway overexpression vector used is pH7FWG2-RR-293, which is a gift from Professor Zhang Jie and Professor Yao Yunceng of Beijing Agricultural University; the Gateway interference vector used is pK7GWIWG2(II)RR-277, which is a gift from Professor Zhang Jie and Professor Yao Yunceng of Beijing Agricultural University.
[0023] The plant material used in the examples of the application is apple (Malus domestica Borkh. Malus domestica ), apple carpophilic C. pomonella (Cydia pomonella L. Cydia pomonella The culture conditions are temperature (24±1)℃, relative humidity (75±5)%, and photoperiod L:D=16 h:8 h.
[0024] Example 1: Establishing a method for screening genes resistant to apple fruit boring pests The newly hatched larvae of C. pomonella were inoculated on the apples of the varieties of Luli, Jonagold and Venus Gold, 8 larvae per apple, and a plurality of apples were inoculated for each variety. Sampling was performed at 36h after inoculation. After sampling, the apple fruits were quickly frozen in liquid nitrogen and stored in a-80℃ refrigerator for standby. The sample numbers of each variety after sampling are shown in Table 1.
[0025] Table 1: Numbering information table of the samples used
[0026] The samples were sent to Shanghai Meiji Biomedicine Technology Co., Ltd. for eukaryotic reference transcriptome sequencing. The sample groups were: AJ2 vs. AJ3, AV2 vs. AV3, and AV2 vs. AV3. After RNA extraction from the samples, library construction, sequencing, and bioinformatics analysis were performed. Bioinformatics analysis first used a second-generation high-throughput sequencing platform to sequence the samples, and statistical methods were used to statistically analyze the base distribution and quality fluctuations of each sequencing cycle. Subsequently, quality control was performed on the raw sequencing data. After aligning the data with the reference genome, based on the expression matrix, PCA analysis between samples was performed to identify samples that had a greater impact on sample clusters. After obtaining the read counts of the genes, DESeq2 software was used to analyze the differential gene expression between different groups, and differentially expressed genes were identified, which were potential insect-resistant candidate genes. The screening threshold for differential analysis was set to |log2FC| ≥ 1, pvalue < 0.05. Finally, R scripts were used to perform KEGG PATHWAY enrichment analysis on the genes in the gene set, using Fisher's exact test.
[0027] Example 2: Screening of resistance genes by the method established in Example 1 KEGG enrichment analysis of up-regulated pathways in the three apples before and after the apple codling moth fed found that in Luli, 6 pathways were enriched, including Photosynthesis, Flavonoid biosynthesis, etc. Figure 1 In Jonagold, 17 pathways were enriched, including Flavonoid biosynthesis, Phenylpropanoid biosynthesis, Cutin, suberine and wax biosynthesis, Glutathione metabolism, etc. Figure 1 In Venus Gold, 20 pathways were enriched, including Flavonoid biosynthesis, Photosynthesis, Glutathione metabolism, MAPK signaling pathway - plant, etc. Figure 1
[0028] KEGG enrichment analysis of the transcriptome showed that the cutin, suberine and wax biosynthesis pathway was significantly enriched in Jonagold and Luli, but not in Venus Gold after the codling moth fed on three apple varieties (Luli, Jonagold, Venus Gold). As an important barrier for plant defense, cutin, suberin and wax substances usually achieve the strengthening of epidermal structure and barrier function by regulating related metabolic pathways. However, in the three apple varieties, the expression of related pathway genes was generally low, and only individual genes in Jonagold apple were slightly up-regulated after being fed, suggesting that the response of this pathway was limited or the reaction time lagged under the condition of early or light feeding of the codling moth.
[0029] By Figure 2 Further analysis was carried out on all genes enriched in this pathway, among which CYP The gene was significantly up-regulated in Jonagold. Among them CYP The amino acid sequence of the protein encoded by the gene is as follows: MEASMALMILSAIAAYLIWFKMISRSMYGPRVWPVVGSLPGLIQNVNRMHDWIADNLRACCGTYQTCTCAIPFLARKQGLVTVTCDPKNLEHILKLRFDNYPKGPTWQAVFHDLLGDGIFNSDGDTWLFQRKTAALEFTTRTLRQAMARWVSRAIELRFCPILETAQNEAKPVDLQDLLLRLTFDNICGLAFGKDPQTLAPGLPENEFANAFDRATEATLQRFILPEIIWKFKKWLGLGMEVSLNHSLHHIDKYLSAIIDARKLELESQQQGLCNGTPHDDLLSRFMKKNSYSDKFLQEVALNFILAGRDTSSVALSWFFWLVIQNPQVEEKILSEICTVLMEARGSDTSKWVKEPLFFEEVDRLTYLKAALSETLRLYPSVPQDSKQTIKDDVLPSGTFVPAGSSITYSIYAIGRMKFIWGEDCLEFKPERWLSSDGKKMEAQDSYKFVSFNAGPRICLGKDLAYLQMKSIAAAVLLRHRLAVVPGHRVEQKMSLTLFMKYGLRVNVHPRDLTPLLAKIGKGDQCGKEDVDIVV (SEQ ID NO: 1).
[0030] One of its nucleotide sequences is as follows:
[0031] Example 3: Transfection of apple fruit with resistance candidate genes using the Gateway system The RNA was extracted from fresh Jonagold fruit using the Norgen FastPure Universal Plant Total RNA Isolation Kit (RC411-01) kit according to the manufacturer's instructions. The RNA product was stored at -80°C after determining the concentration.
[0032] The RNA was used to synthesize cDNA using the TaKaRa PrimeScript® RT reagent Kit with gDNA Eraser according to the manufacturer's instructions.
[0033] 1.CYP Gene sequence Design of specific primer pairs CYP The gene was amplified by PCR cloning, and the primer sequences were as follows: CYP _OE_F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGGCATCAATGGCTT CYP _OE_R: GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAACCACAATATCGACGTCT 2. PCR amplification and gel recovery of the target fragment ① The PCR amplification reaction was performed, and the amplification system and reaction conditions are shown in Table 2 and Table 3.
[0034] Table 2: PCR amplification reaction system
[0035] Table 3: CYP PCR amplification reaction conditions table
[0036] ② The PCR product was detected by agarose gel electrophoresis and the fragment size was observed in the gel imaging system.
[0037] ③ The PCR product was recovered using the Norgen FastPure Gel DNA Extraction Mini Kit (DC301-01) according to the manufacturer's instructions. The recovered product was stored at -20°C after determining the concentration.
[0038] 3. Connect the target fragment into pMD19-T vector ①According to the pMD19-T vector instructions, connect the purified target fragment to the pMD19-T vector.
[0039] ②The ligation product was detected by agarose gel electrophoresis and the fragment size was observed in the gel imaging system.
[0040] 4. Gateway cloning to construct overexpression vector and silencing vector ①Use TIAN prep Mini Plasmid Kit kit to extract the target vector plasmid, refer to the instructions for specific steps.
[0041] ②Design overexpression and interference primers with attB sites, primer sequences as follows: Overexpression primers: CYP _OE_F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGGCATCAATGGCTT, CYP _OE_R: GGGGACCACTTTGTACAAGAAAGCTGGGTATCAAACCACAATATCGACGTCT.
[0042] Interference primers: CYP _RNAi_F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCTGTGCCATTCCCTTCCT, CYP _RNAi_R: GGGGACCACTTTGTACAAGAAAGCTGGGTAGATTTCAGGCAAGATAAAGCGT.
[0043] ③Obtain overexpression and interference PCR products containing attB sites by attb-PCR amplification, the reaction system is shown in Table 4.
[0044] Table 4: Reaction system table
[0045] ④The PCR product was detected by agarose gel electrophoresis and the fragment size was observed in the gel imaging system.
[0046] ⑤Use Thermo Fisher Gateway® BP Clonase™ II Enzyme Mix kit to perform BP reaction, connect into the gateway vector pDONR221, refer to the instructions for specific reaction steps.
[0047] 6. Perform bacterial liquid PCR identification on the cloned colonies to determine whether the target gene is successfully cloned into the vector.
[0048] 7. Perform LR reaction using the Gateway® LR Clonase™ II Enzyme Mix kit from Thermo Fisher Scientific to connect the Gateway overexpression vector pH7FWG2-RR-293 and the silencing vector pK7GWIWG2(II)RR-277. Refer to the instructions for specific reaction steps.
[0049] 8. After expanding the bacterial liquid, extract the plasmid using the Plasmid Miniprep Kit (DP103) from Tiangen Biosciences Co., Ltd. Refer to the instructions for specific methods.
[0050] 5. Agrobacterium-mediated transformation of recombinant vectors 1. Transfer the plasmids obtained from the above reaction construction and the plasmids extracted from the pH7FWG2-RR-293 and pK7GWIWG2(II)RR-277 empty vectors into GV3101 Agrobacterium competent cells. Refer to the GV3101 competent cell instructions for specific steps.
[0051] 2. Expand the bacterial liquid to an OD600 of around 1.0. Prepare the infection solution in a ratio of 200 µM AS + 10 µM MES + 10 µM MgCl2, add the bacterial liquid to the infection solution, and control the OD600 to around 1.0.
[0052] 3. Take fresh Jonagold apple fruits of the same size and shape at the same time, use a sterilized toothpick to make holes on the apple surface, make three 4.5 cm deep holes in the calyx, and make two 1 cm deep shallow holes on both sides of each deep hole (0.5-1.0 cm apart). Figure 3 .
[0053] 4. Use a 1 ml sterile syringe to inject the transformed Agrobacterium infection solution into the apple fruit, inject 100 µl into the deep hole and 50 µl into the shallow hole, complete the transient transformation of the apple fruit ( Figure 2 ).
[0054] 5. Place the injected apples in the optimal conditions (temperature (24±1) ℃, relative humidity (75±5)%, photoperiod L:D=16 h:8 h), after 48 h of treatment, sample the apples within 1 cm of the injection hole, quickly place them in liquid nitrogen, and store them at -80℃ for real-time fluorescent quantitative PCR detection.
[0055] 6. RT-qPCR detection of gene expression ① RNA extraction of sampling samples was performed using the Tengen RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit (DP441) kit, and the specific steps were referred to the instruction manual. The RNA product was determined for concentration and then stored at -80°C.
[0056] ② cDNA synthesis was performed on the extracted RNA using the TaKaRa kit PrimeScript® RT reagent Kit with gDNA Eraser, and the specific steps were referred to the instruction manual.
[0057] ③ Fluorescent quantitative primers were designed, and the primers were as follows: Md CYP _F: AGGCTTTACCCTTCTGTTCCAC Md CYP _R: ATGCGACCGATTGCGTAGAT The internal reference primers were as follows: Md_actin11-F: CTGAACCCAAAGGCTAATCG Md_actin11-R: ACTGGCGTAGAGGGAAAGAA ④ The fluorescent quantitative PCR reaction system was as shown in Table 5. Table 5: Fluorescent quantitative PCR reaction system table
[0058] The reaction condition was 95°C pre-denaturation for 30 s, 95°C denaturation for 5 s, 60°C annealing and extension for 30 s, 40 cycles; the reaction was warmed up at a speed of 0.6°C / s.
[0059] ⑤ Identification of interference and overexpression CYP gene expression levels. From Figure 4 the qRT-PCR detection, it was shown that, 48 h after injection of the interference bacterial liquid, the expression levels of the genes in the apples appeared significant differences (P<0.05), which indicated that, from the mRNA level, the expression of the genes was effectively inhibited; 72 h after injection of the overexpression bacterial liquid, CYP CYP CYP CYP CYP CYP
[0060] Example 4: Inoculation of boring larvae, and method for evaluating the function of apple pest resistance candidate genes on pests One hour after injecting the interference and overexpression infection solution described in Example 3, three newly hatched codling moth larvae were inserted into three deep holes using a sterile paintbrush. Each treatment involved a total of 12 apples ( Figure 5 ).
[0061] After the apples that had been injected and inoculated with insects were placed under optimal conditions (temperature (24±1)℃, relative humidity (75±5)%, photoperiod L:D=16 h:8 h) for 9 days, the inoculated apples were dissected and the mortality rate, weight, body length and other indicators of codling moth larvae were recorded and measured.
[0062] From the mortality rate of codling moth larvae ( Figure 6 , Figure 7 As can be seen, the difference in larval mortality between the experimental group and the control group after interference and overexpression was not statistically significant (P>0.05).
[0063] From the weight of codling moth larvae ( Figure 6 , Figure 7 As can be seen, the body weight of the larvae in the experimental group after interference was significantly different from that in the control group (P<0.01), increasing by approximately 247.22%, indicating that interference... CYP Genes can influence larval growth. Overexpression significantly reduced the body weight of larvae in the experimental group (P<0.05), by approximately 56.05%, indicating... CYP Gene overexpression affects larval weight.
[0064] From the body length of the codling moth larva ( Figure 6 As can be seen, the body length of the larvae in the experimental group was significantly different from that in the control group after interference (P<0.01), increasing by approximately 77.3%, further supporting this finding. CYP Hypothesis of insect resistance by genes.
[0065] from Figure 8 It can be clearly seen from the above that overexpression CYP After gene modification, the codling moth larvae grew more slowly and were smaller in both weight and length compared to the control group; from Figure 9 It can be seen that interference CYP After gene therapy, the codling moth larvae grew faster than the control group, and their weight and body length were larger.
[0066] The results of the qRT-PCR experiment showed CYP After gene interference, its expression level was significantly reduced; CYP After gene overexpression, its expression level increases significantly. This, combined with interference and overexpression... CYP The results of gene bioassays fully demonstrate the interference. CYP Genes that reduce the insect resistance of apples favor the growth of larvae; while overexpression CYPThe gene enhances the insect resistance of the apple, causes the growth of the larvae to be limited, and exhibits obvious insect resistance function.
[0067] The above results show that CYP Insect resistance of the gene in Jonagold apple. The results show that, CYP Down-regulation of the gene is beneficial to the growth of the larvae, and overexpression of the gene inhibits the growth of the larvae. It is shown that the expression change of the gene is highly related to the insect resistance trait, and the functional verification result in the biological assay is clear, the gene has the potential to become an excellent target for molecular breeding of apple insect resistance, and provides a theoretical basis and application reference for subsequent construction of new apple insect-resistant varieties.
[0068] The application provides an insect-resistant gene function verification method based on transient transformation of apple fruit, which combines Agrobacterium-mediated gene transformation, Gateway cloning method, real-time fluorescent quantitative PCR (qRT-PCR) detection and pest bioassay, and can evaluate the influence of the insect-resistant candidate gene in the fruit on the growth and development of pests in a short time. The method of the application can effectively improve the efficiency of the apple insect-resistant gene function research, overcome the problems of long cycle and complex operation of the traditional transgenic method, and provide a new research idea and technical means for apple insect resistance improvement and green control of fruit tree pests.
Claims
1. A method for screening genes resistant to fruit-boring pests of apples, characterized in that, The method described uses transcriptome analysis to examine the changes in gene expression in different apple varieties after being attacked by the codling moth. Through expression level analysis, insect resistance-related genes are identified from the biosynthetic pathways of cuticle, sub-wax, and wax, and differentially expressed genes related to codling moth damage are screened out from these genes.
2. The method as described in claim 1, characterized in that, The expression level was analyzed using quantitative real-time PCR.
3. A method for verifying the insect resistance function of a gene against fruit-boring pests, the method comprising the following steps: 1) Total RNA extraction and cDNA synthesis were performed on the apples to be studied; 2) Gateway vectors were used to construct overexpression and silencing vectors for the target genes; 3) The recombinant vector was transformed into apple fruit via Agrobacterium-mediated transformation, and gene expression was detected by RT-qPCR; 4) The overexpression and interference strains were used as experimental fruits, and the untransformed fruits were used as control fruits. Larvae were introduced into the fruits to evaluate their effect on the growth and development of the boring pests and to verify the gene function.
4. A gene for resistance to apple fruit-boring pests, selected by the method of claim 1, characterized in that, The gene described above encodes a protein with the amino acid sequence SEQ ID NO:
1.
5. The gene as described in claim 4, characterized in that, The nucleotide sequence of the gene is SEQ ID NO:
2.
6. The application of the gene described in claim 4 in improving the resistance of apple fruits to borer pests.
7. A method for improving the insect resistance of apples, characterized in that, The method described herein is to increase the expression level of the gene described in claim 4 in apples.
8. The method as described in claim 7, characterized in that, The method involves introducing an expression vector into an apple that can recombinantly express the gene described in claim 4.
9. A method for screening apple parents resistant to borer pests, characterized in that, The method described is to screen individuals with higher gene expression levels as described in claim 4.
Citation Information
Patent Citations
Method for regulating and controlling plant drought resistance and application of MdCYP86A4 in regulating and controlling plant drought resistance
CN118562859A
Apple laccase LAC3 gene and application thereof in improving aphid resistance of plants
CN119193509A
Method for screening and identifying cucumber aphid-resistant gene as well as screened gene and application thereof
CN120138109A
Application of GhRPS20B gene in improvement of insect resistance of cotton bollworm and insect-resistant breeding
CN120173999A