Method, two-dimensional PCR reaction system and kit for single-tube rapid screening of various vancomycin drug-resistant genes of microorganisms

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to a method, a two-dimensional PCR (polymerase chain reaction) system and a kit for rapidly screening various vancomycin-resistant genes of microorganisms in a single tube. According to the invention, a one-tube quintuple detection method based on two-dimensional PCR is used for screening the vancomycin drug-resistant gene for the first time, and is combined with a convenient nucleic acid extraction method to form a detection method capable of directly screening the vancomycin drug-resistant gene of a collected sample or separated bacteria in a clinical microbiological laboratory; the time from sampling to reporting can be greatly shortened, the reporting efficiency is greatly improved, and key information is provided for clinical early diagnosis, treatment and hospital infection control.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological detection, and particularly relates to a method for rapidly screening multiple vancomycin-resistant genes of microorganisms in a single tube, a two-dimensional PCR reaction system and a kit. BACKGROUND

[0002] Enterococcus (especially Enterococcus faecalis and Enterococcus faecium) often causes urinary tract infection, prostatitis, bacteremia, endocarditis, etc. in clinic, is a gram-positive coccus, and is also an important pathogen causing nosocomial infection. Vancomycin plays an irreplaceable role in the treatment of clinical gram-positive bacterial infections, especially Enterococcus infection. It effectively suppresses the reproduction and spread of bacteria by precisely inhibiting bacterial cell wall synthesis. Since vancomycin was introduced, it has made remarkable achievements in saving the lives of infected patients and has become one of the cornerstone drugs for the treatment of severe bacterial infections. However, with the widespread clinical application, the emergence and spread of vancomycin-resistant Enterococcus in Enterococcus have brought great challenges to clinical anti-infection treatment. So far, nine gene clusters that can mediate Enterococcus resistance to vancomycin have been identified, namely: vanA, vanB, vanC, vanD, vanE, vanG, vanL, vanM, and vanN. Among them, vanC is located on the chromosome and cannot be transmitted by mobile genetic elements, while the remaining eight gene variants belong to acquired drug resistance genes and can be transmitted between bacteria.

[0003] The World Health Organization (WHO) has listed vancomycin-resistant Enterococcus (VRE) as a "high priority pathogen". European monitoring data shows that the incidence of invasive VRE infection has been rising from 2018 to 2022, and the multi-drug resistance of Enterococcus faecium is significantly higher than that of Enterococcus faecalis. Enterococcus infection in Asia presents two major characteristics. First, the dominant species of nosocomial infection has changed, i.e., traditionally dominated by Enterococcus faecalis (accounting for 85% to 95%), but in recent years, the proportion of Enterococcus faecium has increased significantly (up to 30% to 60% in China), and its multi-drug resistance is more severe. Second, the regional differences in drug resistance genes are significant, i.e., vanB type accounts for a rising proportion in East Asia, while vanM type shows an increasing trend in strains in South Asia. VanA, vanB, and vanM have been reported in China, and vanB accounts for more than 80% in some hospitals.

[0004] In clinical practice, accurate, simple, and rapid detection of vancomycin-resistant genes is of great significance for guiding the rational use of antibiotics, controlling the spread of drug-resistant strains, and improving patient outcomes. By identifying drug-resistant strains in a timely manner, clinicians can quickly adjust treatment plans, avoid the use of ineffective antibiotics, and improve treatment outcomes while reducing the risk of further development of drug resistance. Traditional vancomycin-resistant gene detection methods, such as phenotypic detection and conventional PCR techniques, have many limitations. Phenotypic detection usually requires a long incubation time and cannot provide results in a timely manner, which may delay treatment opportunities. While conventional PCR methods have certain sensitivity and specificity, they often involve complex nucleic acid extraction steps, high reagent costs, and long detection periods, making it difficult to meet the urgent needs of rapid clinical detection.

[0005] To overcome the shortcomings of traditional detection methods, researchers have been working to develop new detection techniques in recent years. These new techniques focus on detection speed, ease of operation, and cost-effectiveness, in addition to high sensitivity and specificity. Two-dimensional PCR technology is developed based on probe-based gene amplification technology, which can detect multiple target genes in a single tube using only one probe by detecting fluorescence signals and melting temperatures. The basic principle is to design a fluorescently labeled probe and add a tag sequence to the 5' end of the specific primer that can be used to identify the probe. By changing some bases on the tag sequence, different target gene products can be given unique melting temperatures, allowing effective differentiation between different target genes, and a single fluorescence channel can detect multiple target genes Figure 1 In 2020, Yuxia Zhan et al. developed a single-tube method to detect nine HPV subtypes and a reference gene using two-dimensional PCR. In 2022, Wenwen Zhu et al. developed a method to detect three major integrations simultaneously based on two-dimensional PCR. In 2024, Xuan Wu et al. developed a method to detect four microorganisms in feces using two-dimensional PCR. Two-dimensional PCR technology has significant advantages over traditional probe-based PCR technology. It can achieve single-tube multiplex detection with only one probe, greatly reducing detection costs, and the cost and detection performance are comparable to probe-based PCR technology. However, so far, no researchers have developed a method to detect multiple vancomycin-resistant genes simultaneously based on two-dimensional PCR. This study focuses on developing a one-tube five-reagent vancomycin-resistant gene screening method based on two-dimensional PCR, focusing on the five gene clusters with the highest detection rate and the most important vancomycin-resistant genes (vanA, vanB, vanC, vanD, vanM). The goal is to provide a fast, efficient, and cost-effective detection tool for clinical laboratories to address the challenges posed by vancomycin resistance and provide strong support for accurate clinical diagnosis and treatment.

[0006] Currently, there are still disadvantages in the method for detecting drug resistance genes of clinically isolated bacteria in clinical laboratories. Usually, the strains isolated by the microbiology laboratory need to be transferred to a gene amplification laboratory for detection of drug resistance genes, which undoubtedly increases the detection link and wastes valuable time. The present study expects to develop a new rapid solution by combining a convenient nucleic acid extraction method with a one-tube five-replicate vancomycin resistance gene detection method based on two-dimensional PCR to form a detection method that can directly screen vancomycin resistance genes of collected samples or isolated bacteria in clinical microbiology laboratories, and can control the time from sampling to reporting within 90 minutes, greatly improving the reporting efficiency and providing key information for early clinical diagnosis, treatment and hospital infection control. SUMMARY

[0007] To solve the above problems, the present application first establishes a simple and efficient nucleic acid extraction method, i.e. mixing 0.35mm zirconium oxide beads into a special lysis buffer (containing SDS, EDTA, Tris-HCl (pH 8.0) and proteinase K) developed by the present application, mixing the sample swab, and using 36.82Khz ultrasonic wave for 3 minutes to quickly extract the strain genome for performance evaluation and verification and subsequent experiments. Thereafter, primers and probes for vanA, vanB, vanC, vanD and vanM five vancomycin resistance genes are designed respectively, and two-dimensional PCR amplification is used to detect vancomycin resistance genes of clinically isolated Enterococcus faecium samples, and the reliability and accuracy of the method are verified. The present application combines a convenient nucleic acid extraction method with a one-tube five-replicate vancomycin resistance gene detection method based on two-dimensional PCR to form a detection method that can directly screen vancomycin resistance genes of collected samples or isolated bacteria in clinical microbiology laboratories, and provides key information for early clinical diagnosis, treatment and hospital infection control.

[0008] Specifically, in the first aspect, the present application provides a two-dimensional PCR reaction system for single-tube rapid screening of multiple vancomycin resistance genes of microorganisms, which comprises a universal detection probe and specific forward primers and reverse primers for each vancomycin resistance gene. Each of the forward primers has a two-dimensional coding tag complementary to the universal detection probe, and the degree of complementarity of the two-dimensional coding tag of each forward primer to the universal detection probe is different from each other, so that each vancomycin resistance gene corresponds to a different melting temperature.

[0009] The different degrees of complementarity of the two-dimensional coding tags of each forward primer as described herein to the universal detection probe from each other means that the two-dimensional coding tags carried by different forward primers can each be fully complementary to the universal detection probe or have one or more base mismatches (for example, generated by base variation in the coding tag sequence that is fully complementary to the universal detection probe), whereby the target gene products amplified by different forward primers can have unique melting temperatures.

[0010] Further, the two-dimensional PCR reaction system is used for simultaneously detecting vancomycin-resistant genes vanA, vanB, vanC, vanD and vanM in a single tube.

[0011] Further, the nucleotide sequence of the primer for detecting the vanA gene is:

[0012] vanA-F: CCATTACACTTGCTATACACTTCCACCCGTTTCCTGTATCCGTCCTC

[0013] vanA-R: GGCTGTTTCGGGCTGTGA;

[0014] The nucleotide sequence of the primer for detecting the vanB gene is:

[0015] vanB-F: CCATTACAGATGCTATACACTTCCACATTGCTGCGAACATTGATACGG

[0016] vanB-R: GAGACTGTCGGCTTCCCATT;

[0017] The nucleotide sequence of the primer for detecting the vanC gene is:

[0018] vanC-F: CCATTACACATCCTATACACTTCCACTGACAAATCAAGCCAACC

[0019] vanC-R: GCACTGCGGAACAATAAG;

[0020] The nucleotide sequence of the primer for detecting the vanD gene is:

[0021] vanD-F: CCATTACACTTCCTATACACTTCCACCGGCATTCCTT ATGTGGG

[0022] vanD-R: CTGCTTTCAGGCTGTCCC;

[0023] The nucleotide sequence of the primer for detecting the vanM gene is:

[0024] vanM-F: CCATTACTCATGCTATATACTTCCACCGGCAGATTCG TTTACCT

[0025] vanM-R: GGCAACCGACCTCATA;

[0026] The nucleotide sequence of the universal detection probe is: CCATTACCAACCTTATACACTTCCAC.

[0027] Further, the 5' of the universal detection probe is connected with a fluorescent group and the 3' is blocked by a phosphate group.

[0028] Further, the fluorescent group includes FAM, HEX, Cy3, Cy5, ROX or Alexa Fluor.

[0029] Further, the two-dimensional PCR reaction system further comprises PCR buffer, dNTP, DNA polymerase and magnesium ion.

[0030] Further, the concentration of each forward primer in the two-dimensional PCR reaction system is 0.04 μM.

[0031] Further, the concentration of each reverse primer in the two-dimensional PCR reaction system is 0.24 μM.

[0032] Further, the concentration of the universal probe in the two-dimensional PCR reaction system is 0.12 μM.

[0033] Further, the concentration of magnesium ion in the two-dimensional PCR reaction system is 1.5 mM.

[0034] In a second aspect, the present application provides a kit for single-tube rapid screening of multiple vancomycin-resistant genes of microorganisms, comprising a two-dimensional PCR reaction system as described herein.

[0035] In a third aspect, the present application provides a method for single-tube rapid screening of multiple vancomycin-resistant genes of microorganisms, comprising the following steps:

[0036] (1) providing a sample comprising a microorganism to be tested;

[0037] (2) obtaining a nucleic acid sample of the microorganism to be tested in the sample;

[0038] (3) performing a PCR amplification reaction on the nucleic acid sample using a two-dimensional PCR reaction system or kit as described herein;

[0039] (4) The melting curve analysis is performed on the product after the PCR amplification reaction, and different melting curves correspond to different vancomycin resistance genes.

[0040] Further, the step (2) of obtaining the nucleic acid sample of the microorganism to be tested in the sample comprises the following steps: mixing the sample with a lysis buffer and 0.1-0.5mm diameter zirconium oxide beads, vortexing for 1-5 minutes, then performing ultrasonic treatment, centrifuging to collect the supernatant, and obtaining the nucleic acid sample of the microorganism to be tested.

[0041] Further, the lysis buffer comprises 20mM Tris-HCl, 2mM EDTA, 1.2% SDS and 0.05-0.2mg / mL proteinase K and pH=8.0.

[0042] Further, the ultrasonic treatment has an ultrasonic frequency of 36.82Khz and a treatment time of 2-3min, preferably 150s.

[0043] Further, the nucleic acid sample of the microorganism to be tested is a genomic DNA sample of the microorganism to be tested.

[0044] Further, the sample containing the microorganism to be tested can be a human body fluid or excrement sample containing the microorganism to be tested.

[0045] Further, the human body fluid includes blood, urine or saliva.

[0046] Further, the excrement includes feces.

[0047] Further, the sample containing the microorganism to be tested can also be a sample containing the microorganism to be tested after amplified culture.

[0048] Further, the microorganism to be tested after amplified culture is derived from a human body fluid or excrement sample containing the microorganism to be tested.

[0049] Further, the plurality of vancomycin resistance genes includes vancomycin resistance genes vanA, vanB, vanC, vanD and vanM.

[0050] Advantages of the present application

[0051] The present application successfully develops a single-tube five-reagent vancomycin resistance gene nucleic acid extraction-free rapid screening method based on two-dimensional PCR, which combines the nucleic acid extraction technology of zirconium oxide beads and ultrasonic wall breaking and the optimized two-dimensional PCR detection system. The method has significant advantages in nucleic acid extraction efficiency and detection performance: the nucleic acid extraction time is shortened to 3 minutes, and the extraction efficiency is improved by 3.2 times compared with the traditional column extraction method; the detection sensitivity is high, and the minimum detection limit reaches 10 1 ~103 The method achieves a specificity of 100% (copies / μL). Furthermore, it exhibits high consistency with sequencing results (Kappa value of 0.73, P<0.05), indicating high accuracy and reliability in clinical sample testing. This method is simple to operate, low in cost, and can simultaneously detect five vancomycin resistance genotypes, making it suitable for rapid screening of clinical samples. This invention provides an efficient and economical solution for rapid clinical diagnosis of vancomycin resistance mechanisms, guiding rational antibiotic use, and monitoring nosocomial infections, demonstrating significant clinical application value and promising prospects for wider application. Attached Figure Description

[0052] Figure 1 Schematic diagram of the principle of 2D-PCR single-tube multi-target amplification. A. Composition of 2D-PCR amplification system; B. Composition of amplification products; C. Differential melting peaks formed due to mutation after the probe binds to the amplification products.

[0053] Figure 2 Comparison of results between zirconia bead ultrasonic extraction and centrifugal column extraction. A. Electrophoresis diagram of PCR verification of 5 plasmids; B. Electrophoresis diagram of amplification products of three Enterococcus faecalis strains carrying vanM, vanA, and vanA resistance genes (95 / 55 / 9) extracted by column purification and zirconia + ultrasonic methods; C. Schematic diagram of vancomycin resistance gene positive plasmid construction; D. Bar chart comparison of Enterococcus faecalis nucleic acid concentration extracted by column purification and zirconia + ultrasonic methods. Figure 2 In diagram D, the vertical axis represents nucleic acid concentration; the horizontal axis, from left to right, represents "column-purified extract" and "ultrasonic extract," respectively.

[0054] Figure 3 Figure 1 shows the melting curves of five vancomycin resistance genes after amplification at different dissociation temperatures. Figures A through E show the melting curves of vanA, vanB, vanC, vanD, and vanM at dissociation temperatures of approximately 52°C, 48°C, 65°C, 58°C, and 42°C, respectively. Figure F shows the melting curves of the five target genes amplified simultaneously.

[0055] Figure 4 : Amplification melting curves for two-dimensional PCR primer specificity verification. A to E represent the specificity verification results of primers for vanA, vanB, vanC, vanD, and vanM, respectively.

[0056] Figure 5 Optimization and validation results of unlabeled primer usage. Figures A-E show the melting curves for unlabeled primers (vanA, vanB, vanC, vanD, and vanM), respectively. When the total reaction volume was 25 μL, the optimal amount of unlabeled primer for each primer was 0.6 μL.

[0057] Figure 6 Optimization and verification results of labeled primers. Figures A-E are the verification melting curves of labeled primers for vanA, vanB, vanC, vanD and vanM, respectively. The optimal amount of labeled primer for each primer is 0.1 μL when the total volume of the reaction is 25 μL.

[0058] Figure 7 Different concentrations of probes and Mg 2+ Melting curves after amplification. Figure A is the melting curve after amplification of different concentrations of probes (the optimal concentration is 0.3 μL in a 25 μL system); Figure B is the melting curve after amplification of different concentrations of Mg 2+ ( the optimal concentration is 1.5 μL in a 25 μL system).

[0059] Figure 8 Detection limit verification melting curves for 5 target genes. Figures A-E correspond to the melting curves for vanA, vanB, vanC, vanD and vanM, respectively. The arrow indicates the amplification melting curve at the lowest detection concentration. The detection limits are: 10 3 , 10 2 , 10 3 , 10 1 and 10 1 copies / μL, respectively.

[0060] Figure 9 Vancomycin-resistant gene single-tube 5-reaction 2D-PCR amplification and melting curve. A. Single-tube amplification melting curve for 5 targets; B. Clinical sample detection results, in which yellow represents the positive control, blue represents the negative control and the blank control.

[0061] Figure 10: Schematic diagram of the clinical detection scheme of vancomycin resistance gene, the English annotations are as follows; Left: Sample collection, Blood, Urine, Swab, Sputum; Middle: Sample processing and nucleic acid extraction, Bacterial culture, Enrichment culture, Extract DNA, Zirconia beads, Extraction tube, Ultrasonic generator; Right: RT-PCR, Amplification detection; The whole process takes about 2 days at least (the upper whole process takes about 2 days); The whole process takes about 90 minutes (the lower whole process takes about 90 minutes). DETAILED DESCRIPTION

[0062] The present application will be further described in conjunction with specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the technical field.

[0063] Example 1: Obtain nucleic acid sample of microorganism to be tested

[0064] Strain collection and nucleic acid DNA extraction: 105 strains of vancomycin-resistant Enterococcus faecium (VREfm) were collected from the specimens of patients treated in a Grade III Class A comprehensive hospital in Guangdong Province and Shanghai Fengxian District Central Hospital from January 2022 to April 2024, and all strains were confirmed by matrix-assisted laser desorption ionization time-of-flight mass spectrometer (MALDI-TOF) and automatic microorganism identification and drug sensitivity system VITEK 2 COMPACT for bacterial identification and drug sensitivity detection. The genomic DNA of the 105 strains of Enterococcus faecium was extracted using Ezup column bacterial genomic DNA extraction kit (B518255-0100) of Shengong Bioengineering (Shanghai) Co., Ltd.

[0065] A new method for bacterial nucleic acid extraction was established: the Enterococcus bacteria in the logarithmic growth phase were collected and precipitated, resuspended in 200 μL of lysis buffer containing SDS (20 mM Tris-HCl, 2 mM EDTA, 1.2% SDS, 0.1 mg / mL proteinase K, pH 8.0). 0.35 mm diameter zirconium oxide beads (about 100 mg) were added, and the bacteria were first broken up by vortexing at a maximum speed of 2500 rpm for 2 minutes. Then the sample tube was placed in the sample hole of the ultrasonic crusher, set at a frequency of 36.82 kHz, 70% amplitude, and treated with ultrasound for a total of 150 seconds in continuous mode to enhance lysis by cavitation effect. After lysis, centrifugation was performed at 4°C and 4000 rpm for 5 minutes. The supernatant was carefully aspirated, which was the crude extract containing total nucleic acid, and could be directly used for PCR. The concentration and purity of the nucleic acid were detected by NanoDrop, and the integrity was verified by 1% agarose gel electrophoresis.

[0066] In clinical applications, 0.35 mm zirconium oxide beads were mixed into the lysis buffer containing SDS, EDTA, Tris-HCl (pH 8.0) and proteinase K, and after mixing with blood or saliva samples obtained from patients, the genomic DNA of microorganisms in the samples was rapidly extracted by ultrasonic treatment at 36.82 kHz for 3 minutes as described above.

[0067] In this experiment, the efficiency of zirconium oxide bead combined ultrasonic extraction and centrifugal column method for extracting nucleic acid from Gram-positive bacteria was compared. The average concentration of nucleic acid obtained by zirconium oxide bead combined ultrasonic extraction was significantly higher than that by centrifugal column method (P<0.0001) as detected by NanoDrop. In terms of purity, the purity of nucleic acid extracted by the two methods was within the acceptable range. In terms of extraction time, the average time of zirconium oxide bead combined ultrasonic extraction was significantly shorter than that of centrifugal column method. In addition, the coefficient of variation (CV) was calculated for repeated extraction experiments on the same batch of samples, and the CV value of zirconium oxide bead combined ultrasonic extraction was lower, showing better repeatability. Figure 2 In summary, zirconium oxide bead combined ultrasonic extraction is superior to centrifugal column method in terms of nucleic acid concentration, purity, extraction time, repeatability, etc. when extracting nucleic acid from Gram-positive bacteria.

[0068] Example 2: Construction and verification results of plasmid containing five vancomycin resistance genes

[0069] The complete gene sequences of five common vancomycin resistance genes (vanA, vanB, vanC, vanD and vanM) were obtained from GenBank, with accession numbers CP111713, KT003982, NC_020995, NG_048362 and NZ_CP038997, respectively. The vanA, vanB, vanC, vanD and vanM gene templates were prepared by full gene synthesis by GenScript Biotech (Shanghai) Co., Ltd., and were cloned into the pUC57 plasmid using homologous recombination. The recombinant plasmids were transformed into the DH5a strain, and then the SanPrep column plasmid DNA small-scale extraction kit (B518191-0100) was used to extract the plasmids containing the vancomycin resistance genes for sequencing, and probes and corresponding primers were designed for verification. The ordinary PCR products of the five plasmids were confirmed by agarose gel electrophoresis, and the sequencing results of the amplification products were compared with the complete sequences of the five vancomycin resistance genes to verify whether the plasmids were correctly constructed. The probe and primer sequences used in this study are shown in Table 1, in which the two-dimensional code tag sequence is shown in bold, and the base variation in the two-dimensional code tag sequence is shown underlined.

[0070] Table 1:

[0071]

[0072]

[0073] In this study, using homologous recombination technology, we successfully constructed plasmids containing five vancomycin resistance genes (vanA, vanB, vanC, vanD and vanM) using the pUC57 plasmid as a vector. The recombinant plasmids were transformed into the DH5a strain to facilitate subsequent plasmid extraction and verification. The SanPrep column plasmid DNA small-scale extraction kit (B518191-0100) was used to extract plasmid DNA from the transformed strain. The extracted plasmid DNA was confirmed by agarose gel electrophoresis, showing the expected PCR product band Figure 2 ). The correctness of the plasmid construction was further verified by sequencing the amplification products, and the sequencing results completely matched the original vancomycin resistance gene sequences. The construction of these plasmids provides reliable genetic resources for subsequent vancomycin resistance research.

[0074] Example 3: Establishment of two-dimensional PCR reaction system and primer specificity verification results

[0075] Two-dimensional PCR technology can realize single-tube multiplex detection by designing primers with specific tag sequences, so that the amplification products of different target genes have unique melting temperatures. In this study, we mutated several bases in the probe complementary sequence (see Table 1), so that different vancomycin-resistant genes have different melting temperatures.

[0076] The establishment and verification of the two-dimensional PCR reaction system were carried out on a LightCycler 480II real-time fluorescent quantitative PCR instrument (Roche, Germany). To ensure the specificity and reliability of the subsequent two-dimensional PCR (2D-PCR), single-plex PCR verification was first performed for each target gene to confirm that the specific primer pair could effectively amplify the target fragment, and the corresponding probe could successfully detect the amplification product. Based on the single-plex verification results, a preliminary two-dimensional PCR reaction system was established, with a total volume of 25 μL, mainly containing the following components: 10×PCR buffer (without Mg 2+ ), 25 mM MgCl2 solution, 4×dNTPs mixture, Taq HS DNA polymerase (5 U / μL), target gene-specific probe (10 μM), target gene-specific forward primer with two-dimensional coding tag (10 μM), target gene-specific reverse primer without tag (10 μM), and template DNA (plasmid extract). The system was finally supplemented with nuclease-free water (HPLC grade) to 25 μL, and the specific amount of each component was verified by experiment.

[0077] The PCR amplification program was set as follows: 95℃ pre-denaturation for 4 minutes; followed by 40 cycles of amplification (95℃ denaturation for 10 seconds, 60℃ annealing / elongation for 30 seconds, and fluorescence signal acquisition at the end of this step); immediately after amplification, melting curve analysis was performed, starting from 30℃ and increasing to 80℃ at a rate of 0.1℃ / second, and continuously acquiring fluorescence signals during this process to evaluate product specificity; finally, 40℃ cooling for 30 seconds.

[0078] When using the initial system to amplify each target gene, each target gene could only be amplified by the corresponding two-dimensional PCR primer. The melting curve analysis results showed that the probe could successfully detect the five target genes, vanA, vanB, vanC, vanD, and vanM, with melting temperatures of 52℃, 48℃, 65℃, 58℃, and 42℃, respectively, and the five target genes could be clearly distinguished in the melting curve ( Figure 3 ). When using plasmids containing vanA, vanB, vanC, vanD, and vanM, Pseudomonas aeruginosa, Staphylococcus aureus, Proteus mirabilis, Klebsiella pneumoniae, and Acinetobacter baumannii genomic DNA, and water as templates, the five vancomycin-resistant gene primers could only amplify the corresponding vancomycin-resistant genes, indicating that two-dimensional PCR has sufficient specificity ( Figure 4 ).

[0079] Example 4: Results of primer amount optimization

[0080] In the process of optimization of the amount of unlabeled primer, it was found that the best melting curve valley was obtained when 0.6 μL of unlabeled primer was added to each 25 μL reaction system Figure 5 ). Subsequently, the amount of unlabeled primer was fixed at 0.6 μL, and the amount of other reagents was unchanged, and the optimization of the amount of labeled primer was carried out, and the best melting curve valley was obtained when 0.1 μL of labeled primer was added to each 25 μL reaction system Figure 6 ).

[0081] Example 5: Results of probe and magnesium ion amount

[0082] Since the five target genes were detected in the same tube, the plasmid containing the vanA gene was selected as the template, and the amounts of labeled primer and unlabeled primer were fixed at 0.1 μL and 0.6 μL, respectively, and the amounts of probe and magnesium ion were optimized. In the process of probe optimization, it was found that the best melting curve valley was obtained when 0.3 μL of probe was added to each 25 μL reaction system. Subsequently, the amount of probe was fixed at 0.3 μL, and the best concentration of magnesium ion was 1.5 mM, i.e. the best effect was obtained when 1.5 μL of magnesium ion solution (the original magnesium ion concentration was 25 mM) was added to each 25 μL reaction system Figure 7 ).

[0083] Example 6: Results of two-dimensional PCR specificity and sensitivity detection

[0084] The two-dimensional PCR specificity verification results show that only when the corresponding target gene exists in the template, a specific melting valley will appear at the expected Tm position. For example, the vanA plasmid template only appears a valley at 52°C, and there is no signal at other Tm positions (48°C, 65°C, 58°C, 42°C). The other four single plasmid templates also show the same rule, that is, only their own corresponding Tm valley appears. The non-target pathogen genome verification experiment selects the genomic DNA of clinically common and possibly coexisting gram-negative bacteria (Pseudomonas aeruginosa, Klebsiella pneumoniae, Acinetobacter baumannii, Proteus mirabilis) and gram-positive bacteria (Staphylococcus aureus) as templates. No specific melting valley at the target Tm position (52°C, 48°C, 65°C, 58°C, 42°C) was observed in all tests. The no template control (NTC) also showed a negative result. The evaluation of potential interfering substances found that in the presence of these potential interfering substances, the target gene (such as vanA) could still be stably detected, its amplification curve and characteristic Tm valley were clear and distinguishable, and the CT value had no obvious delay or inhibition compared with the positive control without interference. This indicates that the two-dimensional PCR system of this study has good tolerance to these common matrix components and is suitable for direct or rapid extraction detection of complex clinical samples.

[0085] The results of the minimum detection limit (LOD) evaluation of the two-dimensional PCR method established in this study for five vancomycin-resistant genes show that the LOD of vanA and vanC is 10 3 copies / μL; the LOD of vanB is 10 2 copies / μL; vanD and vanM have the highest sensitivity, and the LOD of both is 10 1 copies / μL. All genes cannot be stably detected at concentrations lower than their respective LODs. The LOD range (10 1 ~ 10 3 copies / μL) of this method fully meets the clinical detection requirements. Figure 8

[0086] Example 7: Single-tube multi-gene detection results

[0087] This study verifies the feasibility and reliability of the two-dimensional PCR method in simultaneously detecting five vancomycin-resistant genes (vanA, vanB, vanC, vanD, and vanM) in a single tube through systematic experiments. When the five plasmids are mixed at the respective LOD concentrations (vanA / vanC: 10 3 copies / μL; vanB: 10 2 copies / μL; vanD / vanM: 10 1 ​All targets were stably detected when the concentration of template DNA was 100 copies / μL, and the low-abundance target was not inhibited under the extreme condition of the difference in the abundance of target genes in the simulated clinical sample Figure 9 The melting valley separation of the fiveplex assay remained stable after adding human genomic DNA (50 ng / μL) and LB medium simulated sample background.

[0088] Example 8: Results of clinical sample detection

[0089] The sequencing results of 105 Enterococcus faecium strains showed that 94 strains contained vanA, 1 strain contained vanM, 7 strains carried both vanA and vanM, and 3 strains did not contain any vancomycin-resistant genes. The vancomycin-resistant gene carrying status of 105 Enterococcus faecium strains was detected by two-dimensional PCR, and the detection results of 103 strains were consistent with the sequencing results, and 2 strains showed false negative. Figure 9 Part of the detection results of clinical samples, yellow is positive control, blue is negative control and blank control, and other colors are the detection results of clinical samples. The type of drug-resistant gene carried by the strain can be clearly distinguished from the melting curve.

[0090] Discussion and summary

[0091] Vancomycin, as a glycopeptide antibiotic, its antibacterial mechanism is mainly through inhibiting the key step of bacterial cell wall synthesis, that is, the synthesis of peptidoglycan, thereby destroying the integrity of bacterial cell wall, and ultimately leading to bacterial death. Since its introduction in the mid-20th century, vancomycin has been regarded as the "last resort" for the treatment of serious infections of gram-positive bacteria, especially in the treatment of Enterococcus and methicillin-resistant Staphylococcus aureus (MRSA) infections, which plays an irreplaceable role. However, in recent years, the resistance of these two bacteria to vancomycin has become increasingly serious, which has brought great challenges to clinical treatment. The emergence of drug-resistant strains not only prolongs the hospitalization time of patients, increases the medical cost, but also leads to a higher mortality rate, which poses a serious threat to public health safety.

[0092] Bacteria develop resistance by acquiring specific vancomycin resistance genes (van gene clusters). Currently, 9 vancomycin resistance genes (vanA, vanB, vanC, vanD, vanE, vanG, vanL, vanM, vanN) have been identified, which can be divided into two categories according to their ligase functions. The first category is D-Ala-D-Lac ligase, which is encoded by vanA, vanB, vanD and vanM, and mainly mediates high-level bacterial resistance; the second category is D-Ala-D-Ser ligase, which is encoded by vanC, vanE, vanG, vanL and vanN, and mediates low-level bacterial resistance. These resistance genes change the structure of peptidoglycan precursors in the process of bacterial cell wall synthesis, replacing D-Ala-D-Ala with D-Ala-D-Lac or D-Ala-D-Ser, thereby reducing the binding ability of vancomycin to the cell wall, leading to bacterial resistance to vancomycin. Vancomycin-resistant Enterococcus (VRE) has rapidly increased in speed and scope since it was first discovered in 1986. Studies have shown that the resistance genes are located on transposons, which enable vancomycin resistance genes to rapidly spread between strains through horizontal gene transfer. VRE has been listed by the World Health Organization (WHO) as one of the global priority pathogens, which can cause a series of serious infections, including bacteremia, infective endocarditis, urinary tract infection, intra-abdominal infection, pelvic infection, peritonitis, skin infection, and central nervous system infection. Since Enterococcus faecium and Enterococcus faecalis have intrinsic resistance to many clinically commonly used antibiotics, clinically common Enterococcus infections are mainly caused by these two bacteria. Compared with Enterococcus faecalis, Enterococcus faecium has a higher resistance rate to vancomycin. In 2020, Olaniyi Ayobami et al. pointed out that the proportion of vancomycin-resistant Enterococcus faecium in Europe increased by 10.9% from 2012 to 2018, while the proportion of drug-resistant Enterococcus faecalis was relatively low.

[0093] In this context, it is particularly important to develop a rapid, accurate, and efficient vancomycin resistance gene detection method. Traditional resistance gene detection methods, such as phenotypic detection and conventional PCR techniques, have many limitations. Phenotypic detection usually requires a long incubation time (usually 24-48 hours), which cannot provide timely results and may delay treatment opportunities. Although conventional PCR methods have certain sensitivity and specificity, they often involve complex nucleic acid extraction steps, high reagent costs, and long detection periods (usually 2-3 hours), making it difficult to meet the urgent needs of rapid clinical detection. In addition, conventional PCR methods can only detect a single target, and cannot detect multiple resistance genes simultaneously, limiting their application in complex clinical samples. Therefore, this study developed a two-dimensional PCR-based single-tube five-reagent vancomycin resistance gene nucleic acid extraction-free rapid screening method, aiming to provide a rapid, efficient, and cost-effective detection tool for clinical laboratories to address the challenges posed by vancomycin resistance and provide strong support for clinical precision diagnosis and treatment. Figure 10 Compared with existing research, this study has significant advantages in several aspects. For example, Nomura et al. developed a multiple-PCR-based resistance gene detection method that can detect multiple resistance genes simultaneously, but the detection process is more complicated and requires complex nucleic acid extraction steps. In this study, by optimizing the nucleic acid extraction and detection system, not only the sensitivity is improved, but also the operation process is simplified. In addition, the real-time fluorescent quantitative PCR method developed by He et al. has high sensitivity, but it can only detect three targets, which cannot meet the new trend of vancomycin resistance gene subtypes in clinical practice. The single-tube five-reagent detection system in this study overcomes this limitation and can detect five resistance genes simultaneously, providing a more comprehensive detection scheme for clinical practice. The two-dimensional PCR technique uses primers with specific tag sequences to make the amplification products of different target genes have unique melting temperatures, thereby achieving single-tube multiple detection. In this study, we mutated several bases in the probe complementary sequence (see Table 1), so that different vancomycin resistance genes have different melting temperatures. As shown in Table 1, the melting temperatures of the five different vancomycin resistance genes (vanA, vanB, vanC, vanD, and vanM) differ by more than 4°C, which can be clearly distinguished. This detection method based on melting temperature differences not only improves the specificity of detection, but also significantly reduces the cost of detection, while simplifying the operation process. Figure 9

[0094] The results of the minimum detection limit (LOD) evaluation of the two-dimensional PCR method established in this study for the five vancomycin resistance genes showed that the LOD of vanA and vanC was 10 3 copies / μL; the LOD of vanB was 10 2 ​copies / μL; vanD and vanM had the highest sensitivity, both with LOD of 10 1 copies / μL. These detection sensitivities all met the requirements of clinical sample detection. In the specificity verification, the method only appeared a specific melting valley at the expected Tm position when the corresponding target gene existed in the template. For the non-target pathogen genomic verification experiments, including common pathogens such as Pseudomonas aeruginosa, Klebsiella pneumoniae, Acinetobacter baumannii, Proteus mirabilis and Staphylococcus aureus, no specific melting valley at the target Tm position was observed. In addition, the no template control (NTC) was also negative, indicating that the method had high specificity.

[0095] In clinical sample detection, 105 Enterococcus faecium sequencing results were analyzed and found that 94 strains contained vanA, 1 strain contained vanM, 7 strains carried vanA and vanM, and 3 strains did not contain any vancomycin-resistant genes. Through two-dimensional PCR detection, 103 detection results were consistent with the sequencing results, and 2 appeared false negative, showing high sensitivity and specificity. These results showed that the two-dimensional PCR method developed in this study had high accuracy and reliability in clinical sample detection.

[0096] The two-dimensional PCR-based single-tube five-fold vancomycin-resistant gene detection method developed in this study not only has innovation in technology, but also has important potential value in clinical application. First, this method can detect five vancomycin-resistant genes in a single tube, greatly improving the detection efficiency and shortening the detection time. This is of great significance for clinical rapid diagnosis and treatment decision-making, especially in the face of the serious situation of rapid spread of drug-resistant strains, which can provide accurate drug resistance information for clinicians in time, avoid the use of ineffective antibiotics, and reduce the risk of further development of drug resistance. Second, this method has high sensitivity and specificity, and can detect low concentrations of drug-resistant genes, which plays an important role in early detection of drug-resistant strains and control of infection transmission. In addition, this method has low cost and simple operation, which is suitable for application in medical institutions at all levels. By simplifying the detection process and reducing the detection cost, this method is expected to realize rapid and efficient drug resistance gene detection in clinical laboratories, and provide strong support for clinical precise diagnosis and treatment. Finally, the detection method developed in this study also has good tolerance, which can stably detect target genes in the presence of potential interferents. This is of great significance for the direct detection of complex clinical samples, avoiding the cumbersome nucleic acid extraction and purification steps, and further improving the detection efficiency. In the future, this method is expected to play an important role in hospital infection monitoring, drug-resistant strain screening and clinical treatment guidance, and provide new technical means for coping with global drug resistance challenges.

[0097] Although the two-dimensional PCR method developed in this study showed high sensitivity and specificity in detecting drug-resistant genes, there are still some limitations. First, although the zirconium oxide bead combined with ultrasonic extraction method can quickly extract nucleic acids, it performs poorly in terms of nucleic acid integrity, which may affect some detection methods that require high nucleic acid integrity. Second, although this study verified the application effect of this method in clinical samples, the sample size is relatively limited, and further verification of its accuracy and reliability in a larger sample size is needed in the future. In addition, this method currently only detects vancomycin-resistant genes, and its application potential in other drug-resistant gene detection can be explored in the future. Future research directions can include the following aspects: first, further optimize the nucleic acid extraction method to improve the integrity and concentration of nucleic acids while maintaining the advantage of rapid extraction; second, expand the sample size, verify the application effect of this method in different regions and strains, and evaluate its stability and reliability in the actual clinical environment; third, combine other detection techniques such as gene sequencing and mass spectrometry to further improve the accuracy and resolution of drug-resistant gene detection; fourth, explore the application of this method in other drug-resistant gene detection, and develop more two-dimensional PCR-based multiplex detection methods to provide more comprehensive technical support for clinical drug resistance monitoring.

[0098] In summary, the two-dimensional PCR-based single-tube five-reagent vancomycin-resistant gene detection method developed in this study provides a new technical means for rapid and efficient detection of drug-resistant genes in clinical practice. This method has high sensitivity, high specificity, low cost, and simple operation, and is expected to play an important role in clinical diagnosis, hospital infection monitoring, and drug-resistant strain screening. In the future, with further optimization of technology and expansion of application range, this method is expected to provide more powerful support for coping with global drug resistance challenges.

[0099] It should be noted that the preferred embodiments of the present application are given in the specification and drawings of the present application, but the present application can be implemented in many different forms and is not limited to the embodiments described in the specification. These embodiments are not additional limitations on the content of the present application, and the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive. Furthermore, each of the above technical features continues to be combined, forming various embodiments not listed above, which are considered to be within the scope of the present application. Furthermore, for those skilled in the art, the above description can be improved or modified, and all such improvements and modifications are within the scope of the appended claims of the present application.

Claims

1. A two-dimensional PCR reaction system for rapid single-tube screening of multiple vancomycin resistance genes in microorganisms, characterized in that, The two-dimensional PCR reaction system includes a universal detection probe and specific forward and reverse primers for each vancomycin resistance gene. Each forward primer carries a two-dimensional coding tag complementary to the universal detection probe, and the degree of complementarity between the two-dimensional coding tag of each forward primer and the universal detection probe is different, so that each vancomycin resistance gene corresponds to a different melting temperature.

2. The two-dimensional PCR reaction system according to claim 1, characterized in that, The two-dimensional PCR reaction system is used for the simultaneous detection of vancomycin resistance genes vanA, vanB, vanC, vanD, and vanM in a single tube.

3. The two-dimensional PCR reaction system according to claim 2, characterized in that, The nucleotide sequence of the primers used to detect the vanA gene is as follows: vanA-F: CCATTACACTTGCTATACACTTCCACCCGTTTCCTGTATCCGTCCTC vanA-R:GGCTGTTTCGGGCTGTGA; The nucleotide sequence of the primers used to detect the vanB gene is as follows: vanB-F:CCATTACAGATGCTATACACTTCCACATTGCTGCGAACATTGATACGG vanB-R:GAGACTGTCGGCTTCCCATT; The nucleotide sequence of the primers used to detect the vanC gene is as follows: vanC-F:CCATTACACATCCTATACACTTCCACTGACAAATCAAGCCAACC vanC-R:GCACTGCGGAACAATAAG; The nucleotide sequence of the primers used to detect the vanD gene is as follows: vanD-F:CCATTACACTTCCTATACACTTCCACCGGCATTCCCTT ATGTGGG vanD-R:CTGCTTTCAGGCTGTCCC; The nucleotide sequence of the primers used to detect the vanM gene is as follows: vanM-F:CCATTACTCATGCTATATACTTCCACCGGCAGATTCG TTTACCT vanM-R:GGCACAACCGACCTCATA; The nucleotide sequence of the universal detection probe is: CCATTACCAACCTTATACACTTCCAC.

4. The two-dimensional PCR reaction system according to claim 3, characterized in that, The universal detection probe has a fluorescent group attached to its 5' end and is blocked by a phosphate group at its 3' end.

5. The two-dimensional PCR reaction system according to claim 1, characterized in that, The two-dimensional PCR reaction system also includes PCR buffer, dNTPs, DNA polymerase, and magnesium ions.

6. A kit for rapid single-tube screening of multiple vancomycin resistance genes in microorganisms, characterized in that, Includes the two-dimensional PCR reaction system according to any one of claims 1-5.

7. A method for rapid single-tube screening of multiple vancomycin resistance genes in microorganisms, characterized in that, Includes the following steps: (1) Provide a sample containing the microorganism to be tested; (2) Obtain nucleic acid samples of the microorganisms to be tested from the sample; (3) Perform PCR amplification on the nucleic acid sample using the two-dimensional PCR reaction system according to any one of claims 1-5 or the kit according to claim 6; (4) Melting curve analysis was performed on the products after PCR amplification. Different melting curves correspond to different vancomycin resistance genes.

8. The method according to claim 7, characterized in that, Step (2) involves obtaining the nucleic acid sample of the microorganism to be tested from the sample, which includes the following steps: The sample is mixed with lysis buffer and zirconia beads with a diameter of 0.1-0.5 mm, vortexed for 1-5 minutes, then sonicated, and the supernatant is collected by centrifugation to obtain the nucleic acid sample of the microorganism to be tested.

9. The method according to claim 8, characterized in that, The lysis buffer contains 20 mM Tris-HCl, 2 mM EDTA, 1.2% SDS and 0.05-0.2 mg / mL proteinase K and has a pH of 8.

0.

10. The method according to claim 8, characterized in that, The sample containing the microorganism to be tested is a human bodily fluid or excrement sample containing the microorganism to be tested.

Images