SSR marker primer developed based on plantain root transcriptome sequence and application of SSR marker primer

Abstract

The invention discloses an SSR marker primer developed based on a plantain root transcriptome sequence and application of the SSR marker primer, and belongs to the technical field of molecular markers. The SSR marker primers comprise 10 pairs of primers, namely, P15, P17, P33, P37, P49, P57, P62, P68, P78 and P92, and the 10 pairs of marker primers have good polymorphism and can effectively reflect the genetic diversity of a plantain root material; the polymorphism among different plantain root germplasms is rich, the banding pattern is clear, the repeatability of the characteristic band is good, and the amplification success rate is high. The blank of developing the SSR primer from the transcriptome by the plantain root is filled. The method can be used for interspecific identification and genetic diversity analysis of the roots of Japanese bananas, and provides a certain reference for germplasm resource identification and quality evaluation of the roots of Japanese bananas.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular markers, and particularly relates to an SSR marker primer based on a Rhizoma Musae transcriptome sequence and application thereof. BACKGROUND

[0002] Rhizoma Musae is the underground part of Musa basjoo Sied.et Zucc. With the development of modern science and technology, it is revealed that Rhizoma Musae has rich chemical components and various pharmacological activities such as anti-inflammatory, analgesic, antibacterial and the like. Rhizoma Musae contains various chemical components including saccharides, amino acids, organic acids, flavonoids, steroids, volatile oils and the like. Studies have shown that Rhizoma Musae can stimulate pancreatic beta cells to secrete insulin, thereby increasing the uptake and utilization of glucose by the body and reducing blood glucose concentration. In addition, 7beta-hydroxyrutaecarpine, 7,8-dihydroxycoumarin, pinocembrin diacetate and the like are important active components of Rhizoma Musae, which play a role in promoting bone cell proliferation and anti-inflammatory effect through MAPK signaling pathway, Lipid and Atherosclerosis, PI3K-Akt, IL-17 and the like signal pathways. At present, a Gukang capsule mainly developed from Rhizoma Musae has a significant clinical effect on the treatment of osteoarthritis, bone fracture and the like.

[0003] Simple sequence repeats (SSRs), also known as microsatellites, are mainly 2 to 5 nucleotide tandem repeats as basic repeat units. Due to its wide distribution in the genome, high polymorphism and co-dominant inheritance and the like, it has attracted attention. With the decrease of sequencing cost and the increase of transcriptome data, it is more and more widely used in the molecular biology research of medicinal plants without reference genome information, such as Amomum villosum, Atractylodes lancea and the like. At present, Rhizoma Musae medicinal materials mainly come from wild digging, but the biological characteristics of plants in the genus Musa are similar, and it is difficult to accurately identify them through morphological identification method. At the same time, artificial cultivation of Rhizoma Musae is still in the initial stage, and the genetic background and genetic relationship among different geographical resources are not clear, which seriously restricts the analysis and utilization of Rhizoma Musae germplasm resources.

[0004] The present application uses the transcriptome data of Rhizoma Musae to analyze the composition, distribution and characteristics of EST-SSR sites in Rhizoma Musae, designs potential EST-SSR markers, and preliminarily verifies the polymorphism level of the polymorphic markers in different Rhizoma Musae. These molecular markers can provide powerful tools for interspecific identification, genetic diversity analysis and genetic map construction of Rhizoma Musae. SUMMARY

[0005] Therefore, one of the purposes of the present application is to provide a SSR marker primer developed based on the transcriptome sequence of Musa root; the second purpose of the present application is to provide an application of the SSR marker primer developed based on the transcriptome sequence of Musa root in genetic diversity analysis of Musa germplasm resources; and the third purpose of the present application is to provide a kit containing a combination of the SSR marker primer developed based on the transcriptome sequence of Musa root.

[0006] To achieve the above-mentioned purposes, the present application is realized by the following technical solutions:

[0007] The SSR marker primer developed based on the transcriptome sequence of Musa root comprises the following 10 pairs of EST-SSR primers:

[0008]

[0009] The kit contains P15, P17, P33, P37, P49, P57, P62, P68, P78 and P92 SSR marker primers developed based on the transcriptome sequence of Musa root.

[0010] The application of the SSR marker primer developed based on the transcriptome sequence of Musa root in genetic diversity analysis of Musa germplasm resources.

[0011] The method for analyzing the genetic diversity of Musa germplasm resources comprises the following steps:

[0012] S1, obtaining Musa root transcriptome genes:

[0013] Fresh young leaves of the Musa root sample are used for RNA extraction and construction of a cDNA library, mRNA of the Musa root sample is sequenced based on an Illumina Novaseq 6000 sequencing platform, and independent gene sets are spliced by using Trinity;

[0014] S2, extracting Musa root DNA:

[0015] The total DNA of the Musa root leaves is extracted by using a plant genomic DNA extraction kit, the quality of the obtained total DNA is detected by 2.0% agarose gel electrophoresis, and the sample is stored at -20℃ for standby after the detection is qualified;

[0016] S3, primer design and synthesis:

[0017] The MISA is used for searching the Morus root EST-SSR site; the primer 3 is used for designing the primer, 100 pairs of primers are selected for screening test, the length of the primer is 18-25 bases, and the expected PCR amplification product length is 100-500bp; the PCR amplification product is first detected by 1.5% agarose electrophoresis to obtain a band, and then 10% polyacrylamide gel is used to screen the polymorphic band, and 10 pairs of primers with high polymorphism are selected from the amplification product;

[0018] S4, Morus root resource identification:

[0019] The 10 pairs of primers with high polymorphism are labeled with 6-carboxyfluorescein, and then the DNA of the Morus root sample is subjected to PCR amplification; capillary electrophoresis detection of the amplification PCR product is carried out on an ABI-3730XL gene analyzer, and the fluorescence signal and site peak are detected;

[0020] S5, genetic diversity analysis:

[0021] The raw data obtained by capillary electrophoresis detection are analyzed by using Genemarker V2.2.0 software, the fragment size is obtained by comparing and analyzing the position of the molecular weight internal standard in each lane and the position of the peak value of each sample; the genetic distance matrix of the Morus root sample is calculated by using POPGENE32 software; the clustering analysis of the data of the Morus root sample is carried out by using the UPGMA method according to the GS value matrix, and a circular clustering diagram is obtained.

[0022] In the genetic diversity analysis method of the Morus root germplasm resource, the synthesis system of the primer is: DNA template 2 μL, 2x Rapid Taq Master Mix, upstream and downstream primers 0.6 μL, 10 μmol / L, and ddH2O 7.4 μL.

[0023] In the genetic diversity analysis method of the Morus root germplasm resource, the reaction program of the PCR amplification is: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 60℃ recombination for 30s, 72℃ extension for 50s, a total of 10 cycles; 94℃ denaturation for 30s, 54℃ recombination for 30s, 72℃ extension for 50s, a total of 27 cycles; 72℃ extension for 5min, and 4℃ preservation.

[0024] In the genetic diversity analysis method of the Morus root germplasm resource, the EST-SSR site retrieval parameter setting is: the number of single to six nucleotide repeats is 10, 6, 5, 5, 5 and 5 times, respectively.

[0025] Compared with the prior art, the beneficial effects of the present application are as follows:

[0026] 1. The 10 pairs of EST-SSR primers screened by the application have a PIC value greater than 0.5 in the 45 Musa root germplasm tested, and the average PIC value is 0.759, showing good polymorphism and effectively reflecting the genetic diversity of the materials; the polymorphism is rich among different Musa root germplasm, the banding pattern is clear, the characteristic band has good reproducibility, and the amplification success rate is 60%, which is high.

[0027] 2. The 10 pairs of EST-SSR primers screened by the application are new markers that exist stably, fill the blank of developing SSR primers based on the transcriptome of Musa, and can be used for identification and genetic diversity analysis of Musa root germplasm resources, thereby providing a certain reference for the identification and quality evaluation of Musa germplasm resources. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 : Part of the electrophoretogram of EST-SSR primers screened by 1.5% agarose gel electrophoresis (lanes 1-4 are GZ-1, JS-1, WM-1, and WM-19, respectively);

[0029] Figure 2 : Result graph of EST-SSR primers screened by 10% polyacrylamide gel electrophoresis;

[0030] Figure 3 : Capillary electrophoresis graph of P15 primers on some samples.

[0031] Figure 4 : Musa root cluster analysis graph DETAILED DESCRIPTION

[0032] The application will be further described below in combination with the drawings and specific examples, so that those skilled in the art can better understand the application and implement it, but the examples are not limiting to the application.

[0033] Example 1

[0034] 1. Materials

[0035] 45 Musa root materials were collected from seven counties in Guizhou Province, Guangxi Zhuang Autonomous Region, Jiangxi Province, Jiangsu Province, and Fujian Province, respectively, and fresh and healthy leaves were collected and put into paper molecular sample collection bags, which were placed in sealed boxes containing dry silica gel for subsequent experiments. The specific sampling information is shown in Table 1.

[0036] Table 1: Information of 45 Musa root samples

[0037]

[0038] 2. Methods

[0039] 1.2 EST sequence source

[0040] Fresh young leaves of WM-1 sample were used for RNA extraction and construction of cDNA library. The sample mRNA was sequenced based on Illumina Novaseq 6000 sequencing platform, and Trinity (https: / / github.com / trinityrnaseq / trinityrnaseq / wiki) was used to splice into independent gene set, i.e. a transcriptome spliced from EST sequence.

[0041] 1.3 DNA extraction

[0042] The total DNA of the above experimental materials was extracted by plant genomic DNA extraction kit (Beijing Tiangen), and the quality of the obtained total DNA was detected by 2.0% agarose gel electrophoresis. After detection, the sample was stored at -20℃ for standby use.

[0043] 1.4 Primer design and synthesis

[0044] MISA (http: / / pgrc.ipk-gatersleben.de / misa / misa.html, default parameters) was used to search for Musa root EST-SSR sites. The SSR site search parameters were set as follows: the number of single to six nucleotide repeats was 10, 6, 5, 5, 5 and 5 times, respectively. Primer 3 (version 2.3.4) was used to design primers, and 100 pairs of primers were selected for screening test. The length of the primers was 18-25 bases, and the expected length of the PCR product was 100-500 bp.

[0045] 20 μL primer synthesis system: DNA template 2 μL, 2 × Rapid Taq Master Mix, upstream and downstream primers 0.6 μL (10 μmol / L), ddH2O 7.4 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 10 cycles; 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 27 cycles; 72℃ extension for 5 min, 4℃ storage.

[0046] The PCR amplification products were first detected by 1.5% agarose electrophoresis to obtain bands without diffusion, and then 10% polyacrylamide gel electrophoresis (PAGE) was used to screen polymorphic bands. Finally, 10 pairs of primers with high polymorphism were selected from the amplification products of 100 pairs of primers.

[0047] 1.5 Musa root resource identification

[0048] DNA of 45 Musa root samples were amplified by PCR after fluorescent labeling with 6-carboxy-fluorescein (FAM). Capillary electrophoresis of amplified PCR products was performed on an ABI-3730XL genetic analyzer (Applied Biosystems, Foster City, CA), and fluorescence signals and site peaks were detected.

[0049] 1.6 Genetic diversity analysis

[0050] The raw data obtained by capillary electrophoresis were analyzed using Genemarker V2.2.0 software, and the fragment size was obtained by comparing the positions of molecular weight markers in each lane with the positions of sample peaks. The genetic distance matrix of 45 test materials was calculated using POPGENE32 software. According to the GS value matrix, the results of test material data were clustered using the UPGMA method to obtain a circular cluster diagram.

[0051] 2 Results

[0052] 2.1 Musa root transcriptome SSR site information

[0053] Using high-throughput transcriptome sequencing technology, 7.65 Gb of high-quality sequences were obtained, with Q20 and Q30 of 99.07% and 96.83%, respectively, and a GC content of 51.21%. This indicates that the sequencing assembly quality is good and can be used for subsequent analysis. The sequences were spliced using Trinity software, obtaining 38806 Unigenes with an average length of 993.00 bp.

[0054] MISA software was used to analyze the Unigene of Musa root transcriptome for SSR site information. A total of 7501 SSR sites were detected, with a distribution frequency of 19.33%. SSRs were divided into six types according to the repeat type, with trinucleotide repeats being the most common (44.03%), followed by dinucleotide repeats (43.87%), mononucleotide repeats (24.73%), tetranucleotide repeats (1.64%), hexanucleotide repeats (0.52%), and pentanucleotide repeats (0.51%). The repeat units were mainly AG / CT, A / T, and ACC / GGT, accounting for 32.78%, 20.20%, and 2.41%, respectively. The above results provide a basis for the development of Musa root molecular markers.

[0055] Table 2. Distribution of SSR site repeat numbers in Musa root transcriptome.

[0056]

[0057]

[0058] 2.2 EST-SSR primer screening

[0059] Four phenotypically different Musa root accessions (GZ-1, JS-1, WM-1, and WM-19) were selected to amplify 100 random primers. The preliminary screening results showed that 60 primers could successfully amplify clear bands with good reproducibility, with an amplification success rate of 60%, as shown in Figure 1 . The 60 primers obtained from the preliminary screening were subjected to 10% polyacrylamide gel electrophoresis, and the results are shown in Figure 2 . Based on the above results, 10 EST-SSR primers with rich polymorphism, clear banding patterns, and stable characteristic bands between different Musa root accessions were selected (see Table 3). The effective rate of primers was 16.67%. The capillary electrophoresis chart of some samples amplified by P15 primer is shown in Figure 3 .

[0060] Table 3. Information of 10 EST-SSR primers

[0061]

[0062]

[0063] 2.3 Genetic diversity analysis

[0064] Table 4. Genetic diversity analysis of 10 primers in Musa root

[0065] Table 4. Genetic diversity analysis of 10 primers in Musa root

[0066]

[0067]

[0068] 2.4 Cluster analysis of 45 banana root germplasm accessions

[0069] The UPGMA tree constructed based on the genetic distance coefficient shows that ( Figure 4 The 45 banana root germplasm resources were divided into three groups. Group A consisted of 36 individuals from the GZ, JS, GX and some WM groups; Group B consisted of the remaining 12 individuals from the WM group; and Group C consisted of 9 individuals from the FJ and JX groups.

[0070] Example 2

[0071] Ten pairs of EST-SSR primers selected in Example 1 were combined to prepare a kit for identification, polymorphism analysis, or genetic diversity analysis of banana root species. The specific primer names and sequences are as follows:

[0072]

[0073]

[0074] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. SSR marker primers developed based on banana root transcriptome sequences, characterized in that, The composition of the SSR-labeled primers consists of the following 10 pairs of EST-SSR primers: Primer Name Primer Sequence (5'-3') P15 F:GTCATCTCGGTGTGCTGTGT R:TTGGTCTTGCAAGTGTCGAG; P17 F:CTTATCCGCTCCTTTTGTCG R:TTCCGATCGAGCAACTTCTT; P33 F:CAGGAAGGCAAATTCCAATC R:TCCTTCAAGATCTATGCCCG; P37 F:CAAGTCCCTTCGTAGCTCCA R:TGAGTTGTCGATCCTTGTCG; P49 F:TGGGTTGCATGAGCATTTTA R:GAGGAGCATTTATGCCCAAG; P57 F:GTCCCTCGTACCATCTCTCG R:TCCCCTCCCTTCTTTTTCTC; P62 F:ACTGATTTCGTCTCCATCGG R:AGGGATAAGCATCAAGCACG; P68 F:ACCAGCGCACAAGCAATACT R:CAAAGTGGTGGGAGACTGGT; P78 F:AAATTGCTAGTCCCACACGG R:ATACGCAACTGCTGCACATC; P92 F:TACAAATTCCGTTGGTCGGT R:GATGGCATGAAAACGATGTG.

2. A reagent kit, characterized in that, The kit contains the P15, P17, P33, P37, P49, P57, P62, P68, P78, and P92 SSR marker primers developed based on the banana root transcriptome sequence as described in claim 1.

3. The application of an SSR marker primer developed based on banana root transcriptome sequences as described in claim 1 in the analysis of genetic diversity of banana root germplasm resources.

4. The application according to claim 3, characterized in that, The method for analyzing the genetic diversity of banana root germplasm resources includes the following steps: S1, banana root transcriptome gene acquisition: Fresh young leaves of banana root samples were used for RNA extraction and cDNA library construction. The mRNA of banana root samples was sequenced using the Illumina Novaseq 6000 sequencing platform and assembled into independent gene sets using Trinity. S2, Banana root DNA extraction: Total DNA was extracted from the above-mentioned banana root leaves using a plant genomic DNA extraction kit. The obtained total DNA was tested for quality by 2.0% agarose gel electrophoresis. After passing the test, the samples were stored at -20℃ for later use. S3, Primer Design and Synthesis: MISA was used to identify EST-SSR loci in banana roots; primers were designed using Primer 3, and 100 primer pairs were selected for screening experiments. The primer length was 18-25 bases, and the expected PCR amplification product length was 100-500 bp; the PCR amplification products were first detected by 1.5% agarose gel electrophoresis to identify bands without diffusion, and then 10% polyacrylamide gel electrophoresis was used to screen for polymorphic bands. Ten primer pairs with high polymorphism were selected from the amplification products. S4, Identification of banana root resources: Ten pairs of primers with high polymorphism were selected and fluorescently labeled with 6-carboxyfluorescein. The DNA of banana root samples was then amplified by PCR. The amplified PCR products were detected by capillary electrophoresis on an ABI-3730XL gene analyzer to detect fluorescence signals and site peaks. S5, Genetic Diversity Analysis: The raw data obtained from capillary electrophoresis were analyzed using Genemarker V2.2.0 software. The fragment size was obtained by comparing the position of the molecular weight internal standard in each lane with the position of the peak value of each sample. The genetic distance matrix of banana root samples was calculated using POPGENE32 software. Based on the GS value matrix, cluster analysis was performed on the banana root sample data using the UPGMA method to obtain a circular cluster diagram.

5. The application according to claim 4, characterized in that, The primer synthesis system consisted of: 2 μL DNA template, 2×Rapid Taq Master Mix, 0.6 μL upstream and downstream primers, 10 μmol / L ddH2O, and 7.4 μL ddH2O.

6. The application according to claim 4, characterized in that, The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 10 cycles; 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 27 cycles; 72℃ extension for 5 min, and storage at 4℃.

7. The application according to claim 4, characterized in that, The EST-SSR site retrieval parameters were set as follows: the number of repetitions of single to hexanucleotides were 10, 6, 5, 5, 5 and 5 times, respectively.

Images