SNP (Single Nucleotide Polymorphism) molecular marker related to wheat stripe rust and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker related to wheat stripe rust and application of the SNP molecular marker, and relates to the technical field of molecular biology. In order to solve the technical problem of how to quickly and accurately identify the wheat stripe rust resistance, the invention provides the application of a substance for detecting the polymorphism or genotype of SNP in a wheat genome, the SNP is the 101st nucleotide of SEQ ID NO: 1 in a sequence table, and the nucleotide variety is T or C. The invention further provides the application of the substance for detecting the polymorphism or genotype of the SNP in the wheat genome. The invention also provides a composition and / or a kit for detecting the SNP. The method established by the invention can be used for distinguishing a disease-resistant material from a susceptible material, and provides an effective molecular marking tool for subsequent disease-resistant breeding. A molecular marker detection tool can be provided for identification of stripe rust-resistant germplasm resources and breeding of disease-resistant varieties, the selection efficiency is improved, and the breeding process is accelerated.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, in particular to a SNP molecular marker related to wheat stripe rust and application thereof. BACKGROUND

[0002] Wheat stripe rust is a global fungal disease caused by Puccinia striiformis f.sp.tritici. The disease poses a serious threat to wheat production and can cause a significant reduction in crop yield or even complete loss in epidemic years. Due to the wide range of disease occurrence, deep harm degree, and the continuous rise of prevention and control cost, under the dual needs of cost reduction and efficiency increase and ecological protection, breeding and reasonable layout of disease-resistant varieties have become the most economical and effective strategy to control the disease. At present, the international academic circle has located and officially named 87 wheat stripe rust resistance genes through systematic research. However, due to the high variability of wheat stripe rust physiological races, some major disease resistance genes have gradually lost their resistance function, so continuous exploration of new disease resistance genes and development of their molecular markers have important scientific value for broadening the genetic basis of resistance sources and improving disease resistance breeding efficiency.

[0003] KASP markers have a wide range of applications in the field of agriculture, especially in the detection of SNP sites in major crops such as wheat, rice, and corn, showing great application potential. Its advantage is that it can achieve high-throughput genotyping, providing strong technical support for genetic research and breeding of crops. At present, after QTL positioning and whole genome association analysis using wheat SNP chip genotype data, the linked SNP is converted into a KASP marker, which can be more directly applied to molecular marker-assisted selection breeding, helping to improve breeding efficiency and accuracy. SUMMARY

[0004] The technical problem to be solved by the present application is how to identify or assist in identifying the wheat stripe rust resistance of wheat or how to breed wheat.

[0005] In order to solve the above technical problems, the present application provides the application of a substance for detecting the polymorphism or genotype of a SNP in the genome of wheat, the SNP being a site in the genome of wheat, the nucleotide species being T or C, the 101st nucleotide of SEQ ID NO: 1 in the sequence listing; the application can be any of the following:

[0006] A1) the application of the substance in identifying or assisting in identifying the wheat stripe rust resistance of wheat,

[0007] A2) the application of the substance in wheat breeding,

[0008] A3) the application of the substance in preparing a product for identifying or assisting in identifying the wheat stripe rust resistance of wheat,

[0009] A4) use of the substance in the manufacture of a product for wheat breeding.

[0010] In the above use, the substance can be B1), B2) or B3) as follows:

[0011] B1) the substance is a primer composition for amplifying a fragment of wheat genomic DNA including the SNP site,

[0012] B2) the substance is a PCR reagent containing the primer composition of B1),

[0013] B3) the substance is a kit containing the primer composition of B1) or the PCR reagent of B2).

[0014] In the above use, the genotype of the SNP can be genotype TT, genotype CC or genotype TC, genotype TT is a homozygous type of SNP T; genotype CC is a homozygous type of SNP C; and genotype TC is a heterozygous type of SNP T and C.

[0015] With wheat genome WheatOmics 1.0 as a reference genome, the SNP is located in the Kukri_c2289_635 gene, and the Kukri_c2289_635 gene is located at the position of 596.72-596.92 Mb of wheat chromosome 6B, and is related to wheat stripe rust resistance.

[0016] First, the SNP sequence significantly associated with multiple disease resistance traits identified by GWAS analysis is used as a probe to align in the Chinese spring wheat reference genome database and the NCBI website to obtain its accurate physical position and flanking sequence; then, based on the determined physical position interval, the candidate gene most likely to regulate the target trait in the interval is screened by using the wheat WheatOmics 1.0 database, and systematic functional annotation analysis is performed; finally, based on the stable SNP site, KASP markers that can be used for high-throughput genotyping are developed by using online software Polymarker.

[0017] The application also provides a method for identifying or assisting in identifying wheat resistance to wheat stripe rust, which comprises detecting the genotype of the SNP site in the genome of the wheat to be tested, and identifying or assisting in identifying the wheat resistance to wheat stripe rust according to the genotype, wherein the SNP site is the above-mentioned SNP site.

[0018] The method can comprise detecting the genotype of the SNP in the wheat to be tested, and identifying or assisting in identifying the wheat resistance to wheat stripe rust according to the genotype of the wheat to be tested, wherein the genotype of the wheat to be tested is TT, and the wheat resistance to wheat stripe rust of the wheat to be tested with the genotype of TT is extremely significantly higher or candidate higher than that of the wheat to be tested with the genotype of CC.

[0019] Optionally, the method for identifying or assisting in identifying the wheat stripe rust resistance trait can be any one of the following:

[0020] (1) The wheat to be tested for the SNP genotype TT is or is a candidate for high stripe rust resistance wheat.

[0021] (2) The average value of the stripe rust resistance of the wheat to be tested for the SNP genotype TT is significantly higher than or is a candidate for higher than the wheat to be tested for the genotype CC.

[0022] As an embodiment, the method for identifying or assisting in identifying the wheat stripe rust resistance can comprise the following steps:

[0023] (1) Using the genomic DNA of the wheat to be tested as a template, KASP is performed using primer composition F1; the primer composition F1 can consist of primer F1-A, primer F1-B, and primer R;

[0024] The primer F1-A can be a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 2 or a single-stranded DNA with a nucleotide sequence of 22-44 of SEQ ID NO: 2 in the sequence listing;

[0025] The primer F1-B can be a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 3 or a single-stranded DNA with a nucleotide sequence of 22-44 of SEQ ID NO: 3 in the sequence listing;

[0026] The primer R can be a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 4.

[0027] (2) After step (1) is completed, fluorescence detection is performed to determine the genotype of the SNP site of the wheat to be tested;

[0028] (3) According to the genotype result, the stripe rust resistance of the wheat to be tested is identified: the average value of the stripe rust resistance of the wheat to be tested for the SNP genotype TT is significantly higher than or is a candidate for higher than the wheat to be tested for the genotype CC.

[0029] The present application also provides the use of the above method in wheat breeding.

[0030] The present application also provides a method for wheat breeding, which comprises detecting the genotype of the SNP site in the wheat genome, and selecting wheat with the genotype TT of the SNP site as a parent for breeding, wherein TT is the homozygous type of T at the SNP site.

[0031] As an embodiment, the method for wheat breeding can comprise the following steps:

[0032] (1) using the genomic DNA of the wheat to be tested as a template, and using the primer set F1 described above to perform KASP;

[0033] (2) after step (1) is completed, performing fluorescence detection to determine the genotype of the SNP site of the wheat to be tested;

[0034] (3) selecting the wheat with CC genotype to breed high-streak rust resistance.

[0035] In the present application, the index of plant breeding includes wheat stripe rust resistance, and the purpose of plant breeding includes breeding wheat with high stripe rust resistance.

[0036] The wheat stripe rust resistance described above can be resistance to adult plant resistance identification to a mixed race composed of CYR32, CYR34 race, water source pathogenic race (Su11-4, Su11-5), Guinong 22 pathogenic race (G22-14) and the like in proportion.

[0037] In the above applications and methods, the wheat can be a pure line wheat inbred line. In the above applications and methods, a wheat inbred line can be selected as a parent for breeding.

[0038] In the above applications and methods, the high stripe rust resistance of the wheat variety is relative to the hybrid parent wheat. If the stripe rust resistance of the two hybrid parent wheats is the same, the stripe rust resistance of the wheat variety with high stripe rust resistance can be equal to or higher than the stripe rust resistance of the hybrid parent wheat; if the stripe rust resistance of the two hybrid parent wheats is not the same, the stripe rust resistance of the wheat variety with high stripe rust resistance can be equal to or higher than the stripe rust resistance of the hybrid parent wheat with higher stripe rust resistance.

[0039] The present application also provides a product for detecting the polymorphism or genotype of the SNP site in the wheat genome, the SNP site can be the SNP site described above, the product contains the above-mentioned substance, and the product can be any one of the following:

[0040] C1) a product for detecting or assisting in detecting a single nucleotide polymorphism or genotype related to wheat resistance to wheat stripe rust,

[0041] C2) a product for identifying or assisting in identifying wheat resistance to wheat stripe rust,

[0042] C3) a product for wheat breeding,

[0043] C4) a product for screening or breeding wheat single plants or lines or strains or varieties according to wheat resistance to wheat stripe rust.

[0044] In the above-mentioned application, method and product, the substance can be a reagent or instrument required for determining the polymorphism or genotype of the SNP by at least one of the following methods: DNA sequencing, restriction enzyme fragment length polymorphism, single strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes chip based on nucleic acid hybridization reaction, chip based on single base extension reaction, chip based on allele-specific primer extension reaction, chip based on "one-step" reaction, chip based on primer ligation reaction, chip based on restriction enzyme reaction, chip based on protein DNA binding reaction, and chip based on fluorescence molecule DNA binding reaction.

[0045] Specifically, the product can be D1), D2) or D3) as follows:

[0046] D1) the product is a primer composition for amplifying a fragment of wheat genomic DNA including the SNP site,

[0047] D2) the product is a PCR reagent containing the primer composition of D1),

[0048] D3) the product is a kit containing the primer composition of D1) or the PCR reagent of D2).

[0049] In the above, the primer composition consists of primer F1-A, primer F1-B and primer R;

[0050] The primer F1-A is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 2 in the sequence listing or a single-stranded DNA with a nucleotide sequence of 22-44 of SEQ ID NO: 2 in the sequence listing;

[0051] The primer F1-B is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 3 in the sequence listing or a single-stranded DNA with a nucleotide sequence of 22-44 of SEQ ID NO: 3 in the sequence listing;

[0052] The primer R is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 4 in the sequence listing.

[0053] In the above applications, methods, and products, the primer composition can or can not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as 32P; binding moieties such as biotin; haptens such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with nucleic acid or protein sequences, as long as the sequence comprising the label is detectable. In some embodiments, the nucleic acid is detected directly without a label (e.g., the sequence is read directly).

[0054] The primer composition F1 can be a primer composition consisting of a single-stranded DNA having a nucleotide sequence of positions 22-44 of SEQ ID NO: 2 in the sequence listing, a single-stranded DNA having a nucleotide sequence of positions 22-44 of SEQ ID NO: 3 in the sequence listing, and a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 4 in the sequence listing, and the primer composition F1 can also be a primer set of a single-stranded DNA represented by SEQ ID NO: 2 in the sequence listing, a single-stranded DNA represented by SEQ ID NO: 3 in the sequence listing, and a single-stranded DNA represented by SEQ ID NO: 4 in the sequence listing. SEQ ID NO: 2 in the sequence listing consists of 44 nucleotides, the first to 21st nucleotides are a FAM sequence (as a label), and the 22nd to 44th nucleotides are a specific sequence; and SEQ ID NO: 3 in the sequence listing consists of 44 nucleotides, the first to 21st nucleotides are a HEX sequence (as a label), and the 22nd to 44th nucleotides are a specific sequence.

[0055] The present application also provides a DNA molecule having a nucleotide sequence of SEQ ID NO: 1 in the sequence listing.

[0056] The above DNA molecule can be obtained by PCR amplification of a wheat genomic gene using the primer composition F1.

[0057] The PCR amplification reaction system is 5 μL, including 2 μL of 2x KASP Master mix, 0.056 μL of primer composition F1, 2 μL of genomic DNA, and ultrapure water to make up to 5 μL.

[0058] The concentration of the forward specific primer F1-A and the forward specific primer F1-B in the primer composition F1 can both be 12 mmol / L, and the concentration of the universal reverse primer R can be 30 mmol / L. After synthesis of the primers, dry powder is centrifuged at 12000 rpm for 10 min, and then diluted with ddH2O to 100 mmol / L, respectively, and dissolved by vortexing. The solutions of the primers FAM, HEX and the universal primer are obtained. A 2D tube and caps are taken, 10Mm Tris-HCL 23 μL is added, 6 μL of the FAM and HEX solutions and 15 μL of the universal primer solution are taken, mixed and centrifuged to obtain a primer mixture.

[0059] The PCR amplification program can be: 94℃ pre-denaturation for 15 min, 95℃ denaturation for 20 s; 62℃ annealing for 60 s, 0.6℃ lower for each cycle, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 60 s, 30-40 cycles.

[0060] The application of the above-mentioned DNA molecule is also within the protection scope of the present application, and the application can be any one of the following:

[0061] E1) the application of the DNA molecule in identifying or assisting in identifying the wheat stripe rust resistance trait,

[0062] E2) the application of the DNA molecule in wheat breeding,

[0063] E3) the application of the DNA molecule in preparing a product for identifying or assisting in identifying the wheat stripe rust resistance trait,

[0064] E4) the application of the DNA molecule in preparing a product for wheat breeding.

[0065] E5) the application of the DNA molecule in a product for screening or breeding wheat single plants or strains or lines or varieties according to the wheat stripe rust resistance trait,

[0066] E6) the application of the DNA molecule in a product for assisting in screening or assisting in breeding wheat single plants or strains or lines or varieties according to the wheat stripe rust resistance trait.

[0067] Optionally, in the above-mentioned applications, the DNA molecule serves as a detection target.

[0068] The substance for detecting the SNP polymorphism and genotype or the haplotype can be combined with other substances (such as a substance for detecting other single nucleotide polymorphisms or genotypes of molecular markers related to the wheat stripe rust resistance) to prepare a product for identifying wheat stripe rust resistance varieties.

[0069] Compared with the prior art, the present application has the following advantages:

[0070] The application provides a KASP molecular marker of a wheat stripe rust resistance gene and an application thereof, and through a genome-wide association analysis (GWAS) technology, a stripe rust resistance gene Kukri_c2289_635 located on a 6B chromosome of wheat is successfully mined, and a specific KASP primer is designed based on a single base variation (SNP) thereof. The present application develops a marker for the Kukri_c2289_635 gene for the first time, and fills the blank of the molecular marker at the site. The designed KASP primer can accurately distinguish the resistant and susceptible materials, and has higher targeting for the specific SNP site of the Kukri_c2289_635 gene. A competitive allele-specific PCR (KASP) primer is designed according to a single base variation of the gene. The primer can distinguish the resistant and susceptible materials, and provides an effective molecular marker tool for subsequent disease resistance breeding. The SNP molecular marker identified in the application, the primer for detecting the SNP molecular marker and the corresponding detection typing method have the characteristics of high throughput, low cost and high accuracy, and provide a new technical means for molecular marker assisted selection of different wheat rust disease resistant wheat offspring, and can be used for molecular identification of wheat rust disease resistance. The application can provide a molecular marker detection tool for identification of stripe rust resistance germplasm resources and breeding of disease-resistant varieties, improve the selection efficiency and accelerate the breeding process. BRIEF DESCRIPTION OF DRAWINGS

[0071] Figure 1 is a genotype and stripe rust resistance analysis of 292 wheat.

[0072] Figure 2 is a typing result of 292 wheat varieties (lines). DETAILED DESCRIPTION

[0073] The application will be further described in detail below in conjunction with the specific embodiments. The examples provided below are only for illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the application.

[0074] In the following examples, the experimental methods are conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0075] In the following examples, the 300 wheat natural population varieties are as follows:

[0076] Wang R, Ren Y, Cheng YK, et al. Genome-wide association analysis of flag leaf morphological traits in wheat [J]. Crop Science, 2023, 49(11): 2886-2901.

[0077] Zhang Z, Cheng Y, Ren Y, et al. Genome-wide association study of grain-related traits in wheat (Triticum aestivum L.) [J]. Journal of Plant Genetic Resources, 2023, 24(04): 993-1006.

[0078] The above biological material can be obtained from Xinjiang Agricultural University, and the biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes.

[0079] Example 1, discovery of SNP molecular markers related to wheat stripe rust resistance genes

[0080] 1. Planting of test materials

[0081] The test materials were planted in the Xinjiang Yining City Ili State Agricultural Science Institute test base (86.25°E, 44.30°N, 2021-2022 referred to as 22YL, 2022-2023 referred to as 23YL) for 3 consecutive years, 2023-2024 in the Xinjiang Agricultural University Lugang campus test base (87.40°E, 43.94°N, 2023-2024 referred to as 24SP), and 2023-2024 in the Gansu Academy of Agricultural Sciences Qingshui test base (34.74°E, 106.14°N, 2022-2023 referred to as 24TS). 300 wheat natural populations were planted, using a randomized complete block design, with 3 rows of each material planted in the field, 1m in length, 0.2m in row spacing, with two repetitions, and randomized block arrangement. 1 row of Mingxian 169 was planted after each material as a diseased control material. In addition, 6 rows of diseased materials were sown around the rust nursery to ensure uniform infection of the stripe rust fungus, and the field management followed the local wheat production field management method.

[0082] 2. Detection of stripe rust resistance of test materials

[0083] After the wheat returned green and before the jointing stage, the mixed spores of pathogenic bacteria CYR32, CYR33, CYR34 races, water source pathogenic groups (Su11-4, Su11-5), and Guinong 22 pathogenic groups (G22-14) were prepared according to the ratio of 1g mixed spores: 2ml 96% Tween-20 solution: 2L distilled water to prepare a stripe rust suspension. The pathogenic bacteria were provided by Professor Jia Qiuzhen of the Institute of Plant Protection, Gansu Academy of Agricultural Sciences. Recorded in the following literature: Wang R, Cheng Y, Bai B, et al. Analysis of stripe rust resistance and disease resistance genes in Xinjiang wheat varieties (lines) [J]. Journal of Cereal Science, 2024, 44(11): 1423-1430.

[0084] The prepared stripe rust suspension was inoculated by spore suspension spray method. When the disease of the susceptible control was fully developed (the flag leaf severity of Ming 169 reached 80%), the flag leaf of 300 test materials was investigated for severity, diseased leaf rate and reaction type. The investigation was carried out every 7 days for a total of 3 times. The main investigation at the adult stage was based on disease severity (DS) (%). The severity was the percentage of the area of uredium on the diseased leaf to the total area of the leaf. The severity was recorded according to the 9-level standard of 0, 1%, 5%, 10%, 20%, 30%, 50%, 60%, 80% and 100%. The investigation standard of severity was in accordance with GB / T 15795-2011 "Technical specification for wheat stripe rust forecasting".

[0085] As shown in the severity in Table 1.

[0086] 3. Discovery of SNP molecular markers related to wheat stripe rust resistance genes

[0087] In this study, 292 local varieties and bred varieties (lines) from different regions were used as materials to investigate the disease severity (DS) and reaction type (IT) at the seedling stage and adult stage. Genome-wide association analysis was carried out using the wheat 90K chip. A total of 26 materials showed full-growth-period resistance to the current prevailing races CYR32 and CYR34 in four environments. DS and IT had high heritability and were significantly correlated. Through optimized compressed mixed linear model (ECMLM), a total of 261 marker-trait associations were detected at the seedling stage and adult stage, distributed on multiple chromosomes except 4D, 6D and 7D. Based on the decay distance of linkage disequilibrium, 12 adult-stage resistance loci were further determined, with a phenotype variation explanation rate of 0.01%-20.85%.

[0088] Through comparison with the Chinese Spring genome and the WheatOmics 1.0 database, a total of 12 candidate genes related to resistance were screened. In particular, the gene TraesCS3D01G511700 encoding NBS-LRR type disease resistance protein at the locus Kukri_c2289_635 had a phenotype explanation rate as high as 15.56%, was stably detected in four environments, had a significant genetic effect and a high frequency. LDBlock was drawn for the 1.73 Mb region upstream and downstream of the locus, and Kukri_c2289_635 located in the 596.72-596.92 Mb interval of chromosome 6B was found to have a high degree of linkage disequilibrium.

[0089] Example 2, Design of KASP Special Primer Related to Wheat Stripe Rust Resistance Genes and Establishment of Its Method

[0090] 1. Design of genome-specific primer for SNP site

[0091] The primer set F1 for identifying polymorphism of SNP site comprises three primers, which are as follows:

[0092] Forward specific primer F1-A (SEQ ID NO: 2): 5'- CAAGAGTGTGGGTCTTTCCTAAT-3'; GAAGGTGACCAAGTTCATGCT

[0093] Forward specific primer F1-B (SEQ ID NO: 3): 5'- CAAGAGTGTGGGTCTTTCCTAAC-3'; GAAGGTCGGAGTCAACGGATT

[0094] Universal reverse primer R (SEQ ID NO: 4): 5'- GTACAATAGGAGGTACGATGCCC-3'.

[0095] The nucleotide sequence of the KASP molecular marker containing the SNP site developed by the application is shown in SEQ ID NO: 1 (63 bp), and the nucleotide T or C at the 23rd position is represented by Y, which is as follows:

[0096] CAAGAGTGTGGGTCTTTCCTAAYAGTGTCTTCACGAAGATGGGCATCGTACCTCCTATTGTAC.

[0097] The underlined sequence in the primer F1-A is the FAM sequence; the underlined sequence in F1-B is the HEX sequence. The single-stranded DNA molecule amplified from the sequence shown in SEQ ID NO: 2 and SEQ ID NO: 4 is the fragment in SEQ ID NO: 1 with the SNP site being T, and the fluorescence signal of the fluorescent group combined with the FAM sequence in the template can be read by a microplate reader or a fluorescence quantitative PCR instrument;

[0098] The single-stranded DNA molecule amplified from the sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4 is the fragment in SEQ ID NO: 1 with the SNP site being C, and the fluorescence signal of the fluorescent group combined with the HEX sequence in the template can be read by a microplate reader or a fluorescence quantitative PCR instrument.

[0099] 2. Establishment of a method for detecting wheat resistance to wheat stripe rust gene using KASP molecular markers

[0100] 2.1 Extraction of sample genomic DNA

[0101] ​​Genomic DNA of the test wheat samples was extracted according to the plant genomic DNA extraction kit (catalog number: DP305) provided by TIANGEN and the kit instructions, and the specific steps were as follows:

[0102] S1, grind 100 mg of fresh or 20℃ frozen sample material in liquid nitrogen;

[0103] Test material: a natural population of 300 wheat varieties (lines) from home and abroad, see Table 1

[0104] S2, quickly transfer the ground powder to a centrifuge tube preloaded with 700 μL of buffer GP1 preheated to 65℃, which contains 0.1 wt% mercaptoethanol, mix well after quickly inverting, and place the centrifuge tube in a 65℃ water bath for 20 min, invert the centrifuge tube several times during the water bath process to mix the sample;

[0105] S3, add 700 μL of chloroform and mix well, centrifuge at 12000 rpm for 5 min; if the extracted plant tissue is rich in polysaccharides or starch, perform equal volume extraction with a 1:1 phenol and chloroform mixture in advance;

[0106] S4, transfer the upper aqueous phase obtained after centrifugation in S3 to a new centrifuge tube, add 700 μL of buffer GP2, and mix well;

[0107] S5, transfer the mixed liquid to the adsorption column CB3, centrifuge at 12000 rpm for 30 s, and discard the waste liquid;

[0108] S6, add 500 μL of buffer GD to the adsorption column CB3, and add ethanol at a ratio of 1:1. (In DNA extraction experiments, buffer GD usually needs to be pre-mixed with anhydrous ethanol to ensure that it can effectively bind DNA.

[0109] The specific steps and precautions for S6 are as follows:

[0110] (1) Preparation of buffer GD

[0111] Add anhydrous ethanol: Buffer GD needs to be mixed with a certain proportion of anhydrous ethanol before use. The specific proportion is described in the kit instructions (usually 1:1, for example, 1 mL of anhydrous ethanol is added to 1 mL of buffer GD).

[0112] Check if it has been added: If the buffer GD is pre-mixed (i.e. anhydrous ethanol has been added), no additional addition is required; if not pre-mixed, add anhydrous ethanol according to the instructions and mix well.

[0113] (2) Experimental steps

[0114] Add 500 μL Buffer GD (Ensure that Buffer GD has been added to the absolute ethanol) to the adsorption column CB3.

[0115] Centrifuge at 12,000 rpm for 30 seconds to make the liquid pass through the adsorption column.

[0116] Discard the waste liquid (The waste liquid contains impurities and the DNA is bound to the adsorption column).

[0117] (3) Matters needing attention

[0118] The role of absolute ethanol: Absolute ethanol is a key component of Buffer GD, which is used to adjust the polarity of the solution so that the DNA can be effectively bound to the adsorption column.

[0119] Centrifugal speed and time: Ensure that the centrifuge speed is 12,000 rpm and the time is 30 seconds to ensure that the liquid passes through the adsorption completely. 12000 rpm for 30 seconds, discard the waste liquid;

[0120] S7, add 600 μL of rinse liquid PW to the adsorption column CB3 (check whether absolute ethanol has been added before use), centrifuge at 12000 rpm for 30 seconds, rinse again after discarding the waste liquid;

[0121] S8, put the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, discard the waste liquid, and place the adsorption column CB3 at room temperature to dry completely the residual rinse liquid in the adsorption material;

[0122] S9, put the adsorption column CB3 into a clean centrifuge tube, add 50-200 μL of elution buffer TE with pH value between 7.0-8.5 to the middle of the adsorption membrane, and place it at room temperature for 2-5 min, centrifuge at 12000 rpm for 2 min to collect the DNA solution;

[0123] S10, use the ultraviolet spectrophotometer to detect the content and purity of the DNA, and the results show that the A260 / 280 of the measured sample is between 1.8-2.0, indicating that the extracted DNA has high purity.

[0124] 2.2 PCR amplification and fluorescence signal detection

[0125] The genomic DNA obtained in 2.1 is used as a template, DNA dilution and transfer are performed on a TECAN liquid automation workstation, the entire PCR process is completed on a Douglas Scenfitic Array Tape platform, DNA and PCR mix are added to the 384 PCR reaction Array Tape on a Nexar workstation, the PCR reaction is completed in a Soellex water bath, fluorescence intensity is detected on an Araya, data is read, program setting and data analysis are completed in an Intellics management system;

[0126] After the primer synthesis, dry powder is centrifuged at 12000 rpm for 10 min, and is diluted with ddH2O to 100 mmol / L, respectively, and is fully vortexed and dissolved to obtain primer FAM, HEX and universal primer solutions. Take 2D tubes and caps, add 10Mm Tris-HCL 23 μL, take 6 μL of FAM and HEX solutions, and 15 μL of universal primer solution, mix and centrifuge to obtain a primer mixture.

[0127] The PCR amplification reaction system is 5 μL, including 2 μL of 2×KASP Master mix, 0.056 μL of primer composition F1, 2 μL of genomic DNA, and ultrapure water to 5 μL.

[0128] The PCR amplification program can be: 94℃ pre-denaturation for 15 min, 95℃ denaturation for 20 s; 62℃ annealing for 60 s, decreasing by 0.6℃ for each cycle, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 60 s, 35 cycles;

[0129] The PCR amplification reaction system is 5 μL, including 2 μL of 2×KASP Master mix, 0.056 μL of primer composition F1, 2 μL of genomic DNA, and ultrapure water to 5 μL.

[0130] The fluorescence signal is read on an Araya fluorescence reader, data reading is performed using Douglas Scenfitic company Intell ics software, and result analysis is performed using Douglas Scenfitic company Intellics software for genotyping, and the results are shown in Table 1 and Figure 2 .

[0131] Among the 300 wheat varieties (lines), 244 varieties show genotype CC, 48 varieties show genotype TT, 6 varieties show genotype CT, and another 2 varieties are not detected for specific genotypes. The resistance of TT genotype wheat to stripe rust is higher than that of CC genotype wheat.

[0132] Table 1 Genotype and stripe rust resistance of 300 wheat materials

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141] Note: "?" represents missing phenotype or genotype data.

[0142] The following examples use statistical software to process data, and the experimental results are expressed as mean ± standard deviation, and One-way ANOVA test is used, P<0.05 (*) indicates significant difference.

[0143] The significant difference of two genotypes and stripe rust resistance was analyzed, and the results are shown in Table 2 and Figure 1 The genotype of Kukri_c2289_635 of the test wheat with TT homozygous type is higher than that of the test wheat with CC homozygous type.

[0144] Table 2 Genotype and stripe rust resistance of 292 wheat materials

[0145]

[0146] The above results show that Kukri_c2289_635 is related to the resistance of wheat stripe rust: the resistance of wheat with Kukri_c2289_635 genotype of TT is significantly higher than that of wheat with Kukri_c2289_635 genotype of CC, and Kukri_c2289_635 genotype of TT can be used as a molecular marker for identifying or assisting in identifying the resistance of different strains of wheat stripe rust. In wheat breeding with the purpose of breeding wheat with high resistance to stripe rust, wheat with Kukri_c2289_635 genotype of TT can be selected as the parent for breeding.

[0147] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the application.

Claims

1. An application for detecting SNP polymorphisms or genotypes in the wheat genome, characterized in that, The SNP is a site in the wheat genome, and its nucleotide type is T or C, specifically the 101st nucleotide of SEQ ID NO: 1 in the sequence listing; the application is any of the following: A1) The application of the substance described in identifying or assisting in the identification of wheat resistance to wheat stripe rust. Application of the substance described in A2) in wheat breeding A3) The application of the substance described therein in the preparation of products for identifying or assisting in the identification of wheat resistance to wheat stripe rust. A4) The application of the substance described therein in the preparation of products for wheat breeding.

2. The application according to claim 1, characterized in that, The substance is B1), B2), or B3): B1) The substance described is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites. B2) The substance described is a PCR reagent containing the primer composition described in B1). B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

3. A method for identifying or assisting in the identification of wheat resistance to wheat stripe rust, characterized in that, The method includes detecting the genotype of SNP sites in the genome of the wheat to be tested, and identifying or assisting in the identification of wheat resistance to wheat stripe rust based on the genotype, wherein the SNP site is the SNP site described in claim 1.

4. The application of the method of claim 3 in wheat breeding.

5. A method for wheat breeding, characterized in that, The method includes detecting the genotype of the SNP locus in claim 1 in the wheat genome, selecting wheat with the genotype TT at the SNP locus as a parent for breeding, wherein TT is the homozygous type of the SNP locus T.

6. A product for detecting SNP polymorphisms or genotypes in the wheat genome, characterized in that, The SNP site is the SNP site of claim 1, the product contains the substance of claim 1, and the product is any one of the following: C1) Products that detect or assist in the detection of single nucleotide polymorphisms or genotypes related to wheat resistance to wheat stripe rust. C2) Products used to identify or assist in the identification of wheat resistance to wheat stripe rust. C3) Products used in wheat breeding C4) Products of wheat plants, strains, varieties or cultivars selected or bred based on wheat resistance to wheat stripe rust.

7. The product according to claim 6, characterized in that, The product is either D1), D2), or D3): D1) The product described is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites. D2) The product described is a PCR reagent containing the primer composition described in D1). D3) The product is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The application according to claim 2 or the product according to claim 7, characterized in that, The primer composition consists of primer F1-A, primer F1-B, and primer R; The primer F1-A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or is a single-stranded DNA molecule whose nucleotide sequence is positions 22-44 of sequence 2 in the sequence listing; The primer F1-B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-44 of sequence 3 in the sequence listing; The primer R nucleotide sequence is the single-stranded DNA molecule of sequence 4 in the sequence listing.

9. A DNA molecule, characterized by, The nucleotide sequence of the DNA molecule is sequence 1 in the sequence listing.

10. The application of the DNA molecule according to claim 9, characterized in that, The application is any one of the following: E1) The application of the DNA molecule described in the identification or auxiliary identification of wheat resistance to wheat stripe rust. The application of the DNA molecules described in E2) in wheat breeding E3) The application of the DNA molecule described therein in the preparation of products for identifying or assisting in the identification of wheat resistance to wheat stripe rust. The application of the DNA molecules described in E4 in the preparation of wheat breeding products. E5) The application of the DNA molecule described therein in the screening or breeding of wheat individual plants, lines, strains, or varieties based on wheat resistance to wheat stripe rust. E6) The application of the DNA molecule described therein in the auxiliary screening or breeding of wheat single plants, lines, strains or varieties based on the wheat resistance to wheat stripe rust trait.

Images