Application of inhibitor of targeted Xirp2 gene in preparation of medicine for preventing or treating myocardial fibrosis

Abstract

The invention belongs to the technical field of gene therapy, and particularly relates to application of an inhibitor of a targeted Xirp2 gene in preparation of a medicine for preventing or treating myocardial fibrosis. In order to determine the effect of the actin binding protein Xirp2 in the cardiac hypertrophy process caused by pathological matrix hardness-induced myocardial cell hypertrophy and pressure overload, the invention provides application of an inhibitor of a targeted Xirp2 gene in preparation of a medicine for preventing or treating myocardial fibrosis. The inhibitor is siRNA of which the nucleotide sequence is shown as SEQ ID NO: 1-3 or shRNA of which the nucleotide sequence is shown as SEQ ID NO: 4. The invention finds that Xirp2 is related to myocardial hypertrophy caused by myocardial cell hypertrophy induced by pathological matrix hardness and myocardial hypertrophy caused by pressure overload for the first time, and after expression of Xirp2 is knocked down in vivo and in vitro, myocardial hypertrophy can be relieved. Therefore, the invention develops a new application of the inhibitor targeting the Xirp2 gene, develops a new medicine and a new treatment mode for myocardial fibrosis, and has great significance.

Description

Technical Field

[0001] This invention belongs to the field of gene therapy technology, specifically relating to the use of an inhibitor targeting the Xirp2 gene in the preparation of drugs for the prevention or treatment of myocardial fibrosis. Background Technology

[0002] Pathological myocardial hypertrophy is a common pathological manifestation of cardiovascular disease, involving multi-level remodeling processes including neurohumoral molecules, myocardial inflammation, metabolism, and cardiac mechanomechanics. Its long-term development can lead to cardiac decompensation and ultimately heart failure. Conditions such as aortic sclerosis, stenosis, and arterial hypertension can all cause the heart to be subjected to pressure overload, and pressure overload is one of the initiating factors of myocardial hypertrophy. The main pathological manifestations of myocardial hypertrophy are the abnormal accumulation (fibrosis) of components such as collagen in the extracellular matrix (ECM) and cardiomyocyte hypertrophy (increased volume). As myocardial hypertrophy progresses, components in the ECM accumulate and undergo extensive cross-linking, including collagen. These pathological changes lead to an increase in ECM stiffness, resulting in decreased myocardial tissue compliance and impaired diastolic function. Currently, how increased myocardial ECM stiffness regulates the process of pressure overload-induced myocardial hypertrophy and its potential mechanobiological mechanisms are among the research hotspots in the fields of myocardial hypertrophy, myocardial fibrosis, and heart failure.

[0003] Previous studies have shown that the ECM-integrin-cytoskeleton pathway is a classic mechanotransmission pathway. The microfilaments in the cytoskeleton are mainly composed of actin and actin-binding proteins. The actin cytoskeleton plays a significant role in cellular responses to changes in the mechanoenvironment. Under conditions such as hypertension leading to increased myocardial pressure load, cardiomyocytes experience increased mechanical stress. To adapt to this mechanical change, actin within cardiomyocytes undergoes remodeling. Actin-binding proteins play a crucial regulatory role in the dynamic changes of actin filament depolymerization and polymerization. However, the role of actin-binding proteins in cardiomyocyte hypertrophy caused by increased ECM stiffness remains unreported.

[0004] Xirp2 is an evolutionarily conserved actin-binding protein containing the Xin repeat sequence, abundant in cardiomyocytes and primarily located in the mechanosensitive regions of cardiomyocytes, namely the intercalated discs of the heart. However, whether changes in ECM stiffness can regulate the expression and function of Xirp2 in cardiomyocytes in cardiac diseases, and whether abnormal expression of Xirp2 can participate in the progression of myocardial hypertrophy, has not yet been reported. Summary of the Invention

[0005] The technical problem to be solved by this invention is to clarify the role of actin-binding protein Xirp2 in the process of myocardial hypertrophy induced by pathological matrix stiffness and myocardial hypertrophy caused by pressure overload, and to develop a new drug for the treatment of myocardial fibrosis.

[0006] Therefore, the technical solution of the present invention to solve the above-mentioned technical problems is: to provide the use of an inhibitor targeting the Xirp2 gene in the preparation of a drug for the prevention or treatment of myocardial fibrosis.

[0007] In the above-mentioned uses, the inhibitor is siRNA or shRNA.

[0008] Furthermore, the siRNA comprises sequences selected from SEQ ID NO:1-3.

[0009] Furthermore, the nucleotide sequence of the shRNA is shown in SEQ ID NO:4.

[0010] Furthermore, the aforementioned myocardial fibrosis can also be myocardial hypertrophy.

[0011] In a second aspect, the present invention also provides a pharmaceutical composition for the prevention or treatment of myocardial fibrosis, comprising the above-mentioned inhibitor and a pharmaceutically acceptable carrier.

[0012] In a third aspect, the present invention also provides a recombinant AAV vector comprising: a nucleotide sequence encoding the Xirp2 protein, a specific promoter TNT, and an AAV9 capsid protein.

[0013] Furthermore, the nucleotide sequence encoding the Xirp2 protein is shown in SEQ ID NO:4.

[0014] Furthermore, the construction sequence of the recombinant AAV vector is AAV9-cTNTpromoter-shXirp2.

[0015] In a fourth aspect, the present invention also provides the use of the above-mentioned recombinant AAV vector in the preparation of medicaments for the prevention or treatment of myocardial fibrosis.

[0016] Furthermore, in the above-mentioned uses, the myocardial fibrosis can also be myocardial hypertrophy.

[0017] The beneficial effects of this invention are as follows: This invention, through screening actin-binding proteins associated with stress-induced myocardial fibrosis, first discovered that Xirp2 is related to both pathological matrix stiffness-induced cardiomyocyte hypertrophy and stress-induced myocardial hypertrophy. Therefore, this invention, by knocking down endogenous Xirp2 expression in vitro with specific siRNA, found that the hypertrophic phenotype of neonatal rat cardiomyocytes (NRCMs) induced by pathological ECM stiffness was significantly alleviated. Subsequently, an adeno-associated virus (AAV9-sh-Xirp2) specifically knocking down Xirp2 expression was constructed in vivo, and studies showed that targeting cardiomyocytes to specifically knock down Xirp2 expression significantly alleviated stress-induced myocardial hypertrophy. Therefore, this invention provides the use of an inhibitor targeting the Xirp2 gene in the preparation of drugs for the prevention or treatment of myocardial fibrosis, offering a new treatment approach for myocardial fibrosis. Attached Figure Description

[0018] Figure 1 The diagram shows increased expression of genes such as actin-binding protein Xirp2 in mouse models of myocardial hypertrophy induced by TAC surgery and cardiomyocyte hypertrophy induced by pathological sclerosis. Figure A shows a schematic diagram of RNA sequencing and analysis of cardiac tissue and cardiomyocytes hypertrophied by pathological sclerosis in a mouse TAC-induced myocardial hypertrophy model. Figure B shows an intersection analysis of 2015 genes upregulated in hypertrophic mouse hearts and 459 genes upregulated in hypertrophic cardiomyocytes, identifying 92 differentially expressed genes (DEGs) that were co-upregulated in both models.

[0019] Figure 2 The image shows how knocking down Xirp2 expression with specific siRNA can alleviate pathological hard matrix-induced cardiomyocyte hypertrophy. A shows the changes in protein expression levels of cardiomyocyte hypertrophy markers ANP and BNP after transfection with si-Xirp2 on matrices of different hardness (Western Blot method); B is a statistical graph showing the changes in protein expression levels of cardiomyocyte hypertrophy markers ANP and BNP after transfection with si-Xirp2 on matrices of different hardness (n=3 per group); C shows the changes in cardiomyocyte surface area detected by fluorescence staining after transfection with si-Xirp2 on matrices of different hardness, and a statistical graph showing the surface area of ​​cardiomyocytes in each group. Changes in cardiomyocyte area were detected by immunofluorescence 24 h after knocking down Xirp2 expression with si-Xirp2 (n>50); Xirp2 (red), DAPI (blue), α-actinin (green); * p < 0.05, ** p < 0.01, *** p < 0.001, **** p<0.0001, ns p >0.05.

[0020] Figure 3 The image shows an adeno-associated virus 9 (AAV9) vector that specifically inhibits Xirp2 expression in cardiomyocytes during an in vivo mouse study. It is named pHBAAV-cTNT-mCherry vector.

[0021] Figure 4 The diagram shows that targeted knockdown of Xirp2 significantly improved myocardial hypertrophy and impaired cardiac function induced by TAC surgery in mice. A is the overall animal experiment flowchart, which describes the administration of 1×10⁻⁶ mmol / L via tail vein injection to mice 2 weeks (2 weeks) before TAC surgery. 11 Vg dose of AAV9 virus was administered, and echocardiography was performed 4 weeks after TAC surgery to examine cardiac function, as well as subsequent anatomical, pathological staining, and molecular biological tests. B shows representative echocardiographic images of each group of mice 28 days after sham surgery or TAC surgery. C shows that after AAV9 treatment, the damaged cardiac function showed a more significant improvement, with the cardiac ejection fraction (EF) and left ventricular fractional shortening (FS value) of the TAC+sh-Xirp2 group increasing by 51% and 52%, respectively, compared to the TAC+sh-NC group. D shows that in terms of cardiac function, left ventricular mass (LV mass) and left ventricular end-diastolic diameter (LVIDd) decreased by 36% and 18%, respectively, compared to the TAC+sh-NC group. E shows a gross image of the hearts of mice in each group: after AAV9-sh-Xirp2 treatment, the hearts of mice in the TAC+sh-Xirp2 group were significantly smaller; F shows that after AAV9-sh-Xirp2 treatment, compared with the TAC+sh-NC group, the heart-to-tibia ratio (HW / TL) and heart-to-body ratio (HW / BW) of mice in the TAC+sh-Xirp2 group were significantly lower; G shows representative images of HE, WGA, and Masson staining of the hearts of mice in each group; * p < 0.05, ** p < 0.01, *** p < 0.001, **** p <0.0001 indicates a statistically significant difference between the two groups (ns). p A value >0.05 indicates that there is no statistically significant difference between the two groups. Detailed Implementation

[0022] In the experiments of this invention, we first constructed a pathological matrix stiffness-induced NRCMs hypertrophy model and a TAC-induced mouse myocardial hypertrophy model. Through RNA sequencing and bioinformatics analysis, we screened and verified that the expression of actin-binding protein Xirp2 was significantly increased during NRCMs hypertrophy and myocardial hypertrophy.

[0023] Furthermore, we clarified the function of Xirp2 in in vitro and in vivo models, and explored its mechanism of action in cardiomyocyte hypertrophy and myocardial hypertrophy. The results showed that the actin-binding protein Xirp2 was elevated in cardiomyocyte hypertrophy induced by pathological matrix stiffness and myocardial hypertrophy induced by pressure overload. In in vitro experiments, specific knockdown of endogenous Xirp2 expression significantly alleviated cardiomyocyte hypertrophy induced by pathological matrix stiffness. In in vivo animal experiments, specific targeting of cardiomyocytes to knock down Xirp2 expression alleviated the degree of myocardial hypertrophy and fibrosis in mice induced by pressure overload, and improved impaired cardiac function in mice.

[0024] In summary, in vivo and in vitro experiments have shown that moderate intervention in Xirp2 expression can alleviate myocardial hypertrophy and cardiomyocyte hypertrophy phenotypes. Xirp2 may be a very promising therapeutic target for improving myocardial hypertrophy, and this study provides a new therapeutic approach for the treatment of myocardial fibrosis or its potential subsequent heart failure.

[0025] The specific implementation of the present invention will be further explained and described below through examples, but this does not mean that the scope of protection of the present invention is limited to the scope described in the examples.

[0026] Unless otherwise specified, the instruments and reagents used in the embodiments of this invention are all commercially available products.

[0027] Example 1: Screening and validation of actin-binding proteins that play a key role in pathological sclerosis-induced cardiomyocyte hypertrophy and pressure overload-induced myocardial hypertrophy.

[0028] (I) Constructing a model of cardiomyocyte hypertrophy induced by pathological hard stromal tissue We prepared four PDMS matrices with different hardnesses by adjusting the ratio of polydimethylsiloxane (PDMS) curing agent to prepolymer, with mixing ratios of 1:50, 1:30, 1:15, and 1:5 (v / v). The Young's modulus of the PDMS adhesives with different hardnesses was measured using atomic force microscopy (AFM), and the values ​​were 23.79 ± 0.61 kPa (1:50), 197 ± 160 kPa (1:30), 457 ± 390 kPa (1:15), and 1014 ± 560 kPa (1:5), respectively.

[0029] Primary neonatal SD rat cardiomyocytes (NRCMs) were isolated and cultured in vitro using a modified trypsin-collagenase two-step digestion method. SPF-grade SD rat suckling mice (0-3 days old) were used, and the experiment was approved by the animal ethics department of West China Hospital of Sichuan University. The suckling mice were purchased from Chengdu Dashuo Biotechnology Co., Ltd.

[0030] The steps for primary isolation of neonatal rat cardiomyocytes are as follows: (1) All instruments used, including curved forceps, ophthalmic straight scissors, curved scissors, etc., should be sterilized by high pressure and then dried in advance; (2) Spray the surface of the suckling mouse with 75% medical alcohol for rapid disinfection. Hold the suckling mouse by the back of its neck with your left hand to expose its chest. Hold ophthalmic straight scissors in your right hand to cut open the skin and sternum, and use your left hand to push upwards slightly to squeeze out the heart and cut it off; (3) Transfer the heart to a pre-cooled PBS solution on an ice box.

[0031] (4) Gently squeeze the blood out of the heart with curved forceps. Transfer the heart to fresh, pre-cooled PBS solution and wash twice more; (5) After washing out the blood clots inside the heart, transfer the blood to a new culture dish, add a small amount of 0.25% trypsin using a Pasteur pipette, and cut it into small pieces with curved scissors until the pieces are about 1 mm in size. 3 .

[0032] (6) Transfer the heart tissue block to a centrifuge tube containing 10 mL of 0.25% pancreatic enzyme and digest it slowly on a shaker at 4°C for 2 hours.

[0033] (7) Stop digestion by using complete culture medium to treat the supernatant enzyme solution after digestion.

[0034] (8) The remaining tissue block was aspirated into a centrifuge tube containing 10 mL of type II collagenase digestion solution (prepared in L15 medium, 1.5 mg / mL), and the tissue block was gently dispersed with a Pasteur pipette. The tube was then placed at 37°C and rotated for 30 min to continue digestion.

[0035] (9) Gently blow the cells again with a Pasteur pipette to fully release them, and transfer the supernatant to an equal volume of complete culture medium to stop digestion.

[0036] (10) Add 8 mL of type II collagenase solution to the remaining small amount of tissue block in the tube, pipette and then rotate digest at 37°C again until the tissue block is completely digested, and then transfer it to an equal volume of complete culture medium to stop digestion. (11) Mix the three cell suspensions thoroughly, filter through a cell filter (200 mesh), centrifuge at room temperature for 5 min (400 xg), collect the cells and resuspend them in complete culture medium.

[0037] (12) The resuspended cells were seeded in T75 cell culture flasks and placed in an incubator for differential adhesion.

[0038] (13) After 35 min, the cells were removed. At this time, the culture medium contained non-adherent cardiomyocytes. The supernatant was collected. (14) After cell counting, dilute to 5 × 10⁻⁶. 6 Cells / mL. Inoculate onto PDMS substrate that has undergone hydrophilic pretreatment.

[0039] (15) The next day, wash the non-adherent cells 1-2 times with preheated PBS solution, then change the medium and starve them.

[0040] The isolated and purified NRCMs were seeded onto the surface of PDMS substrates with different hardness gradients (1:50, 1:30, 1:15, 1:5) that had undergone hydrophilic pretreatment. After incubation at 37°C and 5% CO2 for 48 h, total RNA was extracted from the cells using an RNA extraction kit. Subsequent RT-qPCR detection was then performed.

[0041] For RT-qPCR detection, the reaction system (Rever Tra Ace qPCR RT Kit) was first prepared by reverse transcribing RNA into cDNA, with a final volume of 20 μL. The reaction system consisted of: 2 μL of gDNA Clean Reaction Mix VER.2 and 5×Evo M-MLVRT Reaction Mix VER.2. *8 4 μL of RNA and 1 μg of RNase-free ddH2O were added, totaling 14 μL. The reaction conditions were: 37℃ for 15 min, followed by 85℃ for 5 s. Then, using AG Biotech's SYBR Green, a final reaction volume of 20 μL was prepared. The reaction mixture consisted of: 6 μL ddH2O, 2 μL cDNA, 1 μL Primer F (10 µM), 1 μL Primer R (10 µM), and 2×SYBR Green Pro Taq HS Premix. *1 10 μL. (4) The reaction conditions for RT-qPCR are shown in Table 1 below.

[0042]

[0043] PCR results showed that the gene expression level of the cardiomyocyte hypertrophy marker Anp gradually increased with the increase of matrix stiffness, and Bnp expression also gradually increased in the stiffness of 1:50-1:15, but decreased in the 1:5 matrix.

[0044] Based on the experimental results, we ultimately selected a PDMS substrate with a pressure of 23.79±0.61 kPa (curing agent to gel ratio of 1:50) as the physiological soft substrate to simulate the mechanical microenvironment of healthy myocardial tissue. At the same time, we selected a PDMS substrate with the best stability and repeatability with a pressure of 1014±560 kPa (curing agent to gel ratio of 1:5) as the pathological stiff substrate to simulate the mechanical properties of hypertrophic myocardial tissue.

[0045] (ii) Screening key actin-binding proteins After establishing the pathological hard matrix-induced NRCM hypertrophy model, we performed transcriptomics studies. NRCMs were cultured on PDMS gels in both the Soft and Stiff groups for 48 h to induce hypertrophy. Two μg of total RNA was extracted, and rRNA was removed using the Ribo-Zero™ Gold Kits. NEBNext was used for further analysis. ® Strand-specific reagent kits were used to construct strand-specific libraries from the recovered RNA. Library quality control and quantification were performed using an Agilent 2100 bioanalyzer. After the test results met the standards, subsequent Illumina sequencing was commissioned to Zhongke Pury Co., Ltd. Simultaneously, related analyses were performed using total transcriptome sequencing data of total RNA from myocardial tissue of Sham_4w and TAC-4w ​​mice (commissioned by Novogene Co., Ltd., relevant data uploaded to a public database, ID: PRJNA787574). Figure 1 (As shown in A). We found that compared with the soft substrate group, 459 genes were significantly upregulated in the stiff substrate group (Stiff) (Fold change>2, P<0.05), while 2015 genes were significantly upregulated in the TAC-4w ​​group compared with the Sham-4w group (Fold change>2, p<0.05). Further gene set intersection analysis using Venny 2.1 identified 92 differentially expressed genes that were co-upregulated in both models (e.g., ...). Figure 1(As shown in B). We used the DAVID bioinformatics resource (Version 6.8, https: / / david.ncifcrf.gov / summary.jsp) to perform functional annotation on 92 DEGs. Through pathway analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) analysis, we revealed the key signaling pathways and biological processes that these differentially expressed genes may be involved in. The results showed that the 92 co-upregulated differentially expressed genes were significantly enriched in multiple biological processes and signaling pathways closely related to myocardial remodeling, especially pathways related to actin binding, extracellular matrix remodeling, and cytoskeleton regulation. Subsequently, we used heatmap analysis to screen out six key genes that were significantly upregulated in the actin binding pathway and whose expression was stable across different samples: Enah, Xirp2, Synpo2l, Tpm2, Map1a, and S100a4.

[0046] A pressure overload-induced myocardial hypertrophy model was constructed using TAC surgery, following the same method as previously published in our group. RNA was extracted from cardiomyocytes cultured in substrates of different stiffness and from left ventricular tissue of pressure overload-induced myocardial hypertrophy mice (TAC-4w), and mRNA expression was detected using RT-qPCR. The results showed that Xirp2, Enah, and Synpo2l were significantly upregulated in both myocardial tissue and cardiomyocytes cultured in hard substrates in the TAC-4w ​​group mice. p <0.01), indicating that these three genes may be involved in the process of myocardial hypertrophy induced by both in vivo and in vitro models.

[0047] Next, through co-expression network analysis of single-cell mRNA sequencing database (GSE120064) of TAC model mouse heart tissue, we found that Xirp2 and the hypertrophic marker ANP (Nppa) exhibited significant spatial co-localization characteristics in specific cardiomyocyte subsets. This suggests that Xirp2 may play a potentially crucial role in the pathological process of myocardial hypertrophy.

[0048] Example 2: In vitro experimental verification of Xirp2 function

[0049] To investigate the functions of Xirp2, Enah, and Synpo2l in cardiomyocyte hypertrophy, we designed three specific small interfering RNAs (siRNAs) to target and inhibit the endogenous expression of these three genes. The three siRNAs were named si-Xirp2-001, si-Xirp2-002, and si-Xirp2-003, and their nucleotide sequences are shown in SEQ ID NO:1-3 (SEQ ID NO:1's nucleotide sequence is CCACAACAGGCAAGAAATA; SEQ ID NO:2's nucleotide sequence is GCAGACAAGAAAGAACATAA; SEQ ID NO:3's nucleotide sequence is GCAGAAAACATCCACTAAGA). The siRNAs for the other five genes were named si-ETV4-001 (ATGGAAATCAGGAACAAACTG), si-CREB3-002 (GCACGTCTCCATAGATCTA), si-STAT3-001 (GCAGGATCTAGAACAGAAA), si-Enah-001 (GTGGCTTAATGGAAGAAAT), and si-Synpo2l-001 (GGCATCAGCCATACCAACT), with nucleotide sequences shown in SEQ ID NO: 6-10. Simultaneously, scrambled siRNA was transfected as a negative control group (siNC).

[0050] RT-qPCR results showed that the knockdown efficiency of all three siRNA sequences exceeded 90%, effectively inhibiting the expression of endogenous genes. This confirms that our designed siRNAs have a highly efficient and specific gene silencing effect, providing a reliable tool for subsequent functional studies. Based on the knockdown efficiency, we continued our experiments using si-Xirp2-001.

[0051] Based on the verification of siRNA knockdown efficiency, we further investigated the effects of Xirp2, Enah, and Synpo2l gene silencing on NRCM hypertrophy induced by pathological matrix stiffness. The specific experimental design is as follows: NRCMs were seeded in PDMS matrices of different hardness for 24 hours, and then the Soft and Stiff groups were transfected with si-NC (negative control), siXirp2, siEnah, or siSynpo2l, respectively. After 12 hours of culture, the medium was changed, and the cells were cultured for another 12 hours. Cell RNA was collected, and the expression changes of NRCM hypertrophy markers (Anp, Bnp, and Myh7) were detected.

[0052] The results showed that, compared with the Stiff-siNC group, knockdown of Synpo2l did not significantly improve the hypertrophic phenotype of NRCMs induced by hard matrix, and the gene expression levels of Anp, Bnp, and Myh7 remained high or increased. While knockdown of Enah partially alleviated Bnp expression, the expression levels of Anp and Myh7 also remained high or increased. However, silencing the Xirp2 gene significantly inhibited hard matrix-induced NRCM hypertrophy, as evidenced by a significant reduction of approximately 40% in the expression levels of Anp, Bnp, and Myh7 in cardiomyocytes compared to the Stiff-siNC group. This result suggests that Xirp2 may play a key regulatory role in the hypertrophy of NRCMs induced by pathological matrix stiffness.

[0053] Further Western blot results showed that, after the addition of siXirp2, compared with the Stiff+siNC group, the expression of ANP and BNP in NRCMs in the Stiff+siXirp2 group decreased by approximately 52% and 19%, respectively. Figure 2 A, 2B). Immunofluorescence assay results showed that, compared with the Stiff+siNC group, the cell area of ​​NRCMs in the Stiff+siXirp2 group was reduced by approximately 39% ( Figure 2 C).

[0054] In summary, we have demonstrated that specific knockdown of the Xirp2 gene can significantly reduce the hypertrophy of NRCMs induced by pathological hard stromal tissue.

[0055] Example 3: Animal in vivo experiments to verify the function of Xirp2 We constructed an AAV adeno-associated virus (AAV9-cTNTpromoter-Xirp2, sh-Xirp2 refers to the shRNA of the mouse Xirp2 gene knocked down by carrying the cTNT promoter (targeting cardiomyocytes). The adeno-associated virus was synthesized by Hanheng Biotechnology Co., Ltd.

[0056] The sequence of mouse Xirp2 shRNA is GCATATCCATCCAGAGTTAAG (SEQ ID NO:4); the reverse complementary sequence is CTTAACTCTGGATGGATATGC (SEQ ID NO:5). The AAV9-cTnT-Xirp2 vector map is shown below. Figure 3 As shown.

[0057] We administered 1×10⁻⁶ doses via tail vein injection to mice 2 weeks prior to TAC surgery. 11Vg dose of AAV9 virus, echocardiography to assess cardiac function 4 weeks after TAC, and subsequent anatomical, pathological staining and molecular biological tests. Figure 4 A).

[0058] The animals were grouped as follows: (1) Sham_4w+sh-NC: Sham injection negative control group; (2) Sham_4w+sh-Xirp2: Sham injection target virus group; (3) TAC_4w+sh-NC: TAC injection negative control group; (4) TAC_4w+sh-Xirp2: TAC injection target virus group.

[0059] We performed echocardiography and pathological examination 4 weeks after TAC. The ultrasound results are as follows: Figure 4 As shown in Figure B, at 4 weeks post-TAC surgery, mice in the TAC_4w+sh-NC group showed significantly impaired cardiac function compared to the Sham_4w+sh-NC group, with FS and EF values ​​decreasing by 48% and 49%, respectively; LVIDd, LV mass, and LVPWd increased by 19%, 80%, and 36%, respectively. After AAV9 treatment, the TAC_4w+sh- Xirp2 Compared to the TAC_4w+sh-NC group, the TAC_4w+sh- group showed a more significant improvement in impaired cardiac function. Xirp2 The EF and FS values ​​of the group were 51% and 52% higher than those of the TAC_4w+sh-NC group, respectively. Figure 4 C); LVmass and LVIDd decreased by 36% and 18% respectively compared with the TAC_4w+sh-NC group, but IVSd and LVPWd showed no significant change. Figure 4 D).

[0060] Observation of mouse hearts revealed that 4 weeks after TAC surgery, the hearts in the TAC_4w+shNC group showed significantly greater enlargement compared to the Sham_4w+sh-NC group; after AAV9-sh- Xirp2 Treatment, TAC_4w+sh- Xirp2 The hearts of the mice in the group were significantly smaller ( Figure 4 E). It was also observed that compared to the Sham_4w+sh-NC group, the heart-to-tibia ratio (HW / TL) and heart-to-body ratio (HW / BW) in the TAC_4w+sh-NC group increased by 1.0-fold; while compared to the TAC_4w+sh-NC group, the HW / TL and HW / BW in the TAC_4w+sh-Xirp2 group decreased by approximately 41% and 44%, respectively. Figure 4 F).

[0061] Next, we embedded the heart tissue to prepare pathological paraffin blocks, and then stained them with HE, WGA, and Masson staining. We observed the hypertrophy of cardiomyocytes in each group. Statistical results showed that, in terms of the cross-sectional area of ​​mouse myocardium, the TAC_4w+sh-NC group increased by 2.6 times compared to the Sham_4w+sh-NC group; and the TAC_4w+sh-Xirp2 group decreased by 40% compared to the TAC_4w+sh-NC group. Regarding collagen deposition, Masson staining results showed that mice in the TAC_4w+shNC group had a 10-fold increase compared to the Sham_4w+sh-NC group; while the TAC_4w+sh-Xirp2 treatment group had a 59% decrease compared to the TAC_4w+sh-NC group. Figure 4 G).

[0062] The statistical results of myocardial fibrosis and myocardial cell area in each group of mice showed that the myocardial area of ​​mice in the TAC+shXirp2 group was significantly reduced compared with that in the TAC+shNC group.

[0063] Subsequently, we examined the changes in the expression levels of markers of myocardial hypertrophy and myocardial fibrosis in the myocardial tissue of each group of mice. The results showed that, 4 weeks after TAC surgery, compared with the TAC+shNC group, the gene expression levels of myocardial hypertrophy markers Anp, Bnp, and Myh7, collagen deposition markers Col1a1 and Col3a1, and myocardial fibrosis markers Postn and Ctgf were significantly downregulated in the TAC+shXirp2 group of mice.

[0064] In conclusion, knocking down Xirp2 expression in cardiomyocytes in mice can significantly improve cardiac function impairment in the early and progressive stages induced by stress overload, and alleviate the degree of myocardial hypertrophy and collagen deposition.

Claims

1. Use of an inhibitor targeting the Xirp2 gene in the preparation of a medicament for the prevention or treatment of myocardial fibrosis.

2. The use according to claim 1, characterized in that: The inhibitor is siRNA or shRNA.

3. The use according to claim 2, characterized in that: The siRNA contains sequences selected from SEQ ID NO:1-3.

4. The use according to claim 2, characterized in that: The nucleotide sequence of the shRNA is shown in SEQ ID NO:

4.

5. The use according to any one of claims 1-4, characterized in that: The aforementioned myocardial fibrosis can also be myocardial hypertrophy.

6. A pharmaceutical composition for the prevention or treatment of myocardial fibrosis, characterized in that: It includes the inhibitor as described in any one of claims 2-4 and a pharmaceutically acceptable carrier.

7. A recombinant AAV vector, characterized in that: It contains the nucleotide sequence of the shRNA as described in claim 4, the specific promoter TNT, and the AAV9 capsid protein.

8. The recombinant AAV vector according to claim 7, characterized in that: The construction sequence of the recombinant AAV vector is AAV9-cTNTpromoter-shXirp2.

9. Use of the recombinant AAV vector according to claim 7 or 8 in the preparation of a medicament for the prevention or treatment of myocardial fibrosis.

10. The use according to claim 9, characterized in that: The aforementioned myocardial fibrosis can also be myocardial hypertrophy.

Images