Chinese orchid growth regulation gene CsARF4 as well as coding sequence and application thereof

Abstract

The invention discloses a Chinese orchid growth regulation gene CsARF4 as well as a coding sequence and application thereof, and belongs to the field of plant molecular biology. Analysis finds that the expression of CsARF4 in Chinese cymbidium roots is the highest; in different flower development stages of cymbidium sinense, the expression trend of CsARF4 is gradually reduced; in tissue parts of mature flowers of cymbidium sinense, the expression of CsARF4 in petals is the highest. Through a genetic engineering technology, it is found that overexpression of the Chinese cymbidium growth and development regulation gene in cymbidium sinense can change plant growth traits and cause increase and rapid growth of rhizomes, so that the gene and a protein coded by the gene can be used for rhizome proliferation, the budding rate is increased, and the yield of plants is increased. Research on growth and development regulation ways such as rapid growth of plants is promoted, and the method is used for improving growth traits.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant molecular biology, and particularly relates to a Cymbidium growth regulation gene CsARF4 and a coding sequence and application thereof. BACKGROUND

[0002] Auxin response factor (ARF) gene plays a core role in regulating plant bud proliferation, tillering and rapid growth. Studies have shown that MONOPTEROS (MP, also known as ARF5) is a key transcription factor for mediating auxin transcription response, and the expression of MP is controlled by a growth hormone-dependent self-activation mode. Local active MP autonomously directs PIN1 polarity non-cell, promotes the formation of local auxin maximum and organ formation. In addition, ARF gene finely regulates tillering by integrating multi-hormone signal network: on the one hand, it induces the expression of strigolactone synthesis genes (MAX3, MAX4) and activates downstream inhibitor BRC1 / TB1, indirectly inhibiting axillary bud germination; on the other hand, it inhibits the expression of key gene IPT for cytokinin synthesis, reducing the concentration of cytokinin in the main stem axillary bud. In the process of rapid growth, tomato SlARF5 drives cell division and expansion by coordinating auxin-gibberellin signal pathway, while Arabidopsis AtARF3 directly binds to the promoter of cytokinin gene AtIPT5 to inhibit its expression, thereby regulating the regeneration of new buds.

[0003] Cymbidium plants of small flower type and terrestrial origin, collectively referred to as Cymbidium, are one of the ten traditional famous flowers in China, and mainly include 9 categories of Cymbidium faberi, Cymbidium goeringii, Cymbidium ensifolium, Cymbidium lancifolium, Cymbidium kanran, Cymbidium sinense, Cymbidium devonianum, Cymbidium ensifolium and Cymbidium ensifolium. Most Cymbidium have a long growth cycle. Although the tissue culture technology of Cymbidium has been broken through, it is still difficult to solve the inherent characteristics of slow proliferation and long growth cycle. From sowing to germination, budding, seedling, and rooting, it usually takes 2-3 years, and the production cycle is long and the cost is high. How to use modern molecular biological technology to carry out genetic improvement and realize rapid growth has become a key problem for industrial development. SUMMARY

[0004] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of the present application is to provide a Cymbidium growth regulation gene CsARF4 and a coding sequence and application thereof.

[0005] The present application overcomes the problems of long cycle and high cost in traditional production of Cymbidium. By using molecular biology methods, the present application mines gene resources that can be used for growth trait improvement, and realizes rapid growth.

[0006] The purpose of the present application is achieved by the following technical scheme: The present application provides a Cymbidium growth regulation gene CsARF4 which is obtained from Cymbidium faberi, a typical representative of Cymbidium.Cymbidium sinense ) is isolated from the leaf cDNA of the cultivar 'Xiaoxiang', and its nucleotide sequence consists of 2043 bases, as shown in SEQ ID NO: 1, and is named as CsARF4 .

[0007] The second object of the present application is to provide a protein encoded by the growth regulation gene of Cymbidium, which consists of 680 amino acid residues, as shown in SEQ ID NO: 2, The third object of the present application is to provide an expression cassette containing CsARF4 the gene, a recombinant plant expression vector, a transformed bacterium or transgenic material.

[0008] The expression vector is any one of binary vectors that can be used for Agrobacterium transformation of plants or vectors that can be used for plant microprojectile bombardment, such as pCAMBIA series vectors, pBI series vectors, pBin series vectors or Gateway™ series vectors, and the overexpression vector pCAMBIA series plasmid is used in the present application.

[0009] The starting bacterium of the transformed bacterium is Agrobacterium, preferably Agrobacterium EHA105.

[0010] The fourth object of the present application is to provide CsARF4 the gene, the encoded protein, the expression cassette containing CsARF4 the gene, the recombinant plant expression vector, the transformed bacterium or the transgenic material, for one of the following applications: (a) application in improving Cymbidium cultivars; (b) application in regulating plant growth; Preferably, overexpression of the CsARF4 gene causes rapid proliferation and budding of plants, and improves the budding rate.

[0011] Preferably, the plant is Cymbidium, and further is Cymbidium sinense.

[0012] The fifth object of the present application is to provide a method for promoting plant growth, comprising the following steps: introducing the CsARF4 gene into plant cells, tissues or organs, and then cultivating the transformed plant cells, tissues or organs into plants, so that the CsARF4 gene is expressed in plants to achieve rapid proliferation and budding of plants and / or to improve the budding rate of plants. CsARF4 Further preferably, the is introduced into plant cells, tissues or organs by a plant expression vector.

[0013] Preferably, the plant is Cymbidium, and further is Cymbidium sinense.

[0014] This invention, through genetic engineering technology, discovered that the growth and development regulatory gene of Cymbidium goeringii is overexpressed in Cymbidium sinense, which can alter plant growth traits, resulting in increased rhizomes and rapid growth. Therefore, this gene and its encoded protein can be used to study growth and development regulation pathways such as rhizome proliferation, increased budding rate, and promotion of rapid plant growth, as well as for the improvement of growth traits.

[0015] The present invention has the following advantages and effects compared with the prior art: This invention isolates key growth genes from the flower bud cDNA of the Cymbidium sinense cultivar 'Xiao Xiang'. ARF4 and named CsARF4 Spatiotemporal expression pattern analysis revealed that, CsARF4 The highest expression was observed in the roots of Cymbidium goeringii; it was also observed at different flower development stages in Cymbidium goeringii. CsARF4 The expression trend is a gradual decrease; in the tissue parts of mature Cymbidium flowers, CsARF4 Expression was highest in petals. In Cymbidium orchids, transient overexpression was observed to accelerate rhizome proliferation, increase budding rate, and promote rapid plant growth. Attached Figure Description

[0016] Figure 1 In Embodiment 1 of the present invention, CsARF4 Gene homologous sequence alignment.

[0017] Figure 2 In Embodiment 1 of the present invention, CsARF4 Phylogenetic analysis of proteins.

[0018] Figure 3 In Embodiment 2 of the present invention, CsARF4 Expression pattern analysis in different organs of *Cymbidium goeringii*; where A: phenotypes of different organs; B: CsARF4 Expression level analysis chart.

[0019] Figure 4 In Embodiment 2 of the present invention, CsARF4 Expression pattern analysis at different flower development stages of Cymbidium goeringii; where A: phenotypes at different flower development stages S1–S5; B: CsARF4 Expression level analysis chart.

[0020] Figure 5 In Embodiment 2 of the present invention, CsARF4 Analysis of expression patterns in different floral tissues of Cymbidium goeringii; where A: phenotypes of different floral tissues; B: CsARF4 Expression level analysis chart.

[0021] Figure 6 In embodiment 3 of the present invention, CsARF4 Screening and phenotypic analysis of transgenic Cymbidium goeringii. Note: A: Schematic diagram of Cymbidium goeringii transient overexpression recombinant vector; B:CsARF4 Transgenic Cymbidium goeringii PCR screening and identification; C: CsARF4 Expression level detection of transgenic Cymbidium goeringii; D: CsARF4 Statistical analysis of the number of shoots emerging from transgenic rhizomes; E: CsARF4 Statistics on the germination days of transgenic rhizomes; F: CsARF4 Phenotypes that promote rhizome proliferation and budding in transgenic Cymbidium goeringii. Detailed Implementation

[0022] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the embodiments described in this specification are merely for explaining the invention and are not intended to limit the invention. The parameters, proportions, etc., of the embodiments can be selected according to local conditions without substantially affecting the results.

[0023] Example 1 CsARF4 Gene cloning and sequence analysis 1. RNA extraction Take 2g of tender leaves of the Cymbidium goeringii cultivar 'Xiao Xiang', extract total RNA using the "Fastpure Universal Plant Total RNA Isolation Kit", and reverse transcribe it into cDNA (HiScript III 1st Strand cDNASynthesis Kit (+gDNA wiper)).

[0024] 2. Target gene CsARF4 The acquisition by CsARF4 -F(SEQ ID NO:3,ATGGCAATCGATCTGAATACGGT) and CsARF4 -R (SEQ ID NO: 4, TTAGAGAGAAAACTCGAGCTTTCC) was used as the primer. Using the cDNA obtained in the previous step as a template, PCR was performed using a high-fidelity enzyme (2x PhantaFlash Master Mix (Dye Plus)) under the following conditions: 95℃ for 30 seconds, then 35 cycles (95℃ for 10 seconds, 58℃ for 5 seconds, 72℃ for 5 seconds), and finally 72℃ for 10 minutes. The PCR product was detected by agarose gel electrophoresis, showing a clear and single band, approximately 2000 bp in size. The target band was excised and recovered, and the recovered product was ligated into a cloning vector (5 min TA / Blunt-Zero Cloning Kit) and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequencing analysis revealed that the amplified fragment contained the target gene. CsARF4The complete CDS sequence of the gene is composed of 2043 bases, the nucleotide sequence is shown as SEQ ID NO: 1, and the gene is named as the growth regulation gene of Cymbidium sinense CsARF4 The nucleotide sequence is translated into a protein sequence (the sequence is shown as SEQ ID NO: 2) by using SnapGene software CsARF4 , and the amino acid sequence of the encoded protein is composed of 680 amino acid residues, and the protein is named as the growth regulation protein CsARF4 protein of Cymbidium sinense. The obtained Escherichia coli containing CsARF4 is currently preserved in the Institute of Environmental Horticulture, Guangdong Academy of Agricultural Sciences.

[0025] 3. CsARF4 Gene sequence analysis The conserved domain of the CsARF4 protein is analyzed by the Conserved Domain Search function of the NCBI database, and it is found that CsARF4 has the typical domain of the ARF gene family, mainly including a DNA-binding domain (DBD), a middle region (MR), and a dimerization domain (CTD) three key regions.

[0026] The Cymbidium sinense Figure 1 gene is subjected to homologous sequence search in NCBI, and the encoded amino acid alignment of the homologous sequences is performed by using software MEGA Figure 2 , and an evolutionary tree is constructed CsARF4 . The results show that CsARF4 the homology with Dendrobium x P_020700958.1 is 75.74%, the homology with Dendrobium x P_020700958.1 is 75.18%, the homology with Dendrobium x P_020700958.1 is 72.35%, the homology with Dendrobium x P_020700958.1 is 61.12%, the homology with Dendrobium x P_020700958.1 is 62.08%, the homology with Dendrobium x P_020700958.1 is 60.29%, the homology with Dendrobium x P_020700958.1 is 59.42%, the homology with Dendrobium x P_020700958.1 is 60.84%, and the homology with Dendrobium x P_020700958.1 is 58.61%, and the homology with Dendrobium x P_020700958.1 is 58.17%.

[0027] The evolutionary tree result shows that CsARF4 is close to the orchid plants due to the close genetic relationship and is gathered together.

[0028] Example 2 CsARF4 Expression pattern in Cymbidium sinense 1. Extraction of RNA Two g samples were taken from different organs (roots, stems, leaves, flowers, and fruits), different flower development stages (S1-S5), and different tissue parts (sepia, petals, lip, and column) of the Cymbidium goeringii cultivar 'Xiao Xiang'. Total RNA was extracted from these samples using the plant "Fastpure Universal Plant Total RNA Isolation Kit". Two μL of the extracted RNA was reverse transcribed into cDNA using the ThermoScientific RevertAid First Strand cDNASynthesis Kit.

[0029] 2. Quantitative PCR Using primers CsARF4 -RT-F (SEQ ID NO: 5, GCTGAGGATTGCGACTTGTCTG) and CsARF4 -RT-R (SEQ ID NO: 6, TGCTGCGTGTGTGGATGGAA) was used to detect different organs, different flower development stages, and different tissue parts of mature flowers in Cymbidium goeringii. CsActin Gene expression levels were detected using real-time quantitative PCR. CsActin -RT-F (SEQ ID NO: 7, CAATGAGCTTCGTGTTGCCC) and CsARF4 -RT-R (SEQ ID NO: 8, GATACGAACCAGTTGTGCGG) was used as primer, and Actin was amplified as an internal control. The following procedure was followed: pre-denaturation at 95℃ for 30 seconds, followed by 40 cycles (95℃ for 10 seconds, 60℃ for 30 seconds, 95℃ for 15 seconds), and extension at 72℃ for 10 minutes. Amplification was performed using the iCycler IQ Real-time PCR Detection System (Bio-Rad, USA), following the instructions for the Taq Pro Universal SYBR qPCR Master Mix kit.

[0030] 3. Expression Analysis The PCR results were analyzed using iCycler real-time detection system software (version 7.0). The results showed... Figure 3 The gene was expressed at its highest level in different organs of Cymbidium goeringii, followed by the stem. CsARF4 ); in different stages of the development of Cymbidium goeringii, Figure 4 Expression was concentrated in the early stages of flower development, with the highest expression level in S1, followed by a gradual decrease, and reaching its lowest level in S5. CsARF4In different floral tissues of Cymbidium goeringii, Figure 5 The highest expression was observed in the petals, and the lowest in the column. CsARF4 ).

[0031] Example 3: In Cymbidium goeringii CsARF4 Gene functional analysis 1. Construction of a transient overexpression vector for Cymbidium goeringii The overexpression vector 35S3301-RUBY was double-digested (NcoI and BstEII restriction sites, Takara Bio Engineering (Dalian) Co., Ltd.), and the resulting linear vector was purified. Based on the sequence of the double restriction sites, a design was developed. CsARF4 Homologous recombination primers that are seamlessly linked to pCAMBIA3301 CsARF4 -pCAM3301-F (SEQ ID NO: 9, acgggggactcttgaccatggATGGCAATCGATCTGAATACGG) and CsARF4 The target fragment was obtained by recovering and purifying pCAM3301-R (SEQ ID NO: 10, ggggaaattcgagctggtcaccTTAGAGAGAAAACTCGAGCTTTCCC). Homologous recombination of the linear vector and the target fragment was performed using the CloneExpressUltraOneStepClosing Kit. After sequencing verification, the plasmid was named pCAMBIA3301-CsARF4.

[0032] The starting vector for vector 35S3301-RUBY is pCAMBIA3301 vector; vector 35S3301-RUBY is disclosed in the literature “CN120173950A, A promoter and its application in orchid plants”.

[0033] 2. Transformation of Cymbidium goeringii plants 2.1 Transformation of Agrobacterium EHA105 The competent cells of Agrobacterium EHA105 were taken out from the -80℃ refrigerator and dissolved on ice, 5 min later, 1 μL of pCAMBIA3301-CsARF4 plasmid was added, and then sequentially placed on ice for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, and ice bath for 5 min. Then 700 μL of LB culture solution without antibiotics was added in the clean bench and mixed by blowing, and then placed in a 28℃, 200 rpm shaking incubator. After 2 h, the bacteria were centrifuged (5000 rpm, 1 min), the supernatant was removed in the clean bench, and about 100 μL of the remaining bacterial solution was spread on LB solid medium containing Kana+Rif antibiotics, and cultured in a 28℃ incubator for 2-3 days. The same as above, the empty control pCAMBIA3301 and the marker control 35S3301-RUBY plasmid were respectively transformed into Agrobacterium according to the above method.

[0034] After 2 days, the monoclonal was picked into LB culture solution containing 50 mg / L Kan+25 mg / L Rif antibiotics, and cultured in a 28℃, 200 rpm incubator for 1 day. 50 μL of correct bacterial solution was taken into 50 mL of LB culture solution containing 50 mg / L Kan antibiotics, and cultured at 28℃, 200 rpm until the OD value reached 1.0-1.2. The bacterial solution was centrifuged in a 4℃ centrifuge (5000 rpm, 7 min), the supernatant was discarded and the bacterial pellet was collected. Then the bacterial pellet was resuspended and diluted to OD 600 0.8 with a buffer containing 100 mol / L MES, 100 mol / L MgCl2, 200 μmol / L AS (acetyl-syringone). It was placed at room temperature for 5-6 h and ready for use.

[0035] 2.2 Agrobacterium infection of Cymbidium rhizomes The Cymbidium rhizomes were placed in a 250 mL sterile conical flask, and about 100 mL of Agrobacterium infection solution was poured in. The healthy Cymbidium rhizomes were infected with Agrobacterium resuspension solution containing empty control pCAMBIA3301, marker control 35S3301-RUBY and test group pCAMBIA3301-CsARF4 respectively by vacuum negative pressure method, and transgenic Cymbidium rhizomes were obtained, which were recorded as empty vector group (Empty-vetor), marker group (Ruby) and test group (35S: CsARF4 -OE).

[0036] 2.3 Agrobacterium infection of Cymbidium rhizomes and co-culture The Cymbidium rhizomes were taken out, the surface solution was absorbed with sterile filter paper and blown dry for about 15 minutes under the clean bench, and then placed on the co-culture medium, and cultured in the dark at 28℃ for two days.

[0037] 2.4 Recovery culture and screening culture of Cymbidium positive adventitious buds After two days of culture, the rhizomes were washed in an antiseptic solution, then in sterile water, and then dried and placed in recovery medium (½MS + 0.1 mg / L NAA + 4 mg / L 6-benzylaminopurine (6-BA) + 0.6% (w / v) agar, pH 5.4) for 14 days, and in selection medium (½MS + 0.1 mg / L NAA + 4 mg / L 6-benzylaminopurine (6-BA) + 0.6% (w / v) agar + 500 mg / L cefotaxime + 0.5 mg / L Glufosinate-ammonium, pH 5.4) for about 15 days.

[0038] 2.5 Phenotype observation The newly grown bud points were selected from the above-mentioned infected rhizomes, and the number of bud points newly grown from the rhizomes in the test group increased. The results showed that the transient overexpression vector could play a normal role in the Cymbidium plant body.

[0039] 2.6 Detection of the effect of gene transient overexpression DNA was extracted from the transgenic rhizomes, and primers pCAM3301-F (SEQ ID No: 11, GAGAACACGGGGGACTCTTG) and pCAM3301-R (SEQ ID No: 12, TAATCATCGCAAGACCGGCA) were used to check the overexpression of the gene. The rhizomes of the empty control pCAMBIA3301 and the marker control 35S3301-RUBY were used as controls, the PCR products were added to the sample wells of the gel for electrophoresis, and if the expected size of the DNA band was observed, the plant was identified as a positive plant, indicating that the target DNA fragment had been successfully inserted into the plant genome. Three transgenic positive lines (35S: CsARF4 -OE1#, 35S: CsARF4 -OE2#, and 35S: CsARF4 -OE3#) were selected to detect the PCR products and expression amounts. RNA was extracted from the transgenic rhizomes, and primers CsARF4 -RT-F and Actin -RT-R were used to detect the expression amount of CsARF4 of Cymbidium to obtain the effect of transient overexpression of the recombinant expression vector by real-time quantitative PCR detection, and the PCR detection method and analysis were as in Example 2. Cs Actin -RT-F and Cs CsARF4 -RT-R were used as primers, and Actin was amplified as an internal reference.

[0040] Studies have found that using Ruby marker genes and Agrobacterium-mediated transient overexpression technology, the expression of Ruby marker genes in Orchid rhizomes can be effectively controlled. CsARF4 Overexpression was performed, with the empty vector control pCAMBIA3301 and the labeled control 35S3301-RUBY as controls. Phenotypic results were recorded after one week, and the phenotypes observed after 30 days of treatment showed that pCAMBIA3301- Figure 6 The number of newly sprouted buds from the rhizomes increased in the experimental group. Figure 6 (D and F in the text); and the bud germination time was significantly earlier than that of the empty control and the marker control, about 7 days earlier (in the text). Figure 6 (E in the text). Subsequently, PCR detection confirmed that the target gene had been successfully introduced into the plant. CsARF4 (B in the text), and furthermore, through qRT-PCR detection results, we found that at 35S: Figure 6 In -OE plants, the expression level of CsARF4 was significantly upregulated, more than 1.8-fold. ​ (C in the text). Therefore, we hypothesize that CsARF4 may be involved in regulating the rapid proliferation and budding of Cymbidium rhizomes.

[0041] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A Guzmania growth regulatory protein CsARF4, characterized in that: The amino acid sequence is shown as SEQ ID NO:

2.

2. A Cymbidium growth regulating gene encoding the Cymbidium growth regulating protein CsARF4 of claim 1. CsARF4 .

3. The growth regulatory gene of Gossypium raimondii of claim 2 CsARF4 characterized in that The nucleotide sequence is shown as SEQ ID NO:

1.

4. The biological material related to CsARF4 of the genus Lanate growth regulating protein according to claim 1, characterized in that, Any one or a combination of the following biological materials: (1) an expression cassette comprising the gene of claim 2 or 3 CsARF4 ; (2) recombinant plant expression vectors comprising the genes of claim 2 or 3 CsARF4 ; (3) a recombinant plant expression vector containing the expression cassette in (1); (4) a transformed bacterium containing the gene of claim 2 or 3 CsARF4 ; (5) a transformed bacterium containing the expression cassette in (1); (6) a transformed bacterium containing the recombinant plant expression vector in (2) or (3).

5. The biological material according to claim 4, characterized in that: The starting bacterium of the transformed bacterium is Agrobacterium.

6. The Cymbidium growth regulating protein CsARF4 of claim 1, the Cymbidium growth regulating gene of any one of claims 2 to 3, or the biological material of any one of claims 4 to 5 for use in improving Cymbidium varieties. CsARF4 or the biological material of any one of claims 4 to 5 for use in improving Cymbidium varieties.

7. The Cymbidium growth regulating protein CsARF4 of claim 1, the Cymbidium growth regulating gene of any one of claims 2 to 3, or the biological material of any one of claims 4 to 5 for use in regulating plant growth. CsARF4 or the biological material of any one of claims 4 to 5 for use in regulating plant growth.

8. Use according to claim 7, characterized in that: Overexpression CsARF4 After the gene, cause the plant rapid proliferation and budding, improve the budding rate; the plant is national orchid.

9. A method of promoting plant growth, characterized by, comprising the step of introducing into a plant cell, tissue or organ the gene of any one of claims 2 to 3 CsARF4 and cultivating the transformed plant cell, tissue or organ into a plant, such that the gene of any one of claims 2 to 3 is expressed in the plant CsARF4 in the plant, to achieve rapid propagation and sprouting of the plant and / or to increase the sprouting rate of the plant.

10. The method according to claim 9, characterized in that: The plant is Cymbidium.

Images