Leuconostoc mesenteroides subsp. Mesenteroides JMCC0041 for cheese fermentation and application thereof

By screening out the Leuconostoc mesenteroides subsp. JMCC0041 strain, which is tolerant to high salt and a wide temperature range, the problems of stress resistance and flavor consistency in cheese fermentation were solved, and stable fermentation and flavor enhancement of cheese were achieved.

CN120988939AActive Publication Date: 2025-11-21SIPING JUNLEBAO DAIRY CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511453170.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-13
Publication Date
2025-11-21
Estimated Expiration
2045-10-13

AI Technical Summary

Technical Problem

Existing cheese fermentation strains have weak stress resistance, poor consistency in fermentation flavor and texture, and insufficient or excessive dimethyl ketone production, which affects cheese production and flavor quality.

Method used

The enteromembranous subsp. enterica strain JMCC0041 was screened out. It has high production of flavor substances, high salt tolerance and wide temperature range fermentation ability, and can be used for cheese fermentation to ensure that the diacetone content is within the appropriate range.

Benefits of technology

To improve the stability and flavor quality of cheese fermentation, reduce the impact of environmental fluctuations during the production process, and enhance product quality and sensory experience.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention discloses leuconostoc mesenteroides subsp. Mesenteroides JMCC0041 for cheese fermentation and application of the leuconostoc mesenteroides subsp. Mesenteroides JMCC0041, and belongs to the technical field of microbial engineering. The preservation number of the leuconostoc mesenteroides subsp. Mesenteroides JMCC0041 is CGMCC (China General Microbiological Culture Collection Center) NO.34266, and the Latin name of the leuconostoc mesenteroides subsp. Mesenteroides is Leuconostoc mesenteroides subsp. The leuconostoc mesenteroides subsp. Mesenteroides JMCC0041 provided by the invention has relatively high and appropriate butanedione yield, a fermented cheese product is outstanding in cream flavor, the strain is stable in fermentation in a high-salt environment and wide in working temperature range, the application range of the leuconostoc mesenteroides subsp. Mesenteroides is expanded, and the production cost is reduced. The germplasm resources of the leuconostoc mesenteroides subsp.mesenteroides in China are enriched. The method is suitable for preparing the leavening agent and the fermented cheese.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of microbial engineering, and relates to a new strain of Leuconostoc mesenteroides subsp. mesenteroides, in particular, Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation and application thereof. BACKGROUND

[0002] Among various dairy products, cheese has high nutritional value, but imported cheese products are limited by transportation and preservation costs, and the terminal price is high, while local brands still have some unsolved problems in the fermentation, curd and ripening process of raw cheese.

[0003] First, there is a lack of stress-resistant strains for fermentation. In the cheese production process, it will go through low-temperature environments such as raw milk refrigeration, high-temperature environments such as residual heat after pasteurization, and high-salt environments such as salting, etc. These environmental conditions can lead to insufficient activity of some sensitive strains. At present, most of the commercial starter strains on the market have weak stress resistance, especially in low-salt and low-temperature fermentation processes such as soft cheese production, which can easily lead to a decrease in strain activity or even cause fermentation to stop, affecting the normal production of soft cheese.

[0004] Secondly, some strains also have the problem of poor consistency of fermentation flavor and texture. The metabolic products of starter strains such as lactic acid, butanedione, acetaldehyde, etc. are the core source of cheese flavor, but the generation of these metabolic products is greatly affected by factors such as strain activity, fermentation time, and environmental temperature fluctuations. For example, a 1~2℃ fluctuation in environmental temperature can cause changes in the activity of ester-producing strains, resulting in high acidity or lack of flavor in the same batch of cheese, and the ability of the starter to produce exopolysaccharide is unstable, which can lead to cheese that is too soft due to insufficient polysaccharide production, or too hard due to excessive polysaccharide production, thereby affecting the subsequent processing performance of the cheese such as slicing and melting.

[0005] Especially among the various metabolic products of starter strains, butanedione is a key flavoring substance in cheese that imparts a buttery aroma, and its content directly affects the flavor quality of the cheese product. Therefore, the amount of butanedione produced by the cheese fermentation bacteria has an important influence on the sensory experience of the final product. Previous studies have shown that there is a significant threshold range for butanedione to exert its ideal buttery flavor effect in cheese, and this range varies depending on the type of cheese. The highest content of butanedione in various types of cheese should not exceed 10mg / kg. If this threshold is exceeded, the cheese will have a noticeable putrid odor, chemical odor and metallic taste, which will seriously damage the flavor of the product, leading to a decrease in product quality or even making it inedible. However, the existing bacteria used for cheese fermentation currently have problems of insufficient or excessive production of butanedione during actual fermentation. SUMMARY

[0006] The purpose of the present application is to provide a Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 strain for cheese fermentation, which is isolated from traditional fermented dairy products, and screened from lactic acid bacteria for producing flavor substances, high salt environment fermentation stability and adapting to a wide temperature range, so as to enrich the domestic cheese fermentation strain germplasm resources.

[0007] Another purpose of the present application is to provide the above-mentioned application of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation, which is used as a cheese fermentation agent strain for the fermentation of cheese products, so that the cheese has a suitable and high butanedione content and a prominent butter aroma.

[0008] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is: A Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 strain for cheese fermentation, the 16S rDNA sequence of which is shown as SEQ ID NO. 1, the Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 strain is preserved in the China General Microbiological Culture Collection Center, the preservation address is No. 1, Beichen West Road, Yard 3, Chaoyang District, Beijing, the preservation date is April 27, 2025, the preservation number is CGMCC NO. 34266, and the Latin name is Leuconostoc mesenteroides subsp. mesenteroides .

[0009] SEQ ID NO. 1 is as follows: The Phes gene sequence is shown as SEQ ID NO. 2, which is: AATAAGTAAGCAATCGTTGTAATTAAATATAGAATAGCGCCCCATCGAACAATCTTTTTCCGTCCGATTAGTTCTAACTCTTTTCCAACTATTAGCCGAGCTATTAACGTTCCTATGATATAAATCCCAGAGGCCAATCCCGCTTGCCCAAACGAAGCATGTAGTTGATTGTGTGCAACAACTGCAATTATAACCATCATCAGATAATACACTAAGTACACGATAAAGTTAATAATAGTAATTGTTAAAAAGCCTTTATTAAATAATTTTTCTTCCATTTTCCCAATCTCAAATTCTATTTAGCAACTCTAACAATAGCAAAGTAGCTATGTAGGTGCAAACTTGAAATCAGATTTTAAAACATGCATGT.

[0010] As a limitation of the present application, the content of butanedione in the cheese fermented by the Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is not less than 7.33 mg / kg. The fermentation temperature of the Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is 19℃~37℃.

[0011] The present application also provides an application of the above-mentioned Leuconostoc mesenteroides subsp. mesenteroides JMCC0041, which is specifically used for preparing a ferment.

[0012] As a limitation of the present application, the ferment is a composite ferment containing lactic acid bacteria. Further, in the composite ferment, the ratio of viable bacteria of the Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 to other bacteria is 0.1%~10%:1, and the other bacteria include Lactococcus lactis subsp. cremoris, Lactococcus lactis subsp. lactis and Streptococcus salivarius subsp. thermophilus.

[0013] As a further limitation of the present application, the ferment is used for fermenting to prepare dairy products.

[0014] The addition amount of the ferment in the fermentation substrate is 0.025~0.1g / kg; the fermentation temperature is 29~35℃, and the end point of fermentation is pH =4.7.

[0015] As a further limitation of the present application, the dairy product includes cheese.

[0016] The application also provides application of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 in preparation of high-salt cheese, wherein the mass fraction of NaCl added in the fermentation liquor of the high-salt cheese is 0.5% to 4%.

[0017] Compared with the prior art, the application has the following technical progress: The application obtains Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 with specific functions through strain separation and screening in traditional fermented dairy products. The discovery and application of the strain can effectively supplement the domestic cheese fermentation strain germplasm resource bank. Compared with the current dependence on imported strains in the domestic cheese fermentation field, the native strain has unique biological characteristics and fermentation functions, provides basic germplasm materials for subsequent molecular improvement, directional breeding and industrialization transformation of the strain, and can alleviate the problems of single germplasm resources and high dependence on foreign countries. The Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 has strong adaptability in key environments for cheese fermentation. Firstly, the strain has good fermentation stability in a high-salt environment required for cheese production, and can stably ferment under the condition that the mass fraction of NaCl is 0.5% to 4%, thereby reducing the influence of environmental fluctuations in the production process on the stability of product quality and ensuring the product quality of continuous industrial production of cheese. Secondly, the strain has a wide tolerance range to temperature conditions, and has stable fermentation capacity in the temperature range of 19 to 35 DEG C, without the need for strict single temperature control conditions. This not only reduces the energy consumption cost of temperature control in the production process, but also adapts to the equipment configuration and process parameters of different scale production enterprises, and improves the applicability of the strain in actual production scenarios. The Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 as a cheese fermentation agent strain for fermenting and producing cheese can significantly improve the flavor quality and sensory characteristics of the product. The strain has high yield of flavor active substances in the fermentation and metabolism process, especially maintains the synthesis amount of butanedione in the cheese within an appropriate flavor threshold range and at a high content level, and the product has prominent butter aroma.

[0018] The Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is used for preparing a fermentation agent to industrially produce fermented dairy products, especially cheese products. DETAILED DESCRIPTION

[0019] The application will be further described in detail through specific examples. It should be understood that the described examples are only used to explain the application, and do not limit the application.

[0020] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels unless otherwise specified.

[0021] In the following examples: Leuconostoc mesenteroides subsp. mesenteroides JM-0008, Leuconostoc mesenteroides subsp. mesenteroides JM-0733, Leuconostoc mesenteroides subsp. mesenteroides JM-0942, Leuconostoc mesenteroides subsp. mesenteroides JM-0962, Streptococcus thermophilus JMCC16 (preserved in China General Microbiological Culture Collection Center with the preservation number CGMCC NO.11672), Lactobacillus plantarum N3117 (preserved in China General Microbiological Culture Collection Center with the preservation number CGMCC NO.10133), Lactobacillus rhamnosus X253 (preserved in China General Microbiological Culture Collection Center with the preservation number CGMCC NO.18404), Bifidobacterium animalis lactis i797 (preserved in China General Microbiological Culture Collection Center with the preservation number CGMCC NO.18403) are all preserved in the laboratory of the applicant and can be obtained by purchase or other means.

[0022] Example 1 This example provides Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation, which is preserved in China General Microbiological Culture Collection Center with the preservation address of No. 3, Beichen West Road, Chaoyang District, Beijing, the preservation date of April 27, 2025, the preservation number of CGMCC NO.34266, and the Latin name of Leuconostoc mesenteroides subsp. mesenteroides .

[0023] The 16S rDNA sequence of the above-mentioned Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation is shown as SEQ ID NO. 1, and the Phes gene sequence is shown as SEQ ID NO. 2.

[0024] It has been verified by experiments that the diacetyl content in the cheese fermented by Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is not less than 7.33 mg / kg; Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 can be used as a fermentation agent strain for the fermentation of raw cow milk or reconstituted milk at a temperature of 19℃, 20℃, 22℃, 25℃, 28℃, 31℃, 35℃ or 37℃; and can be used for the fermentation production of cheese under the conditions of a mass fraction of NaCl of 0.5%, 1%, 1.5%, 2.5% or 4%.

[0025] Example 2 This example provides a method for isolating and purifying Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation, and strain identification.

[0026] Isolation and purification of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 comprising the following steps in sequence: S1. Sample collection Take 25 mL of traditional fermented dairy products in Inner Mongolia pastoral area, add to 200 mL of normal saline, mix to get the collection sample; S2. Sample enrichment Take 2 mL of the collection sample, add to 100 mL of MRS liquid medium, cultivate at 37℃ for 72h to get the culture liquid B; S3. Strain isolation Take 1 mL of the culture liquid B, dilute 10 times with sterile normal saline, continue to dilute 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 times with sterile normal saline respectively to get bacterial suspensions with different concentrations; Take MRS solid medium, sterilize and melt, pour into sterile culture dishes to make sterile plates, after cooling and complete solidification, take 0.1 mL of bacterial suspensions with different concentrations and spread on the sterile plates respectively; Place in 37℃ anaerobic environment for 68h; after typical colonies appear on the plates, select single colonies; S4. Strain purification Take the single colonies and streak inoculate on another sterile MRS solid medium plate, cultivate at 37℃ in aerobic environment for 72h, then pick the single colonies Q on the sterile plate and continue to streak inoculate on another new sterile MRS solid medium plate, cultivate for three times in succession until the colony morphology in the medium is consistent, observe the cell morphology of the strain under microscope, then obtain the strain to be verified, inoculate the strain to be verified in liquid MRS medium, cultivate at 37℃ for 24h to get the final pure culture liquid, mark as JMCC0041; S5. Strain preservation Take 800 μL of the pure culture liquid and mix with sterile 50% glycerol (a mixture of glycerol and an equal volume of distilled water) at 1:1, place in a strain preservation tube, mix well and store at -70℃, at the same time, inoculate the single liquid in a sterile modified MRS solid medium test tube slant for temporary preservation.

[0027] (II) Strain identification of JMCC0041 1) Strain property identification Strain characterization method: inoculate JMCC0041 strain on MRS solid medium plate, streak and invert, cultivate at 37℃ for 72h, observe cell morphology and conduct Gram staining, oxidase detection, contact enzyme detection and carbohydrate acid production (API 50CH) property detection experiment.

[0028] Strain characterization result: observation shows that the cell morphology of JMCC0041 is spherical; Gram staining shows positive; contact enzyme detection shows no contact enzyme.

[0029] Carbohydrate acid production (API 50CH) property detection result is shown in Table 1: Table 1: Carbohydrate acid production property detection result of JMCC0041 strain

[0030] Note: "+" indicates fermentation utilization, "-" indicates non-fermentation utilization.

[0031] 2) Strain molecular identification Molecular identification was conducted on JMCC0041: using the genomic DNA of JMCC0041 as a template, 16S rDNA sequence was amplified by using bacterial 16S rDNA universal primers, the result is shown in SEQ ID NO. 1. Phes gene sequence was amplified, the result is shown in SEQ ID NO. 2. Through analysis and comparison, JMCC0041 was identified as Leuconostoc mesenteroides subsp. mesenteroides.

[0032] Through detection experiments, the Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 has characteristics significantly different from other strains of the same species and genus suitable for preparing dairy products such as cheese, which are as follows: first, it has the characteristics of producing more flavor substances, and its ability to produce butanedione from fermented milk or reconstituted milk is particularly outstanding, with high butanedione yield and below the poor flavor threshold, and the fermented cheese has a distinct buttery flavor; second, it has strong stress resistance, wide adaptation to fermentation temperature range, and good fermentation performance under high salt stress environment.

[0033] Example 1 of effect experiment This example is an effect verification experiment of butanedione production performance of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041. According to the method in the paper "Discussion on detection method of butanedione and acetaldehyde content in fermented milk" published by Li Yan in 2008, the sample to be tested was treated with trichloroacetic acid, and the butanedione content in each sample to be tested was detected by using o-phenylenediamine colorimetry.

[0034] The test sample is Leuconostoc mesenteroides subsp. mesenteroides JMCC0041, Leuconostoc mesenteroides subsp. mesenteroides JM-0008, Leuconostoc mesenteroides subsp. mesenteroides JM-0733, Leuconostoc mesenteroides subsp. mesenteroides JM-0942, Leuconostoc mesenteroides subsp. mesenteroides JM-0962; Streptococcus salivarius subsp. thermophilus JMCC16, Lactobacillus plantarum N3117, Lactobacillus rhamnosus X253 and Bifidobacterium animalis lactis i797, respectively, under the same conditions and for the same fermentation time.

[0035] The method for fermenting the cheese by each strain is specifically as follows: S11. Pre-sterilized milk: The qualified raw cow milk is filtered and clarified, then sterilized at 75 DEG C for 20 s and cooled to 4 DEG C, and stored in a mature milk warehouse for 10 h.

[0036] S12. Formulation and hydration: The pre-sterilized milk is adjusted according to the formula, the plate exchange is cycled to heat to 65 DEG C, stirring is started, the raw materials are added, and hydration is performed for 90 min, the volume is adjusted, and detection is performed at 20-25 DEG C, and stirring is stopped when the pH value is greater than or equal to 6.40.

[0037] S13. Homogenization: The homogenization pressure is 10 MPa (the second pressure is 3 MPa, and the first pressure is 10 MPa); and the homogenization temperature is 65-75 DEG C.

[0038] S14. Sterilization: The sterilization temperature is 95 DEG C, and the sterilization time is 305 s.

[0039] S15. Inoculation and fermentation: stirring is started, after the milk is added, the fermenting agent (the strain used for fermentation) is added, stirring is performed for 10 min, and then stirring is stopped. The fermentation is performed at 30 DEG C, and stirring is not started in the middle, the fermentation temperature is checked every 3 h, and it is ensured that the temperature change is less than or equal to 5 DEG C.

[0040] S16. Whey removal and ripening: heating to 30 DEG C, using the centrifugal separation method to remove whey, until the curd volume is reduced to about 1 / 3 of the original; ripening for 6 h in a cold storage at 4 DEG C, and obtaining the cheese product.

[0041] The detection results are shown in Table 2. Table 2: Detection results of butanedione content

[0042] The above detection results show that the butanedione content in the cheese fermented by different strains is obviously different, even in the same strain, the butanedione content in the cheese fermented by Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is the highest, and does not exceed the threshold value 10 mg / kg which easily leads to spoilage odor, chemical odor and metallic odor. The butanedione content in the cheese fermented by Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is not less than 7.33 mg / kg.

[0043] Effect experiment example 2 This example is the effect verification experiment of fermentation stability of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 at different temperatures. According to the cheese preparation method of effect experiment example 1, the fermentation temperature is set to 19℃, 22℃, 25℃, 28℃, 31℃ and 35℃ respectively, and Leuconostoc mesenteroides subsp. mesenteroides JM-0008, Leuconostoc mesenteroides subsp. mesenteroides JM-0733, Leuconostoc mesenteroides subsp. mesenteroides JM-0942, Leuconostoc mesenteroides subsp. mesenteroides JM-0962 and Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 are detected as fermentation strains. The pH of cheese after 24h fermentation is analyzed to analyze the stability of fermentation ability.

[0044] The pH fluctuation percentage pHb is calculated and used to represent the fluctuation size of fermentation ability.

[0045] Wherein, pHb= (maximum pH - minimum pH) / minimum pH x 100%. The experimental results are shown in Table 3: Table 3 Detection results of fermentation ability stability at different temperatures

[0046] Note: Different letters represent significant difference p<0.05 The above results show that Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 has good fermentation performance stability at temperatures of 19℃, 20℃, 22℃, 25℃, 28℃, 31℃ or 35℃, and has a wide range of applicable fermentation temperature, which reduces the energy consumption cost of temperature control in the production process, and can also adapt to the equipment configuration and process parameters of different scale production enterprises.

[0047] Effect experiment example 3 This example is the effect verification experiment of fermentation stability of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 under the condition of adding different concentrations of edible salt. According to the cheese preparation method of effect experiment example 1, 0.5%, 1%, 1.5%, 2.5% or 4% edible salt is added to the fermentation liquid (to be fermented milk) before inoculation, and Leuconostoc mesenteroides subsp. mesenteroides JM-0008, Leuconostoc mesenteroides subsp. mesenteroides JM-0733, Leuconostoc mesenteroides subsp. mesenteroides JM-0942, Leuconostoc mesenteroides subsp. mesenteroides JM-0962 and Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 are detected as fermentation strains. The pH of cheese after 24h fermentation is analyzed to analyze the stability of fermentation ability.

[0048] The pH fluctuation percentage pHb is calculated and used to represent the fluctuation size of fermentation ability. The results are shown in Table 4: Table 4 Detection results of fermentation ability stability under different edible salt conditions

[0049] Note: different letters represent significant differences p<0.05 The above results show that Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 has good fermentation performance stability under the conditions of adding 0.5%, 1%, 1.5%, 2.5% or 4% edible salt, and shows obvious stress resistance advantage, and can be applied to the fermentation production of high-salt cheese.

[0050] Example 3 The present embodiment provides the application of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation in the preparation of a fermenting agent. Specifically, Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is used as a fermentation bacteria alone to prepare cheese according to the method of the effect experiment example 1.

[0051] In other embodiments, Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is compounded with lactic acid bacteria such as Lactococcus lactis subsp. lactis, Lactococcus lactis subsp. cremoris or Streptococcus salivarius subsp. thermophilus to prepare a fermenting agent. It has been verified that after compounding, the cheese fermented by the fermenting agent has the characteristics of fast fermentation speed, rich creamy aroma and less odor, so that the overall preference in the sensory evaluation result is significantly improved.

Claims

1. Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation, characterized in that, 16S rDNA sequence is shown as SEQ ID NO. 1, and the strain of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is preserved in China General Microbiological Culture Collection Center, the address is No. 1, Beichen West Road, Chaoyang District, Beijing, the preservation number is CGMCC NO. 34266, and the Latin name is Leuconostoc mesenteroides subsp. mesenteroides .

2. Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation according to claim 1, characterized in that, The diacetyl content in the cheese fermented by Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is not less than 7.33 mg / kg. The fermentation temperature of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is 19℃-37℃.

3. Use of the Enterococcus faecium subsp. enterica JMCC0041 according to claim 1 or 2, characterized in that, The Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 is used for preparing a ferment.

4. The use of Enterobacteriaceae sakazakii subsp. enterica JMCC0041 according to claim 3, characterized in that, The ferment is a complex ferment containing lactic acid bacteria.

5. The use of Enterobacteriaceae sakazakii subsp. enterica JMCC0041 according to claim 3, characterized in that, The ferment is used for fermenting to prepare dairy products.

6. The use of Enterobacteriaceae sakazakii subsp. enterica JMCC0041 according to claim 5, characterized in that, The dairy products include cheese.

7. Use of the Enterococcus faecium subsp. enterica JMCC0041 according to claim 1 or 2 for the preparation of a high-salt cheese, characterized in that, The mass fraction of NaCl added in the fermentation liquid of the high-salt cheese is 0.5%-4%.

Citation Information

Patent Citations

  • Leuconostoc mesenteroides and application thereof

    CN116515703A

  • Yoghourt auxiliary fermentation inoculant capable of generating fruity flavor and application of yoghourt auxiliary fermentation inoculant

    CN118879575A