Recombinant plant lactobacillus of overexpression stress protein gene and application of recombinant plant lactobacillus

Abstract

The invention discloses recombinant plant lactobacillus for overexpressing stress protein genes and application of the recombinant plant lactobacillus. Belongs to the technical field of bioengineering. The invention aims to improve the cold-resistant growth capability of the plant lactobacillus and increase the capability of producing lactic acid and degrading nitrite. The invention provides a recombinant lactobacillus plantarum, which is characterized in that the lactobacillus plantarum is used as an original strain, and a nucleic acid molecule as shown in SEQ ID NO.1 is overexpressed. The lactobacillus plantarum is used for improving the cold-resistant growth capability of the lactobacillus plantarum and increasing the capability of producing lactic acid and degrading nitrite.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a recombinant plant lactobacillus overexpressing a stress protein gene and its application. Background Technology

[0002] Low-temperature fermented foods are of higher quality, with a softer, more delicious texture and no off-flavors. However, the microorganisms in the fermentation system are often affected by low-temperature stress, which reduces their fermentation performance and thus affects product quality. Therefore, this invention provides a method for constructing recombinant *Lactobacillus plantarum* overexpressing a stress protein gene, which can enhance growth and metabolism under low-temperature conditions and can be used for fermentation acid production and nitrite degradation, aiming to improve the flavor and quality of low-temperature fermented foods such as sauerkraut, while shortening the fermentation time.

[0003] In the food industry, many fermented products (such as yogurt, fermented milk, and kimchi) require storage and transportation at low temperatures to extend shelf life and inhibit the growth of harmful microorganisms. If *Lactobacillus plantarum* possesses good cold resistance, it can maintain its activity at low temperatures, helping to preserve the fermentation characteristics, flavor, and safety of the product. Cold-resistant *Lactobacillus plantarum* can be applied to more fermentation or health food production processes requiring low-temperature environments, such as refrigerated fermented foods and low-temperature preserved probiotic preparations, expanding its industrial application scope.

[0004] The accumulation of lactic acid by *Lactobacillus plantarum* during fermentation not only lowers the pH value but also increases lactic acid production, contributing to improved quality and consistency of fermented foods. Furthermore, it can efficiently produce lactic acid, an industrial chemical, through microbial fermentation, thereby reducing environmental pollution and resource waste and facilitating industrial applications. Therefore, there is an urgent need for *Lactobacillus plantarum* strains possessing these capabilities. Summary of the Invention

[0005] The purpose of this invention is to improve the cold resistance of Lactobacillus plantarum, and to increase its ability to produce lactic acid and degrade nitrite.

[0006] This invention provides a recombinant Lactobacillus plantarum ( Lactiplantibacillus plantarum Using *Lactobacillus plantarum* as the starting strain, the nucleic acid molecule shown in SEQ ID NO.1 was overexpressed.

[0007] Further specifying, the originating strain is *Lactobacillus plantarum* SC-MDJ.

[0008] The present invention provides a microbial preparation containing the above-mentioned recombinant Lactobacillus plantarum.

[0009] This invention provides the application of the above-mentioned recombinant Lactobacillus plantarum or the above-mentioned microbial preparation in increasing lactic acid production, increasing lactate dehydrogenase activity, or increasing the cold resistance of Lactobacillus plantarum.

[0010] This invention provides a method for improving the activity of lactate dehydrogenase in *Lactobacillus plantarum* by overexpressing the nucleic acid molecule shown in SEQ ID NO.1 in *Lactobacillus plantarum* and detecting the activity of lactate dehydrogenase.

[0011] This invention provides a method for increasing the lactic acid production of *Lactobacillus plantarum*, wherein the above-mentioned recombinant *Lactobacillus plantarum* is added to MRS medium and fermented at 15 °C.

[0012] This invention provides a method for cultivating cold-resistant *Lactobacillus plantarum* or enhancing the ability of *Lactobacillus plantarum* to degrade nitrite, by overexpressing the gene shown in SEQ ID NO.1 in *Lactobacillus plantarum*.

[0013] This invention provides the application of overexpressing the gene shown in SEQ ID NO.1 in increasing the activity of lactate dehydrogenase, increasing the lactic acid content, or improving the cold resistance of *Lactobacillus plantarum*.

[0014] This invention provides the application of overexpressing the gene shown in SEQ ID NO.1 in promoting the growth of Lactobacillus plantarum.

[0015] This invention provides the application of overexpressing the gene shown in SEQ ID NO.1 or the above-mentioned recombinant Lactobacillus plantarum or the above-mentioned microbial preparation in improving the ability of Lactobacillus plantarum to degrade nitrite.

[0016] Beneficial effects: Fermentation of L. plantarum SC-MDJ-NC8_RS07780 overexpressing the stress protein gene under low-temperature conditions increased the OD600nm of the strain to 1.421, a 34.27% increase compared to the control group; simultaneously, it lowered the pH of the fermentation system to 4.40, an 11.82% decrease compared to the control group; and the lactate dehydrogenase activity reached 49.24 U / mg protein, a 332% increase compared to the control group. Therefore, these results demonstrate that overexpression of the stress protein gene significantly enhances the growth and acid production capacity of L. plantarum SC-MDJ under low-temperature conditions, endowing the fermentation agent with unique physiological functions and strengthening the lactic acid metabolism pathway. Inoculation with individuals expressing stress protein genes L. plantarum Fermentation of SC-MDJ-NC8_RS07780 at 15 °C can increase the total acid content in the fermentation system to 16.84 mg / mL, while reducing the sodium nitrite content to 0.012 mg / mL, achieving a nitrite degradation rate of 98.80%. The increased total acid content enhances the texture and flavor of the food, thus contributing to the formation of a pleasant taste. Therefore, L. plantarumSC-MDJ-NC8_RS07780 starter culture also enhances the flavor of fermented foods. Compared to mesophilic fermentation, it can significantly improve the acid production and nitrite degradation capabilities of the starter culture at lower temperatures. Inoculation with individuals expressing stress protein genes L. plantarum Fermentation of SC-MDJ-NC8_RS07780 at 15 °C increased the lactic acid content in the fermentation system to 11.62 mg / mL, a 40.85% increase compared to the control group. This increased lactic acid content enhances the unique sour taste of the food, thus contributing to the development of a pleasant flavor.

[0017] [Biological Preservation Information]: The plant lactobacillus has been named Lactiplantibacillus plantarum, with accession number CGMCC NO.28112. It is deposited at the China General Microbiological Culture Collection Center on August 7, 2023, at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0018] Figure 1 This is a flowchart illustrating the construction process of a stress protein gene overexpression plasmid. Figure 2 To overexpress stress protein genes L. plantarum The PCR identification results. Detailed Implementation

[0019] MRS broth medium: 10.0 g peptone, 8.0 g beef extract, 4.0 g yeast extract, 20.0 g glucose, 2.0 g dipotassium hydrogen phosphate, 2.0 g diammonium hydrogen citrate, 5.0 g sodium acetate, 0.2 g magnesium sulfate, 0.04 g manganese sulfate, 1.0 g Tween 80, 1000 mL distilled water, pH=5.7 ± 0.2.

[0020] LB broth medium: 10.0 g tryptone, 5.0 g yeast extract, 10.0 g sodium chloride, 1000 mL distilled water, pH=7.0 ± 0.1.

[0021] Example 1. Method for constructing recombinant Lactobacillus plantarum (1) Extraction of genomic DNA and acquisition of stress protein genes Lactobacillus plantarum ( Lactiplantibacillus plantarumSC-MDJ was inoculated into MRS broth at a 2% inoculum and cultured at 30 °C and 200 rpm until the logarithmic growth phase, and then passaged twice. Genomic DNA was then extracted from the strain using a bacterial genomic DNA extraction kit. The DNA was obtained from the National Center for Biotechnology Information (NCBI) database. L. plantarum Reference genes NC8_RS07780 Sequence primers were designed for PCR amplification. After PCR product detection by 1% agarose gel electrophoresis, the target gene fragment was excised and recovered using a standard agarose gel DNA recovery kit. The fragment was stored at -20°C for later use. Stress protein gene ( NC8_RS07780 ) sequence is ATGCCAAGCCGTTACACAAATATTTTAGTACCCGTTGACAGTTCCGATGCTGCACAAGCCGCTTTTACTGAAGCGGTCAACATTGCCCAGCGGCACCAAGCAAACCTGACTGCGCTCTACGTGGTGGATGACAGCACCTACCACACCCCCGCACTCGACCCGGTTCTATCTGAATTACTAGACGCGGAAGCCGCTCACGCAAAGGATGCCATGCGGCAGC GACAACAATTCGTCGCCACCACGTCCGCACCGAATTTAAAAACTGAAATCAGCTACGGATTCCAAAACACACCATTGAGGACTATGCCAAGCAACATCCCGAAATTGACTTGATCGTGCTCGGCGCCACTGGTACCAACTCGCCCCATCGCGTAGCCGTTGGTTCAACGACCAGCTACGTCGTGGATCACGCCCCTTGCAACGTCATCGTCATTCGTTAA (SEQ ID NO.1). The primers and sequences used are shown in Table 1, the PCR amplification reaction system is shown in Table 2, and the amplification reaction procedure is shown in Table 3.

[0022] Table 1 Primers and sequences used

[0023] Table 2 PCR amplification reaction system

[0024] Table 3 PCR amplification reaction procedure

[0025] (2) Plasmid extraction and linearization E. coli containing pMG36e plasmid ( Escherichia coli The inoculum was 2% in LB broth containing 600 µg / mL erythromycin, and cultured at 37 °C and 200 rpm until the logarithmic growth phase. The broth was then passaged twice, and plasmids were extracted using a plasmid miniprep kit. Xba I and Hind The pMG36e plasmid was double-digested with restriction endonucleases III. The digestion reaction was carried out at 37 °C for 20 min. After the reaction, the results were detected by 1% agarose gel electrophoresis. The target fragment was recovered using a standard agarose gel DNA recovery kit and stored at -20 °C for later use. The double digestion reaction system is shown in Table 4.

[0026] Table 4. Double enzyme digestion reaction system

[0027] (3) Ligation of target gene with plasmid and transformation The purified target gene was ligated to the linearized pMG36e plasmid using a one-step cloning kit. The reaction was carried out in a 37°C water bath for 30 min, and immediately placed on ice after the reaction. Subsequently... E. coli DH5α competent cells were thawed on ice. 100 μL of competent cells were gently mixed with 10 μL of plasmid and incubated on ice for 30 min. The ligation plasmid was then transformed into DH5α using a heat shock transformation method. E. coli DH5α competent cells were finally plated on LB agar medium containing 600 µg / mL erythromycin. After the cells grew on the plates, transformants were screened and verified.

[0028] (4) Screening and validation of Escherichia coli transformants After picking single colonies using a sterile pipette tip, PCR verification of the transformants was performed using pMG36e-F and pMG36e-R primers. The correctly verified colonies were inoculated into LB broth containing a final concentration of 600 µg / mL erythromycin and cultured at 37 °C and 200 rpm until the logarithmic growth phase. The bacterial culture was then aspirated and washed twice with sterile physiological saline (0.85% NaCl, w / v) before DNA sequencing verification. Simultaneously, the *E. coli* transformant culture was preserved at -80 °C using the glycerol preservation method. The recombinant plasmid pMG36e-NC8_RS07780 was then successfully constructed. The PCR verification reaction system for the transformants is shown in Table 5, and the amplification reaction procedure is shown in Table 6.

[0029] Table 5 Transformant PCR Validation Reaction System

[0030] Table 6 PCR Amplification Reaction Procedure

[0031] (5) Extraction and transformation of recombinant plasmids The plasmid containing recombinant plasmid pMG36e-NC8_RS07780 was added. E. coli DH5α strain was inoculated at a 2% inoculum into LB broth with a final concentration of 600 µg / mL erythromycin and cultured at 37 °C and 200 rpm until the logarithmic growth phase. Recombinant plasmids were extracted using a plasmid miniprep kit. 10 µL of plasmid was then mixed with 100 µL of erythromycin... L. plantarum SC-MDJ competent cells were gently mixed and incubated on ice for 5 min. Then, plasmids were transformed into the competent cells using an electroporator with a 1 mm spacing. The voltage was adjusted to 1.25 kV, and two consecutive electroporations were performed. Immediately after electroporation, 890 μL of pre-chilled MRS broth was added, and the cells were incubated at 30 °C for 2.5 h. After incubation, the bacterial culture was concentrated by centrifugation and then plated onto MRS agar containing 100 µg / mL erythromycin. The cells were then incubated statically at 30 °C until bacterial growth was observed, followed by screening and validation.

[0032] (6) Screening and validation of gene overexpression strains Single colonies were inoculated into MRS broth containing erythromycin at a final concentration of 10 µg / mL using a sterile pipette tip. The colonies were incubated at 30 °C and 200 rpm until the logarithmic growth phase. The bacterial culture was aspirated and the cells were washed twice with sterile physiological saline (0.85% NaCl, w / v). PCR verification was performed using pMG36e-F and pMG36e-R primers. The correctly verified bacterial culture was then re-inoculated into MRS broth containing erythromycin at a final concentration of 10 µg / mL and incubated at 30 °C and 200 rpm until the logarithmic growth phase. The bacterial culture was then stored at -80 °C using the glycerol preservation method. The stress protein gene was overexpressed. L. plantarum The construction is now complete, named L. plantarum SC-MDJ-NC8_RS07780. The PCR validation reaction system is the same as in Table 5, and the amplification reaction procedure is the same as in Table 6.

[0033] Figure 1 This document outlines the construction process for stress protein gene overexpression plasmids. Figure 2 To overexpress stress protein genes L. plants PCR identification results. The successfully constructed recombinant plasmid pMG36e-NC8_RS07780 was extracted using a plasmid DNA extraction kit. E. coli Extracted from DH5α and converted to electroporation. L. plantarumIn SC-MDJ, single colonies were picked from erythromycin-resistant MRS agar for PCR verification of transformants to check whether the recombinant plasmid had been successfully transformed into the target culture medium. L. plantarum In SC-MDJ, strains overexpressing stress protein genes were obtained. The results of 1% agarose gel electrophoresis are shown below. Figure 2 As shown, a single bright band appears at approximately 1164 bp, indicating good quality and successful transformation of the recombinant plasmid pMG36e-NC8_RS07780 to the target region. L. plantarum In SC-MDJ, strains overexpressing stress protein genes L. plantarum SC-MDJ-NC8_RS07780 has been successfully built. Furthermore... L. plantarum SC-MDJ-NC8_RS07780 NC8_RS07780 The relative expression level of gene mRNA increased by 20.52 times, which also indicates that the gene overexpression was successful.

[0034] Example 2. Improvement L. plantarum Determination of cold tolerance and metabolic capacity of SC-MDJ-NC8_RS07780 (1) Preparation of fermentation agent overexpression strains L. plantarum SC-MDJ-NC8_RS07780 and control strain L. plantarum SC-MDJ was inoculated at a 2% inoculum into MRS broth containing erythromycin at a final concentration of 10 µg / mL, cultured at 30 °C and 200 rpm until the logarithmic growth phase, and passaged twice. The cultures were then collected.

[0035] (2) Establishment of fermentation system The culture was inoculated into MRS broth containing a final concentration of 10 µg / mL erythromycin for inoculation. L. plants The SC-MDJ fermentation system was used as a control group and inoculated. L. plantarum The fermentation system of SC-MDJ-NC8_RS07780 was used as the experimental group and fermented for 6 days at 15 °C and 200 rpm.

[0036] (3) Determination of the growth and metabolic capacity of the fermentation agent After collecting the cultures, the OD was measured using a spectrophotometer. 600nm To evaluate the growth capacity of the strain, the pH of the fermentation broth was measured using a pH meter, and the OD of the strain was determined using a lactate dehydrogenase activity assay kit. 600nm Lactate dehydrogenase activity (=0.8) was used to evaluate the acid-producing capacity of the strain. One unit of enzyme activity was defined as the production of 1 nmol of pyruvate per mg of protein per minute.

[0037] Table 7 L. plantarumOD of SC-MDJ-NC8_RS07780 600nm pH and lactate dehydrogenase activity

[0038] Note: Different lowercase letters in the vertical column indicate significant differences between treatments. P <0.05).

[0039] Table 7 is... L. plantarum OD of SC-MDJ-NC8_RS07780 600nm Results of pH and lactate dehydrogenase activity assays were obtained. The experimental results indicate that inoculation with organisms expressing stress protein genes... L. plantarum Fermentation of SC-MDJ-NC8_RS07780 under low-temperature conditions can reduce the OD of the strain. 600nm The activity of the stress protein gene was increased to 1.421, a 34.27% improvement compared to the control group; simultaneously, the pH of the fermentation system was reduced to 4.40, an 11.82% decrease compared to the control group; and the lactate dehydrogenase activity reached 49.24 U / mg protein, a 332% increase compared to the control group. Therefore, these results demonstrate that overexpression of the stress protein gene can significantly improve… L. plants The growth and acid production capabilities of SC-MDJ in low-temperature environments endow the starter with unique physiological functions and enhance the lactic acid metabolism pathway. This not only helps to increase the fermentation speed of low-temperature fermented vegetable products such as sauerkraut, but also improves the flavor, quality and safety of the products, and reduces resource waste in the food production process.

[0040] Example 3. L. plantarum Determination of total acidity and degradation nitrite levels during fermentation (SC-MDJ-NC8_RS07780) L. plantarum Determination of total acidity in fermentation production (SC-MDJ-NC8_RS07780): (1) Establishment of fermentation system 1 mg / mL sodium nitrite was added to MRS broth containing 10 µg / mL erythromycin. The culture medium without inoculation was used as a control. Fermentation was carried out at 15 °C and 200 rpm for 4 days, and the total acid content in the fermentation system was measured.

[0041] (2) Determination of total acid content Take 10.0 mL of fermentation broth, add purified water, and bring the volume to 100 mL. Filter the broth through gauze to remove impurities. Collect 50 mL of the filtrate and titrate with 0.1 mol / L NaOH, adding 2 drops of 10 g / L phenolphthalein indicator. Record the volume of NaOH solution (V1) when the solution turns slightly pink and the volume of NaOH solution consumed when using purified water instead of the sample solution (V2).

[0042] (3) The formula for calculating the total acid content (mg / mL) is as follows:

[0043] Note: c: Concentration of sodium hydroxide standard titration solution, in mol / L; V1: Volume of sodium hydroxide standard titration solution consumed in titrating the test solution, in milliliters (mL); V2: Volume of sodium hydroxide standard titration solution consumed in the blank test, in milliliters (mL); k: Conversion factor for acid (calculated for lactic acid, 0.090); F: Dilution factor of the solution; m: Mass of the sample, in milliliters (mL); 1000: Conversion factor.

[0044] L. plantarum Determination of nitrite degradation by fermentation using SC-MDJ-NC8_RS07780: (1) Establishment of fermentation system 1 mg / mL of sodium nitrite was added to MRS broth containing 10 µg / mL erythromycin. The culture medium without inoculation was used as a control. Fermentation was carried out at 15 °C and 200 rpm for 4 days, and the sodium nitrite content in the fermentation system was measured.

[0045] (2) Determination of nitrite content The nitrite content in water and soil was determined using a kit for determining nitrite content in water and soil (Grace, Suzhou, China).

[0046] (3) The formula for calculating the nitrite degradation rate is as follows:

[0047] Note: X1 is the sodium nitrite content in the control culture medium, in milligrams per milliliter (mg / mL); X2 is the sodium nitrite content in the inoculated fermentation medium, in milligrams per milliliter (mg / mL).

[0048] Table 8 L. plantarum Total acid and sodium nitrite content in the SC-MDJ-NC8_RS07780 fermentation system

[0049] Note: Different lowercase letters in the vertical column indicate significant differences between samples. P<0.05).

[0050] Table 8 is... L. plantarum Results of total acid and sodium nitrite content determination in the SC-MDJ-NC8_RS07780 fermentation system. Experimental results indicate that inoculation with a stress protein gene overexpressing... L. plantarum Fermentation of SC-MDJ-NC8_RS07780 at 15 °C can increase the total acid content in the fermentation system to 16.84 mg / mL, while reducing the sodium nitrite content to 0.012 mg / mL, achieving a nitrite degradation rate of 98.80%. The increased total acid content enhances the texture and flavor of the food, thus contributing to the formation of a pleasant taste. Therefore, L. plantarum The SC-MDJ-NC8_RS07780 starter culture also enhances the flavor of fermented foods. Compared to mesophilic fermentation, it can significantly improve the acid production and nitrite degradation capabilities of the starter culture at lower temperatures. This not only helps improve the quality and safety of low-temperature fermented vegetable foods such as sauerkraut, but also greatly increases the fermentation speed and reduces resource waste during the production process.

[0051] Example 4. L. plantarum Determination of lactic acid production capacity of SC-MDJ-NC8_RS07780 (1) Preparation of fermentation agent overexpression strains L. plantarum SC-MDJ-NC8_RS07780 and control strain L. plantarum SC-MDJ was inoculated at a 2% inoculum into MRS broth containing erythromycin at a final concentration of 10 µg / mL, cultured at 30 °C and 200 rpm until the logarithmic growth phase, and passaged twice. The cultures were then collected.

[0052] (2) Establishment of fermentation system The culture was inoculated into MRS broth containing a final concentration of 10 µg / mL erythromycin for inoculation. L. plants The SC-MDJ fermentation system was used as a control group and inoculated. L. plantarum The fermentation system of SC-MDJ-NC8_RS07780 was used as the experimental group and fermented for 6 days at 15 °C and 200 rpm.

[0053] (3) Lactic acid production capacity determination After collecting the fermentation broth, the lactic acid content in the fermentation broth was determined using high performance liquid chromatography (HPLC) to evaluate the lactic acid production capacity of the strain under low temperature conditions.

[0054] Table 9 L. plantarumLactic acid production capacity of SC-MDJ-NC8_RS07780

[0055] Note: Different lowercase letters in the vertical column indicate significant differences between treatments. P <0.05).

[0056] Table 9 is... L. plantarum Results of lactic acid content determination in the SC-MDJ-NC8_RS07780 fermentation system. The experimental results indicate that inoculation with a stress protein gene overexpressing... L. plantarum Fermentation of SC-MDJ-NC8_RS07780 at 15 °C increased the lactic acid content in the fermentation system to 11.62 mg / mL, a 40.85% increase compared to the control group. This increased lactic acid content enhances the unique sour taste of the food, thus contributing to the development of a pleasant flavor. Therefore, L. plants The SC-MDJ-NC8_RS07780 starter culture also enhances the flavor of fermented foods, helping to improve the quality and safety of low-temperature fermented vegetable products such as sauerkraut, and promoting product fermentation and maturation. Furthermore, given that microbial fermentation can efficiently produce the industrial chemical lactic acid while reducing environmental pollution and resource waste, it is conducive to industrial application.

Claims

1. A recombinant Lactobacillus plantarum ( Lactiplantibacillus plantarum ), characterized in that, The application discloses a recombinant Lactiplantibacillus plantarum and a preparation method thereof.

2. The recombinant plant Lactobacillus plantarum of claim 1, characterized in that, The application discloses a recombinant Lactiplantibacillus plantarum and a preparation method thereof.

3. A microbial preparation containing the recombinant Lactiplantibacillus plantarum according to claim 1 or 2.

4. The recombinant Lactiplantibacillus plantarum according to claim 1 or 2 or the microbial preparation according to claim 3 is used for improving lactic acid production, improving lactic acid dehydrogenase activity or improving cold tolerance of the Lactiplantibacillus plantarum.

5. A method of increasing the activity of Lactobacillus plantarum lactate dehydrogenase, characterized in that, The application discloses a recombinant Lactiplantibacillus plantarum and a preparation method thereof.

6. A method for increasing the lactic acid yield of *Lactobacillus plantarum*, characterized in that, The recombinant Lactiplantibacillus plantarum according to claim 1 or 2 is added into MRS culture medium and subjected to fermentation at 15 DEG C.

7. A method for breeding cold-tolerant Lactobacillus plantarum or Lactobacillus plantarum having improved ability to degrade nitrite, characterized by, The application discloses a recombinant Lactiplantibacillus plantarum and a preparation method thereof.

8. The gene overexpressed according to SEQ ID NO. 1 is used for improving lactic acid dehydrogenase activity in the Lactiplantibacillus plantarum, improving lactic acid content in the Lactiplantibacillus plantarum or improving cold tolerance of the Lactiplantibacillus plantarum.

9. The gene overexpressed according to SEQ ID NO. 1 is used for promoting growth of the Lactiplantibacillus plantarum.

10. The gene overexpressed according to SEQ ID NO. 1 or the recombinant Lactiplantibacillus plantarum according to claim 1 or 2 or the microbial preparation according to claim 3 is used for improving degradation of nitrite in the Lactiplantibacillus plantarum.

Images