Recombinant corynebacterium glutamicum for producing 5-aminolevulinic acid as well as construction method and application of recombinant corynebacterium glutamicum

Abstract

The invention relates to the technical field of biochemical engineering, in particular to recombinant corynebacterium glutamicum for producing 5-aminolevulinic acid as well as a construction method and application of the recombinant corynebacterium glutamicum. According to the construction method of the recombinant corynebacterium glutamicum capable of producing 5-aminolevulinic acid, a hemARsp gene is heterologously expressed, genes such as SigB and RamB are knocked out and optimized, transcriptional regulatory factors related to carbon metabolism, nitrogen metabolism, phosphorus metabolism, SOS response / pressure response, iron and sulfur homeostasis and the like in the recombinant corynebacterium glutamicum are optimized, and the recombinant corynebacterium glutamicum capable of producing 5-aminolevulinic acid is obtained. And carrying out global regulation and control on a cell metabolism network, and guiding the cell metabolism flux to the accumulation direction of a target product, so as to obtain the recombinant corynebacterium glutamicum for high yield of 5-aminolevulinic acid.

Description

Technical Field

[0001] This invention relates to the field of biochemical technology, and in particular to a recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid, its construction method, and its application. Background Technology

[0002] 5-Aminolevulinic acid (5-ALA) is a non-proteinogenic amino acid widely found in microbial, plant, and animal cells. It is a common precursor to tetrapyrrole compounds such as heme, porphyrin, and vitamin B, occupying a crucial position in metabolism and deeply involved in fundamental life processes such as cellular respiration and photosynthesis. Due to the key role of tetrapyrrole compounds in regulating cellular metabolism and growth, 5-aminolevulinic acid is used in medicine as a photodynamic drug and nutrient, showing wide application in the photodynamic diagnosis and treatment of various cancers and many skin diseases. In agriculture, exogenous supplementation of 5-aminolevulinic acid can effectively increase intracellular chlorophyll levels in crop cells, thus serving as a plant growth regulator to improve crop yield and resist the harmful effects of various abiotic stresses. Furthermore, 5-aminolevulinic acid can be used as a feed additive to enhance ATP production and immune responses, thereby improving the growth performance of chickens, pigs, and shrimp. Therefore, the demand for 5-aminolevulinic acid is increasing year by year, possessing significant economic value and broad market prospects.

[0003] Currently, the main methods for synthesizing 5-aminolevulinic acid (5-ALA) include chemical synthesis and microbial synthesis. Chemical synthesis faces challenges such as complex steps, expensive raw materials, difficult separation and purification processes, low yields, and environmental pollution, resulting in high costs for commercially available 5-ALA. Compared to chemical methods, the emergence of 5-ALA biomanufacturing technology has the potential to reduce production costs, thus promising higher profit margins. The rapid growth of microorganisms in simple culture media and the scalability of established fermentation processes enable the efficient production of large quantities of the target compound. Therefore, microbial synthesis is an environmentally friendly and efficient method. Recent advances in synthetic biology have expanded the possibilities for environmentally sustainable 5-ALA biomanufacturing, highlighting the shift towards green production methods. Research on microbial synthesis of 5-ALA has made some progress; there are reports of de novo synthesis of 5-ALA using *Escherichia coli* and *Corynebacterium glutamicum*, but the yields are low and cannot meet the needs of large-scale industrial production.

[0004] To better address the problem of low yield and meet the growing market demand for 5-aminolevulinic acid (5-ALA), constructing suitable microbial factories to produce 5-ALA from scratch has become a current research hotspot. At the current research stage, it is known that *Corynebacterium glutamicum* is a biosafe bacterium that is non-toxic to humans and has been widely used in the production of various amino acids and their derivatives, showing great potential in the production of 5-ALA. Wild-type *Corynebacterium glutamicum* cannot naturally produce 5-ALA, but recombinant *Corynebacterium glutamicum* modified through genetic engineering and metabolic engineering has the following advantages as a 5-ALA production strain: (1) *Corynebacterium glutamicum* is a biosafe bacterium that is non-toxic and harmless to humans; (2) *Corynebacterium glutamicum* is a Gram-positive bacterium with strong tolerance to high concentrations of the product; (3) *Corynebacterium glutamicum* is a model strain, and its physiological and biochemical characteristics and metabolic pathways are well understood, with relatively mature modification methods. Furthermore, appropriate modification methods are also crucial. Cells can finely control the expression of hundreds or thousands of genes within the cell by fine-tuning transcription factors associated with their global transcriptional mechanisms. Based on this principle, the constructed global transcriptional regulation engineering (gTME) strategy overcomes the limitations of targeting only single gene modifications and is expected to further increase the production of 5-aminolevulinic acid in recombinant Corynebacterium glutamicum. Summary of the Invention

[0005] In view of the shortcomings of the prior art, the purpose of this invention is to provide a recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid, its construction method and application, with the aim of improving the 5-aminolevulinic acid yield of recombinant Corynebacterium glutamicum.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The first aspect of this invention provides a method for constructing a recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid, comprising the following steps:

[0008] The hemARsp gene was introduced into Corynebacterium glutamicum ATCC 13032 to construct the 5-aminolevulinic acid synthesis pathway, thus obtaining the first recombinant Corynebacterium glutamicum.

[0009] Based on the first recombinant Corynebacterium glutamicum, the SOS response / pressure response transcription factor SigB gene, a global transcriptional regulatory factor, was knocked out to obtain the second recombinant Corynebacterium glutamicum.

[0010] The method for constructing the recombinant Corynebacterium glutamicum producing 5-aminolevulinic acid further includes:

[0011] Based on the second recombinant Corynebacterium glutamicum, the RamB gene, a carbon metabolism transcription factor among global transcription regulators, was knocked out to obtain the third recombinant Corynebacterium glutamicum.

[0012] The method for constructing the recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid further includes: based on the second recombinant Corynebacterium glutamicum, knocking out the SigM gene in the global transcription regulatory factor to obtain the fourth recombinant Corynebacterium glutamicum.

[0013] The method for constructing the recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid further includes: based on the second recombinant Corynebacterium glutamicum, knocking out the LldR gene in the global transcription regulatory factor to obtain the fifth recombinant Corynebacterium glutamicum.

[0014] The method for constructing the recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid further includes: based on the second recombinant Corynebacterium glutamicum, knocking out the AmtR gene in the global transcription regulatory factor to obtain the sixth recombinant Corynebacterium glutamicum.

[0015] The method for constructing the recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid, wherein the hemARsp gene is obtained by expression of the expression plasmid pEC-XK99E.

[0016] A second aspect of the present invention provides a recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid, which is constructed using the method described above for constructing a recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid.

[0017] A third aspect of the present invention provides a method for producing 5-aminolevulinic acid by fermentation, which uses the recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid as described above to produce 5-aminolevulinic acid.

[0018] The method for producing 5-aminolevulinic acid by fermentation, wherein the fermentation temperature of recombinant Corynebacterium glutamicum is at least 32°C, the rotation speed of the stirring or shaking equipment is not less than 250 rpm, and the fermentation time is not less than 48 hours.

[0019] The method for producing 5-aminolevulinic acid by fermentation, wherein the fermentation medium of recombinant Corynebacterium glutamicum comprises at least: glucose, (NH4)2SO4, corn steep liquor, KH2PO4, MgSO4·7H2O, VB1, FeSO4·7H2O, CaCO3, and glycine.

[0020] Beneficial effects: This invention provides a method for constructing a recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid. By first introducing an expression plasmid to heterologously express the hemARsp gene, a recombinant Corynebacterium glutamicum that can produce 5-aminolevulinic acid is constructed. Then, the SOS response / pressure response transcriptional regulator SigB gene in the global transcriptional regulatory factors is knocked out and optimized. By cutting off the competitive metabolic pathway, the production of 5-aminolevulinic acid is increased.

[0021] Furthermore, this invention also globally regulates the cellular metabolic network by knocking out other transcriptional regulatory factors, guiding cellular metabolic flux toward the accumulation of target products, thereby further increasing the production of 5-aminolevulinic acid. Attached Figure Description

[0022] Figure 1 This is a schematic diagram of the construction of the pEC-hemARsp plasmid and the PCR verification of the bacterial screening gene fragments in this application.

[0023] Figure 2 This is a schematic diagram of the construction and PCR verification of the bacterial screening gene fragments of recombinant Corynebacterium glutamicum KA in this application.

[0024] Figure 3 This is a graph showing the yield of 5-aminolevulinic acid from shake-flask fermentation of Corynebacterium glutamicum ATCC 13032 and recombinant Corynebacterium glutamicum KA, as described in this application.

[0025] Figure 4 This is a schematic diagram illustrating the construction and PCR verification of the bacterial screening gene fragments of plasmids PSR18-SugR, PSR18-GntR1, PSR18-GlxR, PSR18-LldR, PSR18-FruR, PSR18-ArgR, PSR18-AmtR, PSR18-PhoR, PSR18-SigD, PSR18-DtxR, PSR18-CysR, PSR18-McbR, PSR18-SigB, PSR18-SigM, and PSR18-RamB in this application.

[0026] Figure 5 This is a schematic diagram of the construction and PCR verification of some KA-1 to KA-15 recombinant bacteria gene fragments in this application.

[0027] Figure 6 This is a graph showing the yield of 5-aminolevulinic acid from shake-flask fermentation of KA, KA-1 to KA-15 in this application.

[0028] Figure 7 This is a schematic diagram of the construction and PCR verification of some KA-16 to KA-19 recombinant bacteria gene fragments in this application.

[0029] Figure 8 This is a graph showing the yield of 5-aminolevulinic acid from shake-flask fermentation of KA-1, KA-16 to KA-19 in this application. Detailed Implementation

[0030] This invention provides a recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid, its construction method, and its applications. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below with reference to the accompanying drawings and examples. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0031] In the description of this invention, it should be understood that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of this invention, unless otherwise stated, "multiple" means two or more.

[0032] Example 1: Construction of Recombinant Corynebacterium Glutamate KA

[0033] Step 01. Construct expression plasmid pEC-XK99E

[0034] Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, PCR was performed using hemARsp-F and hemARsp-R primers to obtain a hemARsp gene fragment of approximately 1400 bp in length.

[0035] Primer sequences:

[0036] pEC-XK99E-F: TCATCCGGCTCGTAATGTGT

[0037] pEC-XK99E-R:AACGCAAAAAGGCCATCCGT.

[0038] Purification was performed using a PCR product purification and recovery kit (Full Gold), and the results are as follows: Figure 1-1 As shown.

[0039] The Corynebacterium glutamicum expression plasmid pEC-XK99E was double-digested with EcoR I and Xba I, and the hemARsp gene was ligated into pEC-XK99E using a one-step cloning kit (Novizan) to obtain the recombinant plasmid.

[0040] The recombinant plasmid was transformed into Escherichia coli DH5α by heat shock, and then the Escherichia coli DH5α bacterial suspension was screened on LB agar plates containing 50 mg / L kanamycin.

[0041] PCR positive clones were verified using pEC-XK99E-F and pEC-XK99E-R primer pairs. Figure 1-2 Lanes 1 and 2). After correct sequencing, the recombinant expression plasmid was named pEC-hemARsp;

[0042] Primer sequences:

[0043] hemA-F(pEC):cacaggaaacagaccatggaaATTCGGAATTGTGAGCGGATA

[0044] hemA-R(pEC):gcatgcctgcaggtcgactctagaTAGATTATGCAGCCTTAGCCAG

[0045] Step 02. Constructing recombinant Corynebacterium glutamicum KA

[0046] The expression plasmid pEC-hemARsp was electroporated into *Corynebacterium glutamicum* ATCC 13032 using an electroporator (Bio-Rad). The electroporation cup width was 2 mm, the electroporation voltage was 3000 V, and the electroporation time was 4 ms. Recombinant bacteria were screened on LBHIS plates containing 25 mg / L kanamycin. Single colonies were selected and colony PCR was performed using pEC-check-F and pEC-check-R primers. A band of approximately 1400 bp was considered amplified, indicating successful transformation of the recombinant plasmid pEC-hemARsp into *Corynebacterium glutamicum*, yielding recombinant *Corynebacterium glutamicum* KA (results are shown in [link to results]). Figure 2 (lanes 1 and 2);

[0047] Primer sequences:

[0048] pEC-check-F:CAAGGCGCACTCCCGTTCTGGATAAT

[0049] pEC-check-R: CTACTGCCGCCAGGCAAATTCTGTT

[0050] The primer sequences above are existing technologies.

[0051] The Corynebacterium glutamicum ATCC 13032 strain used in this embodiment was purchased from Beijing BioBio Biotechnology Co., Ltd.

[0052] Example 2: Fermentation culture of Corynebacterium glutamicum ATCC 13032 and recombinant Corynebacterium glutamicum KA

[0053] Step 01. Streak Corynebacterium glutamicum ATCC 13032 and recombinant Corynebacterium glutamicum KA into LB agar plates and incubate for 24 hours. The LB medium consists of: 10 g / L tryptone, 10 g / L NaCl, 5 g / L yeast extract, 20 g / L agar powder, and 25 mg / L kanamycin.

[0054] Step 02. Inoculate the three lines of the LB plate onto LBG plates and incubate for 24 hours. The LBG medium consists of: 10 g / L tryptone, 10 g / L NaCl, 5 g / L yeast extract, 20 g / L glucose, 20 g / L agar powder, and 25 mg / L kanamycin.

[0055] Step 03. Inoculate 1 / 2 LBG of the mycelium sludge into a 250 mL Erlenmeyer flask containing 20 mL of seed culture medium. Fermentation temperature is 32℃, shaker speed is 250 rpm, and culture time is 12 h. The seed culture medium consists of: 30 g / L glucose (sterilized separately), 5 g / L yeast extract, 5 g / L urea, 3 g / L Na2HPO4·12H2O, 3 g / L KH2PO4, 1.2 g / L (NH4)SO4, 2 g / L MgSO4·7H2O, 0.5 g / L NaCl, 20 mg / L MnSO4·H2O, 50 mg / L FeSO4·7H2O, 5 mg / L VB1, and 0.1 mg / L biotin. Mix all ingredients, adjust pH to 6.90 with sodium hydroxide, and sterilize. Add 25 μg / mL kanamycin antibiotic during culture.

[0056] Step 04. Inoculate the seed culture solution into a 250mL Erlenmeyer flask containing 20mL of fermentation medium at an inoculation rate of 10%. At the time of inoculation, add IPTG inducer with a final concentration of 1mM. The fermentation temperature is 32℃ and the shaking speed is 250rpm. 6 hours after inoculation, add 20g / L glycine (prepared with 200g / L stock solution, sterilized, and 2mL of fermentation medium added to each flask). Collect samples and determine fermentation parameters after about 48 hours of fermentation.

[0057] The fermentation medium consisted of: 60 g / L glucose (sterilized separately), 5.5 g / L (NH4)2SO4, 5 mL / L corn steep liquor, 5.5 g / L KH2PO4, 2.2 g / L MgSO4·7H2O, 0.22 g / L FeSO4·7H2O, 1.1 mg / L VB1, and 10 g / L CaCO3 (0.2 g added per bottle separately), pH 6.5. Kanamycin antibiotic at 25 μg / mL was added during culturing.

[0058] Fermentation results as follows Figure 3 As shown, the yield of 5-aminolevulinic acid in recombinant Corynebacterium glutamicum KA is 1.52 g / L.

[0059] Example 3: Construction of Recombinant Suicide Plasmid

[0060] Taking the SigB gene as an example, using the genome of Corynebacterium glutamicum ATCC 13032 as a template, PCR was performed using SigB-up-F and SigB-up-R, and SigB-down-F and SigB-down-R as primers, respectively, to obtain the upstream and downstream homologous arms of the SigB gene, SigB-up and SigB-down, with a length of approximately 900 bp. Purification was performed using a PCR product purification and recovery kit (TransGold) (results are shown in...). Figure 4-1 (Lane 1, Lane 2)

[0061] Using SigB-up and SigB-down fragments as templates, fusion PCR amplification was performed using SigB-up-F and SigB-down-R primers to obtain the SigB-up & down gene fragments. The products were then purified using a PCR product purification and recovery kit (TransGold). (Results are shown in [link to results]). Figure 4-2 Lane 1).

[0062] The suicide plasmid PSR18 of Corynebacterium glutamicum was double-digested with Pst I and Xba I. The SigB-up&down gene fragment was ligated into PSR18 using a one-step cloning kit (Novizan). The resulting recombinant plasmid was then transformed into Escherichia coli DH5α by heat shock and screened on LB plates containing 100 mg / L spectinomycin.

[0063] Gene fragments of SugR, GntR1, GlxR, LldR, FruR, ArgR, AmtR, PhoR, SigD, DtxR, CysR, McbR, SigM, and RamB were constructed using the same method. These fragments were then ligated into PSR18 plasmids using the same method. The resulting recombinant plasmids were transformed into *E. coli* DH5α via heat shock and plated on LB agar plates containing 100 mg / L spectinomycin. Positive clones were verified by PCR using the M13 universal primer (results are shown in [link to results]). Figure 4-3 Lanes 1-15 were used to obtain recombinant plasmids, which were named PSR18-SugR, PSR18-GntR1, PSR18-GlxR, PSR18-LldR, PSR18-FruR, PSR18-ArgR, PSR18-AmtR, PSR18-PhoR, PSR18-SigD, PSR18-DtxR, PSR18-CysR, PSR18-McbR, PSR18-SigB, PSR18-SigM, and PSR18-RamB, respectively.

[0064] The primer sequences used in this embodiment are as follows:

[0065] AmtR-up-F:agtgccAAGCTTgcatgcCTGCActCACTGAACCACGGTGAAGAGC

[0066] AmtR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGAGAATCTCCTCGC GAGGATTC

[0067] AmtR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTCCACGCATCAAATCGCTGAT

[0068] AmtR-down-R:cggtacccggggatcctctaATGCCATCCATGCGGATTTCC

[0069] AmtR-check-F:TCTGCTGAGCTTTCACCCGT

[0070] ArgR-up-F:agtgccAAGCTTgcatgcCTGCacttCATCGCTCATTTGGGTGGACA

[0071] ArgR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGACAGTGCGAGTCACGGGATTTA

[0072] ArgR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTTGAATTGCTGCTGGATGAAGG

[0073] ArgR-down-R:cggtacccggggatcctctaGCAGTACTCCTCAGCGAACTC

[0074] ArgR-check-F:CACGCCAAGCTCTCATTTTGC

[0075] CysR-up-F:agtgccAAGCTTgcatgcCTGCActCCACCGCATCGGAATTTTGTC

[0076] CysR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGATTGATCGACTACTCAACGAGC

[0077] CysR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTATTCCTTCTTCAATTGGGAAG

[0078] CysR-down-R:cggtacccggggatcctctaTAGAACTCGCTCCAAGTCCAT

[0079] CysR-check-F:GATCAACCGGAGCTCAATGTC

[0080] DtxR-up-F:agtgccAAGCTTgcatgcCTGCActCCACCAATGAGGAACTCGCAG

[0081] DtxR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGAGAGGCTGCCTTCCTTGTTTTT

[0082] DtxR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTCTGCGCACTATTTACGAGCTG

[0083] DtxR-down-R:cggtacccggggatcctctaCCTTCTATCAGGCGAGCGTCA

[0084] DtxR-check-F:GATCTGGTCGATACCACCGAA

[0085] FruR-up-F:agtgccAAGCTTgcatgcCTGCActCTCTTCATCGCCACGAAGTTC

[0086] FruR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGAGCTGACCATGCTTAACCTCGC

[0087] FruR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTGTGCGGTGTCTGTAGGAGATT

[0088] FruR-down-R:cggtacccggggatcctctaATTGATGCCTTTACCACCTGC

[0089] FruR-check-F:CGGAAAGACAGCATGCAATTG

[0090] GlxR-up-F:agtgccAAGCTTgcatgcCTGCActCTGTTGTTTTGTGCCCTAATC

[0091] GlxR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGAGCGCTCGATAATCACCAAAGC

[0092] GlxR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTGTGTGCGAACGTTGCAAGAGC

[0093] GlxR-down-R:cggtacccggggatcctctagTTGGCTGCCAGCAATCTGTGA

[0094] GlxR-check-F:CAAATGCTCGGTGTCCACAAT

[0095] GntR1-up-F:agtgccAAGCTTgcatgcCTGCActCAGGTCTCAAACTGGGCCATT

[0096] GntR1-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGATGGGGGCAGAACCTAATGGAT

[0097] GntR1-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTCATCAGTGGCAAGGTTGCTGT

[0098] GntR1-down-R:cggtacccggggatcctctaGTTAGGGACGGAAACCCATCA

[0099] GntR1-check-F:CAGCCAAGCCACTTCTTGACA

[0100] LldR-up-F:agtgccAAGCTTgcatgcCTGCActCAAGACAAGCTTGATCGCACC

[0101] LldR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGATCGGTGACCCAATCCATGACA

[0102] LldR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTTCTCCGAAACCCTCGGAGTTT

[0103] LldR-down-R:cggtacccggggatcctctagTCCGGTTGAAGAGTTCGTGGT

[0104] LldR-check-F:GGTCGCCTAAAAATCGGTGAC

[0105] McbR-up-F:agtgccAAGCTTgcatgcCTGCActCCAGACAGACGTGCCAAGAAT

[0106] McbR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGATGAAGCGCTAGCAGCCACGTT

[0107] McbR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTAACCGTCGTCGCAATCGACCA

[0108] McbR-down-R:cggtacccggggatcctctaCAACAAACGTGGAACTCACCA

[0109] McbR-check-F:GGCAAGAGTAAAACAAGTGCC

[0110] PhoR-up-F:agtgccAAGCTTgcatgcCTGCActATCGGCGCATCTGAGCTTCTT

[0111] PhoR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGAGTGGCGTTGGATATGTTCTGC

[0112] PhoR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTGAGATGTAGGATTCCACGACG

[0113] PhoR-down-R:cggtacccggggatcctctaGGTAGAAGGCGTGGACTTGGA

[0114] PhoR-check-F:AGTCTGAATTAGCTGCGGATC

[0115] RamB-up-F:agtgccAAGCTTgcatgcCTGCActGTGCAGAACCAATGCGACCAG

[0116] RamB-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGAGGACCCCACATATGTCTTTCC

[0117] RamB-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTCCTTAGCAGCAACCCTTGGCT

[0118] RamB-down-R:cggtacccggggatcctctaGGCCTAGGTACTCGATGTCGT

[0119] RamB-check-F:GAAAGAGACCTGAGCCAGGCA

[0120] SigB-up-F:agtgccAAGCTTgcatgcCTGCActGAAGAAGGCATGGGCTTTAGT

[0121] SigB-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGACGTTCAGTCGTTGCGAGATC

[0122] SigB-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTCAGGACCTTGTTCGCGTTTAC

[0123] SigB-down-R:cggtacccggggatcctctaTCGCGGAGCTTACTCATGACT

[0124] SigB-check-F:AGAAGGGGCCAAACCAACGAC

[0125] SigD-up-F:agtgccAAGCTTgcatgcCTGCAcTAAAGACCCGGTCTGGTGACC

[0126] SigD-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGACGCTCAGTATCAGCCAAGTTC

[0127] SigD-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTGGAGATTATTCACCCCATTG

[0128] SigD-down-R:cggtacccggggatcctctaCTGCATAACCGTGGTGTCCGA

[0129] SigD-check-F:ATCGTCGGGCATTGCAAAGAA

[0130] SigM-up-F:agtgccAAGCTTgcatgcCTGCAcCGCTGTGGTGATCATCTTGGT

[0131] SigM-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGATAAGATCCCCCGCAGGTTGAG

[0132] SigM-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTGTTTATATCTGGCGACTCCAG

[0133] SigM-down-R:cggtacccggggatcctctaTCATAGCCCTCGAACATGATG

[0134] SigM-check-F:AACCATGACCTAAGCGATACC

[0135] SugR-up-F:agtgccAAGCTTgcatgcCTGCAcCTAGAGAAGAAGGGCTTCCTG

[0136] SugR-up-R:TCATCTGACCGCCCGTCGACAAGCTTGATATCTCTAGACCTCTGCGTACATGTCACTCC

[0137] SugR-down-F:AGCTTGTCGACGGGCGGTCAGATGATCGCCCTTTTTTGAATTAGCGGGCCGATTCGAT

[0138] SugR-down-R:cggtacccggggatcctctaTTCGATGGTGCCGTCAAGCTC

[0139] SugR-check-F:CGACAGATTGCCTCATTAACG

[0140] All of the above primer sequences are existing technologies.

[0141] Example 4: Construction of recombinant Corynebacterium glutamicum KA-1~KA-15

[0142] The specific construction steps for recombinant Corynebacterium glutamicum KA-1 to KA-15 are similar. Taking the construction of recombinant Corynebacterium glutamicum KA-1 as an example, PSR18-SigB was electroporated into recombinant Corynebacterium glutamicum KA using an electroporator (Bio-Rad). The electroporation cup width was 2 mm, the electroporation voltage was 3000 V, and the electroporation time was 4 ms. The recombinant bacteria were screened on LBHIS plates containing 100 mg / L spectinomycin and 25 mg / L kanamycin. Single colonies were selected and cultured in 50 μL of liquid LB for 5 h, and then plated on LB plates containing 100 g / L sucrose for secondary screening. Single colonies were selected and colony PCR was performed using SigB-check-F and SigB-down-R primers (results are shown in [link to results]). Figure 5 If a band of approximately 800 bp cannot be amplified in lanes 2 and 3, the SigB gene knockout is considered successful, and the recombinant Corynebacterium glutamicum is named KA-1:KA-ΔSigB.

[0143] In the same way, other recombinant strains KA-2: KA-ΔSigD, KA-3: KA-ΔSigM, KA-4: KA-ΔDtxR, KA-5: KA-ΔLldR, KA-6: KA-ΔRamB, KA-7: KA-ΔAmtR, KA-8: KA-ΔPhoR were obtained. , KA-9: KA-ΔMcbR, KA-10: KA-ΔFruR, KA-11: KA-ΔArgR, KA-12: KA-ΔSugR, KA-13: KA-ΔCysR, KA-14: KA-ΔGntR1, KA-15: KA-ΔGlxR.

[0144] Example 5: Shake-flask fermentation culture of recombinant Corynebacterium glutamicum KA, KA-1 to KA-15

[0145] Step 01. Streak recombinant Corynebacterium glutamicum KA, KA-1 to KA-15 onto LB agar plates and incubate for 24 hours. The LB medium consists of: 10 g / L tryptone, 10 g / L NaCl, 5 g / L yeast extract, 20 g / L agar powder, and 25 mg / L kanamycin.

[0146] Step 02. Inoculate the three lines of the LB plate onto LBG plates and incubate for 24 hours. The LBG medium consists of: 10 g / L tryptone, 10 g / L NaCl, 5 g / L yeast extract, 20 g / L glucose, 20 g / L agar powder, and 25 mg / L kanamycin.

[0147] Step 03. Inoculate 1 / 2 LBG of the mycelium sludge into a 250 mL Erlenmeyer flask containing 20 mL of seed culture medium. Fermentation temperature is 32℃, shaker speed is 250 rpm, and culture time is 12 h. The seed culture medium consists of: 30 g / L glucose (sterilized separately), 5 g / L yeast extract, 5 g / L urea, 3 g / L Na2HPO4·12H2O, 3 g / L KH2PO4, 1.2 g / L (NH4)SO4, 2 g / L MgSO4·7H2O, 0.5 g / L NaCl, 20 mg / L MnSO4·H2O, 50 mg / L FeSO4·7H2O, 5 mg / L VB1, and 0.1 mg / L biotin. Mix all ingredients, adjust pH to 6.90 with sodium hydroxide, and sterilize. Add 25 μg / mL kanamycin antibiotic during culture.

[0148] Step 04. Inoculate the seed culture solution into a 250mL Erlenmeyer flask containing 20mL of fermentation medium at an inoculation rate of 10%. At the time of inoculation, add IPTG inducer with a final concentration of 1mM. The fermentation temperature is 32℃ and the shaking speed is 250rpm. 6 hours after inoculation, add 20g / L glycine (prepared with 200g / L stock solution, sterilized, and 2mL of fermentation medium added to each flask). Collect samples and determine fermentation parameters after about 48 hours of fermentation.

[0149] The fermentation medium consisted of: 60 g / L glucose (sterilized separately), 5.5 g / L (NH4)2SO4, 5 mL / L corn steep liquor, 5.5 g / L KH2PO4, 2.2 g / L MgSO4·7H2O, 0.22 g / L FeSO4·7H2O, 1.1 mg / L VB1, and 10 g / L CaCO3 (0.2 g added per bottle separately), pH 6.5. Kanamycin antibiotic at 25 μg / mL was added during culturing.

[0150] Fermentation results as follows Figure 6 As shown, the recombinant Corynebacterium glutamicum-1 produced the highest yield of 5-aminolevulinic acid, at 2.31 g / L.

[0151] Example 6: Construction of recombinant Corynebacterium glutamicum KA-16~KA-19

[0152] The specific construction steps for recombinant Corynebacterium glutamicum KA-16 to KA-19 are similar. Taking the construction of recombinant Corynebacterium glutamicum KA-18 as an example, PSR18-RamB was electroporated into KA-1 using an electroporator (Bio-Ray). The electroporation cup width was 2 mm, the electroporation voltage was 3000 V, and the electroporation time was 4 ms. The recombinant bacteria were screened on LBHIS plates containing 100 mg / L spectinomycin and 25 mg / L kanamycin. Single colonies were selected and cultured in 50 μL of liquid LB for 5 h, and then plated on LB plates containing 100 g / L sucrose for secondary screening. Single colonies were selected and colony PCR was performed using RamB-check-F and RamB-down-R primers (results are shown in [link to results]). Figure 7 If a band of approximately 1000 bp cannot be amplified in lanes 1, 2, 3, and 4, the SigB gene knockout is considered successful, and the recombinant bacterium is named KA-18:KA-ΔSigB-ΔRamB. Similarly, other recombinant bacteria were obtained: KA-16:KA-ΔSigB-ΔSigM, KA-17:KA-ΔSigB-ΔLldR, and KA-19:KA-ΔSigB-ΔAmtR.

[0153] Example 7: Shake-flask fermentation culture of recombinant Corynebacterium glutamicum KA-16~KA-19

[0154] The fermentation culture method for recombinant Corynebacterium glutamicum KA-16~KA-19 is the same as in Example 5, and will not be repeated here. The fermentation results are as follows: Figure 8 As shown, the recombinant Corynebacterium glutamicum-18 produced the highest yield of 5-aminolevulinic acid, at 6.24 g / L.

[0155] In summary, this invention globally regulates the cellular metabolic network by knocking out and optimizing transcriptional regulatory factors related to carbon metabolism, nitrogen metabolism, phosphorus metabolism, SOS response / stress response, and iron and sulfur homeostasis in recombinant Corynebacterium glutamicum KA, guiding cellular metabolic flux toward the accumulation of target products, thereby increasing the yield of 5-aminolevulinic acid.

[0156] It is understood that those skilled in the art can make equivalent substitutions or modifications to the technical solution and inventive concept of the present invention, and all such substitutions or modifications should fall within the protection scope of the appended claims.

Claims

1. A method for constructing a recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid, characterized in that, Includes the following steps: The hemARsp gene was introduced into Corynebacterium glutamicum ATCC 13032 to construct the 5-aminolevulinic acid synthesis pathway, thus obtaining the first recombinant Corynebacterium glutamicum. Based on the first recombinant Corynebacterium glutamicum, the SOS response / pressure response transcription factor SigB gene, a global transcriptional regulatory factor, was knocked out to obtain the second recombinant Corynebacterium glutamicum.

2. The method for constructing recombinant Corynebacterium glutamicum producing 5-aminolevulinic acid according to claim 1, characterized in that, Also includes: Based on the second recombinant Corynebacterium glutamicum, the RamB gene, a carbon metabolism transcription factor among global transcription regulators, was knocked out to obtain the third recombinant Corynebacterium glutamicum.

3. The method for constructing recombinant Corynebacterium glutamicum producing 5-aminolevulinic acid according to claim 1, characterized in that, Also includes: Based on the second recombinant Corynebacterium glutamicum, the SigM gene, a global transcriptional regulatory factor, was knocked out to obtain the fourth recombinant Corynebacterium glutamicum.

4. The method for constructing recombinant Corynebacterium glutamicum producing 5-aminolevulinic acid according to claim 1, characterized in that, Also includes: Based on the second recombinant Corynebacterium glutamicum, the LldR gene, a global transcriptional regulatory factor, was knocked out to obtain the fifth recombinant Corynebacterium glutamicum.

5. The method for constructing recombinant Corynebacterium glutamicum producing 5-aminolevulinic acid according to claim 1, characterized in that, Also includes: Based on the second recombinant Corynebacterium glutamicum, the AmtR gene, a global transcriptional regulatory factor, was knocked out to obtain the sixth recombinant Corynebacterium glutamicum.

6. The method for constructing recombinant Corynebacterium glutamicum producing 5-aminolevulinic acid according to claim 1, characterized in that, The hemARsp gene was obtained by expressing the expression plasmid pEC-XK99E.

7. A recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid, characterized in that, It was constructed using the method for constructing recombinant Corynebacterium glutamicum producing 5-aminolevulinic acid as described in any one of claims 1-6.

8. A method for producing 5-aminolevulinic acid by fermentation, characterized in that, 5-Aminolevulinic acid is produced by fermentation using the recombinant Corynebacterium glutamicum that produces 5-aminolevulinic acid as described in claim 7.

9. The method for producing 5-aminolevulinic acid by fermentation according to claim 8, characterized in that, The minimum fermentation temperature for recombinant Corynebacterium glutamicum is 32℃. During fermentation, the speed of the stirring or shaking equipment should not be less than 250 rpm, and the fermentation time should not be less than 48 hours.

10. The method for producing 5-aminolevulinic acid by fermentation according to claim 8, characterized in that, The fermentation medium for recombinant Corynebacterium glutamicum includes at least the following components: glucose, (NH4)2SO4, corn steep liquor, KH2PO4, MgSO4·7H2O, VB1, FeSO4·7H2O, CaCO3, and glycine.

Images