Rapid visual detection kit for drug resistance of chilo suppressalis bisamide insecticide and application of rapid visual detection kit

Abstract

The invention discloses a rapid visual detection kit for drug resistance of chilo suppressalis bisamide insecticides and application of the rapid visual detection kit. According to the invention, by utilizing the synergistic effect of RPA and CRISPR / Cas12a systems, Y4667D and I4758M mutation sites closely related to resistance in chilo suppressalis ryanodine receptor genes are specifically targeted, an RPA primer pair and crRNA are provided, a one-pot detection method is established, a reaction can be triggered only by manual uniform mixing at a constant temperature, and a centrifugation step is not needed; a coarsely extracted DNA sample can be directly used, so that a tedious purification process is omitted; in combination with a fluorescently-labeled DNA probe, chilo suppressalis individuals carrying key resistance mutations and sensitive individuals can be quickly identified and distinguished with high sensitivity, and the result can be directly observed and interpreted by naked eyes. A visual detection scheme which is extremely simple and convenient to operate, rapid in reaction, excellent in specificity and economical in cost is provided for monitoring chilo suppressalis bisamide insecticide resistant populations in the field in real time.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of pest resistance molecular detection, and particularly relates to a Chilo suppressalis diamide insecticide resistance rapid visual detection kit and application. BACKGROUND

[0002] Chilo suppressalis Chilo suppressalis (Walker) (Lepidoptera: Pyralidae), is a pest affecting global rice production. Its larvae feed and destroy the vascular system by boring into rice stems, causing huge yield losses in Asia, Oceania, the Middle East and Europe. In the past few decades, a variety of chemical insecticides have been systematically developed and applied to control Chilo suppressalis in the field. From the 1980s to the 1990s, organophosphorus (such as triazophos, chlorpyrifos) and nereistoxin neurotoxic agents (such as monocrotophos, dimehypo) were the main control agents. To cope with the emerging organophosphorus resistance, the subsequent strategy shifted to phenylpyrazoles, pyrethroids and ivermectin derivatives. Since 2008, a variety of diamide insecticides including flubendiamide, chlorantraniliprole, cyantraniliprole, tetraniliprole and broflanilide have been gradually applied; among them, chlorantraniliprole and other varieties have been widely used due to their high efficiency in preventing and controlling Chilo suppressalis.

[0003] Diamide insecticides rely on binding to insect ryanodine receptors (RyRs) for their insecticidal mechanism. Triggering RyRs activation leads to uncontrolled release of intracellular calcium ions and depletion of calcium stores, ultimately causing involuntary muscle contraction, paralysis and insect death. With low application dose and excellent insecticidal activity, this class of compounds has rapidly become a widely chosen option for controlling lepidopteran pests since its introduction. However, due to the lack of equally effective alternative agents and sustained selection pressure, field resistance to chlorantraniliprole has been confirmed in a variety of lepidopteran pests, including Plutella xylostella, Tuta absoluta, Spodoptera exigua and Chilo suppressalis.

[0004] As a new visual molecular diagnostic technology, RPA-CRISPR-Cas12a couples the recombinase polymerase amplification (RPA) reaction with the CRISPR-Cas12a system to achieve rapid, portable, and high-precision detection, and has been widely used in pesticide resistance monitoring in recent years. The RPA reaction realizes rapid amplification of target DNA under constant temperature conditions of 37-42℃; Cas12a relies on the precise recognition of target sequences by crRNA to activate and cut single-stranded fluorescent reporter probes to generate signals. The two work together to build a "double screening" mechanism, effectively suppressing non-specific amplification, and its false positive control ability is significantly better than traditional PCR and LAMP technology. In the field of agricultural resistance monitoring, this technology shows significant cost-effectiveness: the reagent consumption is only 1 / 5-1 / 10 of that of qPCR, and its integrated rapid detection process can be used to guide scientific use of pesticides in a timely and effective manner, reducing resistance evolution and economic losses caused by blind pesticide application. Although the complex sample pretreatment still needs to be optimized, this technology, by integrating rapid amplification, closed tube pollution prevention, and portable output, is becoming a core tool for promoting precision plant protection and is expected to achieve technology equity from the laboratory to the field. SUMMARY

[0005] The purpose of the present application is to at least solve one of the technical problems existing in the prior art, and provide a Chilo irridans diacylamine insecticide resistance rapid visual detection kit and application.

[0006] The prior art research shows that I4790M, E1338D and Q4594L mutations in the Plutella xylostella resistance population affect diacylamine resistance. The applicant found that there are Y4667D, Y4667C, I4758M and Y4891F mutation sites in Chilo irridans through research. Moreover, through in-depth study of the mechanism of multiple mutations in Chilo irridans RyRs conferring diacylamine pesticide resistance, it is found that Y4667D and I4758M are high-frequency mutations in the resistance population; more importantly, individuals carrying double mutations show stronger diacylamine pesticide resistance than individuals carrying single mutations, indicating that Y4667D and I4758M mutations are closely related to Chilo irridans resistance to diacylamine pesticides. Therefore, the present application designs RPA primer pairs and crRNA that specifically target key resistance mutation sites (Y4667D / I4758M) of Chilo irridans ryanodine receptors (RyRs). By coupling the recombinase polymerase amplification (RPA) and the CRISPR-Cas12a system, a double screening mechanism is formed, which can accurately distinguish between wild type (sensitive type) and mutant genotype (resistant type), effectively overcoming the false positive problem caused by primer mismatch or non-specific amplification of traditional PCR methods.

[0007] Especially crucially, the application breaks through the traditional step-by-step operation mode. Through one-pot pre-packaging design, the RPA reagent is placed at the bottom of the PCR tube, the Cas12a system is pre-stored in the tube cover, 37℃ constant temperature reaction, whole process closed tube manual shaking, avoiding repeated opening pollution risk, without high-speed centrifugation and only needs crude DNA liquid to complete the analysis. The innovative design of one-pot greatly improves the field practicability. Compared with the loop-mediated isothermal amplification technology (LAMP) which relies on 4-6 primers, the system of the application only needs a pair of primers to complete the amplification; the detection result is directly judged by the test strip fluorescence, without the support of turbidimeter or dyeing agent, which significantly simplifies the operation process. At the same time, the direct recognition characteristics of Cas12a to double-stranded DNA (different from the reverse transcription of Cas13 system) make it naturally adapt to the detection of DNA mutation related to pest resistance. The closed tube operation mode combined with the normal temperature reaction condition makes the technology realize on-site screening under the support of portable equipment, and completes the resistance genotype identification within 40-50 min, which provides immediate decision basis for precise pesticide application.

[0008] The technical solution of the application is as follows: The first aspect of the application provides an RPA primer pair for detecting the resistance of Chilo suppressalis to double amide insecticides, the RPA primer pair comprising an RPA primer pair for detecting Y4667D and / or I4758M resistance mutation sites in the Ryanodine receptor gene of Chilo suppressalis, wherein, The sequence of the forward primer of the RPA primer pair for detecting the Y4667D resistance mutation site is shown in SEQ ID NO: 1 or 2, and the sequence of the reverse primer is shown in SEQ ID NO: 3; The sequence of the forward primer of the RPA primer pair for detecting the I4758M resistance mutation site is shown in SEQ ID NO: 4 or 5, and the sequence of the reverse primer is shown in SEQ ID NO: 6.

[0009] As a preferred embodiment, the RPA primer pair for the Y4667D resistance mutation site is YD-RPA-F1 (SEQ ID NO: 1) and YD-RPA-R (SEQ ID NO: 3); The RPA primer pair for the I4758M resistance mutation site is IM-RPA-F2 (SEQ ID NO: 5) and IM-RPA-R (SEQ ID NO: 6).

[0010] The second aspect of the application provides a crRNA for detecting the resistance of Chilo suppressalis to double amide insecticides, the crRNA comprising a crRNA for detecting Y4667D and / or I4758M resistance mutation sites in the Ryanodine receptor gene of Chilo suppressalis, wherein, The sequence of the crRNA for detecting the Y4667D resistance mutation site is shown as SEQ ID NO: 7 or 8; The sequence of the crRNA for detecting the I4758M resistance mutation site is shown as SEQ ID NO: 9 or 10.

[0011] As a preferred embodiment, the crRNA for detecting the Y4667D resistance mutation site is YD-tCR1 (SEQ ID NO: 7); The crRNA for detecting the I4758M resistance mutation site is IM-tCR2 (SEQ ID NO: 10).

[0012] The YD-tCR1 (SEQ ID NO: 7), IM-tCR2 (SEQ ID NO: 10) and other crRNAs are designed and synthesized based on the Chilo irridans ryanodine receptor (RyRs) Y4667D / I4758M homozygous resistance mutation genomic DNA template sequence. The homozygous sensitive genomic DNA template and the homozygous resistance mutation genomic DNA template are obtained by cloning using the following primers, which are used as specific primers for DNA sequencing when optimizing the RPA-CRISPR / Cas12a detection system and exploring the subsequent one-pot system and field detection of Chilo irridans resistance samples.

[0013] The third aspect of the present application provides a sequence composition for detecting the resistance of Chilo irridans to diamide insecticides, which comprises the RPA primer and the crRNA.

[0014] The sequence composition is specifically detected for the Y4667D / I4758M resistance mutation site of the Chilo irridans ryanodine receptor (RyRs) gene.

[0015] The fourth aspect of the present application provides a rapid visual detection reagent for the resistance of Chilo irridans to diamide insecticides, which is specifically detected for the Y4667D / I4758M resistance mutation site of the Chilo irridans ryanodine receptor (RyRs) gene.

[0016] The reagent comprises: a sample genomic DNA rapid extraction reaction reagent, a recombinase polymerase amplification reaction reagent, and a CRISPR / Cas12a reaction reagent; The recombinase polymerase amplification reaction reagent comprises a pair of the RPA primers; The CRISPR / Cas12a reaction reagent comprises the crRNA and a ssDNA fluorescent reporter probe.

[0017] As a preferred embodiment, the sample genomic DNA rapid extraction reaction reagent comprises PCR amplification primers for amplifying Y4667D and / or I4758M resistance mutation sites in the Chilo suppressalis ryanodine receptor gene; wherein the sequences of the PCR amplification primers for amplifying the Y4667D resistance mutation site are shown as SEQ ID NOs: 11-12, and the sequences of the PCR amplification primers for amplifying the I4758M resistance mutation site are shown as SEQ ID NOs: 13-14.

[0018] As a preferred embodiment, the sequence of the ssDNA fluorescent reporter probe is 5'-F-TTTTT-Q-3', wherein F is a fluorescent group, and Q is a fluorescent quenching group.

[0019] The fifth aspect of the present application provides a Chilo suppressalis diamide insecticide resistance rapid visual detection kit, characterized in that the detection kit comprises the reagent.

[0020] As a preferred embodiment, the detection kit comprises: RPA primer pairs for Chilo suppressalis ryanodine receptor (RyRs) Y4667D / I4758M resistance mutation sites shown as SEQ ID NOs: 1-6; crRNA for detecting the Y4667D / I4758M resistance mutation sites shown as SEQ ID NOs: 7-10; the single-stranded DNA-FQ fluorescent reporter probe SSDL1 (sequence: 5'-F-TTTTT-Q-1-3'); Cas12a enzyme protein; DNAiso Reagent (Takara, Dalian, China), Annealing Buffer for DNA Oligos (Beyotime, Beijing, China), TwistAmp Basic kit (TwistDx, Cambridge, UK), LbaCas12a (NEB, Ipswich, MA, USA), TIANcombi DNA Lyse&Det PCR Kit (Tiangen, Beijing, China).

[0021] As a preferred embodiment, the kit comprises the amount and reaction time information of enzymes, buffers and other reagents required for RPA and CRISPR / Cas12a reactions.

[0022] As a preferred embodiment, the detection result of the kit is interpreted as follows: after the reaction is completed, if green fluorescence is observed with the naked eye under a blue light lamp, it indicates that the Chilo suppressalis sample to be tested contains homozygous or heterozygous mutations of the ryanodine receptor (RyRs) Y4667D or I4758M resistance mutation site, suggesting that the Chilo suppressalis population has developed a certain level of resistance to diamide insecticides.

[0023] The sixth aspect of the present application provides an application of the RPA primer, the crRNA, the sequence composition, the reagent or the detection kit, and the application comprises any one of the following: 1) Application in detection of Chilo suppressalis diamide insecticide resistance; 2) Application in genotyping of Chilo suppressalis ryanodine receptor (RyRs) gene Y4667D and / or I4758M resistance mutation site.

[0024] As a preferred embodiment, the application is the detection of Chilo suppressalis diamide insecticide resistance in the laboratory or in the field.

[0025] The seventh aspect of the present application provides a method for rapid visual detection of Chilo suppressalis diamide insecticide resistance using the reagent or the detection kit, and the method comprises the following steps: (1) Extracting Chilo suppressalis sample genomic DNA; (2) Adding recombinase polymerase amplification reaction reagent to the bottom of the reaction tube, adding the sample genomic DNA obtained in step (1), combining with the RPA primer, and performing RPA isothermal amplification reaction to obtain RPA amplification product; (3) Using the RPA product obtained in step (2) as a template, adding the CRISPR / Cas12a reaction reagent, and performing CRISPR / Cas12a reaction; (4) After the reaction is completed, the reaction product of step (3) is irradiated with a 365 nm LED lamp, and the presence or absence of a fluorescent signal is observed by naked eye under a blue light lamp; If a fluorescent signal is observed in step (4), it indicates that the Chilo suppressalis sample to be tested contains homozygous or heterozygous mutations of the ryanodine receptor Y4667D / I4758M resistance mutation site.

[0026] As a preferred embodiment, the method comprises the following specific steps: (1) Rapid extraction of Chilo suppressalis sample genomic DNA: using a reagent containing DNAiso reagent, anhydrous ethanol and ddH2O for genomic DNA extraction.

[0027] (2) RPA isothermal amplification reaction: adding RPA reaction reagent (containing buffer, primer, etc.) to the bottom of the reaction tube, adding the Chilo suppressalis sample genomic DNA obtained in step (1), using the RPA primer pair as shown in SEQ ID NO: 1-6 for RPA isothermal amplification reaction to obtain RPA amplification product.

[0028] Reaction conditions: temperature 37℃, time 5-20 min, and concentration of forward and reverse primers both 10 μM.

[0029] Preferred reaction system (50 μL): 29.5 μL primer free rehydration buffer, 2.4 μL 10 μM forward and reverse primers, 12.2 μL ddH2O, 1 μL template DNA, 2.5 μL 280 mM MgOAc, 1 microsphere; mix well.

[0030] Preferred primer pairs and lengths: YD-RPA-F1 (SEQ ID NO: 1) / YD-RPA-R (SEQ ID NO: 3) primer pair for Y4667D site, reaction for 10 min; IM-RPA-F2 (SEQ ID NO: 5) / IM-RPA-R (SEQ ID NO: 6) primer pair for I4758M site, reaction for 5 min.

[0031] (3) CRISPR / Cas12a reaction: Add CRISPR / Cas12a reaction reagents to the reaction tube. Centrifuge or manually shake to uniformly mix the RPA amplification product obtained in step (2) with crRNA and SS DNA1 fluorescent reporter probe as shown in SEQ ID NO: 7-10, and perform CRISPR / Cas12a reaction.

[0032] Reaction conditions: reaction temperature 37℃, reaction time 30 min; Cas12a enzyme protein and crRNA concentration ratio can be selected as 1:1 (200 nM:200 nM), 1:2 (200 nM:400 nM), 1:4 (200 nM:800 nM), 1:6 (200 nM:1200 nM), or 1:8 (200 nM:1600 nM), corresponding to Cas12a enzyme protein concentration of 50-250 nM; single-stranded DNA-FQ fluorescent probe SS DNA1 concentration of 1-8 μM; Preferred reaction conditions: detection of Y4667D mutation: crRNA is YD-tCR1 (SEQ ID NO: 7), Cas12a enzyme protein concentration is 150 nM, Cas12a enzyme:crRNA=1:6, single-stranded DNA-FQ fluorescent probe SS DNA1 concentration is 4 μM; detection of I4758M mutation: crRNA is IM-tCR2 (SEQ ID NO: 10), Cas12a enzyme protein concentration is 150 nM, Cas12a enzyme:crRNA=1:4.

[0033] The preferred reaction system (10 μL) for detecting the Y4667D mutation is: 3.6 μL Nuclease-Free Water, 1 μL NEBuffer r2.1 Reaction Buffer (10×), 0.9 μL crRNA (10 μM), 1.5 μL Cas12a (1 μM), 1 μL ssDNA reporter molecule (40 μM), and 2 μL RPA product, which are mixed.

[0034] The preferred reaction system (10 μL) for detecting the I4758M mutation is: 3.9 μL Nuclease-Free Water, 1 μL NEBuffer r2.1 Reaction Buffer (10×), 0.6 μL crRNA (10 μM), 1.5 μL Cas12a (1 μM), 1 μL ssDNA reporter molecule (40 μM), and 2 μL RPA product, which are mixed.

[0035] (4) Fluorescence visualization analysis: After the reaction is completed, the reaction product of step (3) is irradiated using a 365 nm LED lamp, and the detection result is observed by naked eye.

[0036] If green fluorescence is observed, it indicates that the sample to be tested contains homozygous or heterozygous mutations of the ryanodine receptor (RyRs) Y4667D or I4758M resistance mutation site, and the Chilo suppressalis population has developed a certain level of resistance to diacylhydrazine insecticides. If there is no fluorescence, it indicates that the sample does not contain the resistance mutation (or is a sensitive homozygote).

[0037] The eighth aspect of the present application provides a method for rapidly visualizing the diacylhydrazine insecticide resistance of Chilo suppressalis using the reagent or the detection kit, which comprises the following steps: (1) Y4667D detection reaction system preloading: The reaction system is pre- partitioned in a sealed EP tube, and the RPA reaction system is preloaded at the bottom of the EP tube. The RPA reaction system specifically comprises: 13.4 μL of primer free rehydration buffer, 0.8 μL of positive and negative RPA primers, 2 μL of DNA template, and 1 microsphere. The Cas12a detection reaction solution is divided into the inner cover of the EP tube, and the Cas12a detection reaction solution specifically comprises: 2.5 μL NEBuffer r2.1 Reaction Buffer (10×), 1.1 μL crRNA with a concentration of 20 μM, 1.9 μL Cas12a with a concentration of 2 μM, and 2.5 μL ssDNA fluorescent reporter probe with a concentration of 40 μM. I4758M detection reaction system preloading: the reaction system is pre-disposed in a sealed EP tube, and the RPA reaction system is pre-loaded at the bottom of the EP tube. The RPA reaction system specifically includes: 13.75 μL of primer free rehydration buffer, 0.8 μL of positive and negative RPA primers, 2 μL of DNA template, and 1 microsphere; the Cas12a detection reaction solution is divided into the inner cover of the EP tube, and the Cas12a detection reaction solution includes: 2.5 μL of NEBuffer r2.1 Reaction Buffer (10x), 0.75 μL of crRNA with a concentration of 20 μM, 1.9 μL of Cas12a with a concentration of 2 μM, 2.5 μL of ssDNA fluorescent reporter probe with a concentration of 40 μM; (2) RPA amplification stage: place the sealed EP tube in a 37℃ constant temperature environment for incubation for 5~10 min to complete the rapid isothermal amplification of the target fragment; (3) Reaction liquid mixing: manually shake the EP tube to uniformly mix the Cas12a detection reaction liquid in the inner cover and the newly generated RPA amplification product at the bottom of the tube; (4) Cas12a detection reaction: continue to maintain the sealed state of the EP tube, and continue to incubate at 37℃ for 30 min to perform specific detection reaction mediated by CRISPR / Cas12a; (5) Fluorescence visualization analysis: after the reaction is completed, use a 365 nm LED lamp to irradiate the reaction tube, and directly observe whether the mixed liquid in the tube produces a visible fluorescence signal by naked eye; If a fluorescence signal is observed in step (5), it indicates that the sample of the diamondback moth contains homozygous or heterozygous mutations of the fishnet receptor Y4667D / I4758M resistance mutation site.

[0038] As a preferred embodiment, the optimal dilution of the DNA crude extract in step (1) is x50 (i.e. 1:50 dilution). The DNA crude extraction reagent includes: TIANcombi DNA Lyse&Det PCR Kit (Tiangen, Beijing, China).

[0039] The present application has at least one of the following beneficial effects: The application develops a Chilo suppressalis bialaphos-resistant rapid visual detection kit based on RPA-CRISPR / Cas12a technology and an application method thereof. The core of the method lies in designing an RPA primer pair and a crRNA which are specifically targeted at a key resistance mutation site (Y4667D / I4758M) of Chilo suppressalis ryanodine receptor (RyRs). By coupling the recombinase polymerase amplification (RPA) and the CRISPR-Cas12a system, a double screening mechanism is formed, which can accurately distinguish between wild type (sensitive type) and mutant genotype (resistant type), and effectively overcome the false positive problem caused by primer mismatch or non-specific amplification in traditional PCR methods.

[0040] The advantages of the technology are embodied in particular as follows: (1) High sensitivity and specificity: RPA reaction efficiently amplifies target DNA to a detectable level, and the CRISPR-Cas12a system has high recognition accuracy for the target sequence, which can detect as low as a single copy of the mutant gene. The double screening mechanism ensures the accuracy and reliability of the detection results.

[0041] (2) Innovative closed-tube "one-pot" design is adopted: the RPA reaction system is pre-positioned at the bottom of the tube, and the CRISPR / Cas12a reaction system is stored in the tube cap. After incubation at 37°C for 5 or 10 min, the reaction system can be mixed by manual shaking, and the whole process does not need to open the cap and use complex equipment, which maximizes the risk of cross contamination between samples. Using fast crude DNA samples, DNA purification is not required, and the detection results still have high specificity and effectiveness.

[0042] (3) Fast and convenient: the entire detection process (including genomic DNA extraction for about 10 min, RPA constant temperature amplification for 5 or 10 min, and CRISPR / Cas12a detection for about 30 min) can be completed within 40-50 min, which is significantly faster than the qPCR or sequencing method which usually takes 2-3 hours. This high efficiency is particularly suitable for field site, and provides a basis for real-time adjustment of precise pesticide application strategy.

[0043] (4) Fluorescence results are visualized, and the interpretation is simple: the detection results can be directly interpreted by irradiation with a 365 nm LED ultraviolet lamp. Positive samples (with Y4667D or I4758M resistance mutations, homozygous or heterozygous) present bright green fluorescence visible to the naked eye, while negative samples (sensitive type) have no fluorescence response. This intuitive visual interpretation method greatly reduces the dependence on professional equipment and technical personnel, and the operation threshold is low. BRIEF DESCRIPTION OF DRAWINGS

[0044] Figure 1The RPA primer and crRNA position diagram in Example 2 are shown, wherein A is the Y4667D related design diagram, and B is the I4758M related design diagram.

[0045] Figure 2 The RPA primer screening and reaction time optimization results in Example 3 are shown, wherein A is the RPA primer screening of Y4667D, B is the RPA reaction time optimization of Y4667D; C is the RPA primer screening of I4758M, and D is the RPA reaction time optimization of I4758M.

[0046] Figure 3 The screening results of crRNA and RPA reaction primers in Example 3 are shown, wherein A is the crRNA screening of Y4667D, and B is the crRNA screening of I4758M.

[0047] Figure 4 The RPA-CRISIPR-Cas12a reaction system optimization results in Example 3 are shown, wherein A-C are the reaction system optimization of Y4667D; D-F are the reaction system optimization of I4758M; the upper part of each figure is the negative template reaction, and the lower part is the positive template reaction.

[0048] Figure 5 The one-pot RPA-CRISIPR-Cas12a detection process diagram in Example 4 is shown.

[0049] Figure 6 The one-pot RPA-CRISPR / Cas12a fluorescence detection results of Y4667D and I4758M mutations of Diopsis in Example 5 are shown, wherein A and C are the fluorescence detection results of Y4667D, and B and D are the fluorescence detection results of I4758M.

[0050] Figure 7 The crude DNA extraction solution dilution detection results in Example 6 are shown, wherein A and B are the fluorescence detection results of Y4667D, and C and D are the fluorescence detection results of I4758M. DETAILED DESCRIPTION

[0051] The technical solutions in the embodiments of the present application will be described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0052] The rice stem borer larvae used in the following embodiments of the present invention were collected from rice paddies in Nanchang City, Jiangxi Province. The collected larvae were reared in the laboratory with rice stalks at a temperature of 27 ± 1 °C, a light:dark cycle of 16 h:8 h, and a relative humidity of 75 ± 5%.

[0053] The kits used in the following embodiments of the present invention are as follows: the genomic DNA extraction kit DNAiso Reagent was purchased from Takara (Dalian, China); 2× Phanta Max Master Mix (Dye Plus) was purchased from Vazyme Biotech Co. Ltd (Najing, China); the TwistAmp Basic kit was purchased from TwistDx; the DNA Oligos annealing buffer was purchased from Beyotime Biotechnology Co., Ltd (Beijing, China); and the HiScribe™ T7 Quick High Yield RNA Synthesis Kit was purchased from New England Biolabs (USA).

[0054] Example 1: PCR amplification and sequencing analysis of the Y4667D and I4758M mutation sites in the RyR gene of the rice stem borer. (1) Genomic DNA extraction: Genomic DNA was extracted from the larvae of the single-headed rice stem borer using DNAiso Reagent (Takara, Dalian, China) in accordance with the manufacturer's instructions; (2) PCR primer design: Design specific primer pairs (primer sequences are shown in Table 1 below) to amplify genomic DNA fragments covering the Y4667D (Tyr-4667-Asp) and I4758M (Ile-4758-Met) mutation sites in the RyR gene of rice stem borer; (3) Construction of PCR amplification reaction system: PrimeSTAR was used. ® PCR amplification was performed using Max DNA polymerase (Takara). Each reaction system had a total volume of 25 μL and contained the following components: PrimeSTAR Max Premix (2×), 12.5 μL; forward and reverse primers (10 μM), 1.0 μL; ddH2O, 9.5 μL; and genomic DNA template, 1.0 μL. The following program was run on a thermal cycler: initial denaturation at 95°C for 30 s; 34 cycles: denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, final extension at 72°C for 5 min, and hold at 4°C. (4) PCR product analysis and purification sequencing: PCR amplification products were analyzed by 1.5% agarose gel electrophoresis. The target band was purified and bidirectional sequencing analysis was performed by Genscript Company (Nanjing, China).

[0055] Table 1. Primer pairs for DNA amplification containing Y4667D and I4758M target sites Example 2, Design of RPA amplification primer pairs and crRNA sequences As shown in Figure 1 , this embodiment uses Primer Premier 5 software to design RPA amplification primer pairs and crRNA guide sequences for specific fragments in Y4667D, I4758M resistance mutation sites in Chilo suppressalis Ryanodine Receptor (RyRs). The RPA amplification primer pair sequences and crRNA sequences are shown in Tables 2 and 3.

[0056] Table 2, Specific RPA amplification primer pairs designed for Y4667D, I4758M mutation sites Note: To facilitate the effective cleavage of Cas12a, the amplification region needs to cover the target mutation site and contain its adjacent PAM site. However, in this embodiment, there is no natural PAM site near the four tcrRNA target regions. Therefore, we artificially constructed the required PAM site by introducing a mismatched base (5'-TTTV-3') at the 3' end of the forward primer near the mutation site (the underlined bases in Table 2 are the modified bases).

[0057] Table 3, crRNA sequences designed for Y4667D, I4758M mutation sites Note: To improve the specificity of crRNA detection of Y4667D and I4758M mutations, the tcrRNA designed for each mutation site (e.g. YD-tCR1-2, IM-tCR2) adopts a double strategy: first, an adjacent PAM site is artificially constructed near each mutation site; second, an additional mismatched base is introduced near the mutation base of the target sequence of the crRNA to be recognized. Take the YD-tCR1 sequence "CAACCUGACGGACGUCGCGUU" as an example, where the italicized and bold "Y4667D" is the mutation base to be detected, and the double underlined base is the introduced mismatched base (see Table 3 for specific position). G

[0058] ​According to the selected target sequence design and crRNA synthesis principle, four DNA oligonucleotides corresponding to the designed crRNA sequences and a single oligonucleotide containing only the T7 promoter sequence (T7-top) were synthesized by the company Genscript (Nanjing, China) (as shown in Table 4 below). These DNA oligonucleotides were designed to integrate a T7 promoter binding sequence, a guide sequence, and a conserved stem-loop structure at their 5' end for the synthesis of the designed crRNA.

[0059] Subsequently, the synthesized oligonucleotides were annealed with T7-top using the annealing buffer for DNA oligonucleotides (Beyotime) to obtain partially double-stranded DNA templates. In vitro synthesis of tcrRNA was performed using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB) according to the manufacturer's instructions. The obtained tcrRNA was purified using the Monarch RNA Clean up Kit (NEB). The concentration of purified crRNA was determined by NanoDrop spectrophotometer (ThermoFisher Scientific, Shanghai, China) and stored at -80°C for future use. Cas12a protein [EnGen® Lba Cas12a (Cpf1), Cat No. M0653] was purchased from New England Biolabs (NEB).

[0060] Table 4. T7 promoter sequences designed for crRNA sequences Example 3, Establishment of a method for visual detection of Y4667D and I4758M mutation sites based on RPA and CRISPR / Cas12a This example provides a method for visual detection of Y4667D and I4758M mutation sites based on RPA and CRISPR / Cas12a, which includes a recombinase polymerase amplification (RPA) reaction and a CRISPR / Cas12a reaction system. The steps are as follows: (1) Establishment of the recombinase polymerase amplification (RPA) reaction system: TwistAmp Basic kit (TwistDx, Cambridge, UK) was used to perform the reaction in a 37°C constant temperature water bath. Each 50 μL reaction system included 29.5 μL of rehydration buffer, 2.4 μL of forward primer (10 μM), 2.4 μL of reverse primer (10 μM), 1 μL of DNA template, 1 microsphere, and 12.2 μL of ddH2O; the reaction mixture was vortexed gently and centrifuged briefly, then 2.5 μL of MgOAc (280 mM) was added to thoroughly mix to start the reaction; (2) Establishment of the CRISPR / Cas12a reaction system: CRISPR / Cas12a-mediated fluorescence detection was performed using EnGen®LbaCas12a (NEB). 3 μL of ddH2O, 1 μL of NEBuffer r2.1 Reaction Buffer (10×), 1 μL of crRNA (10 μM), 2 μL of Cas12a (1 μM), 1 μL of ssDNA reporter molecule (20 μM), 2 μL of RPA product, and a final reaction volume of 10 μL. After incubation of the reaction mixture at 37°C for 30 min, the fluorescence signal generated was observed by the naked eye under a 365 nm LED lamp, and an image was captured using a smart device (mobile phone).

[0061] On the basis of the above-mentioned RPA reaction and CRISPR / Cas12a detection system, in order to obtain the best visualization effect, the present embodiment screened and optimized the RPA reaction time, the combination of crRNA, ssDNA fluorescent reporter molecule and RPA primer, the Cas12a / crRNA ratio, Cas12a, and the concentration of single-stranded DNA-FQ fluorescent probe, and other key parameters. The specific optimization results are shown in Figures 2-4 , and are described in detail as follows: (1) Optimization of RPA reaction time: Under the condition that the concentrations of the forward and reverse primers were 10 μM, the amplification time at 37°C was screened for 5, 10, 15, and 20 min to determine the optimal RPA reaction duration; The experimental results are shown in Figure 2 , and are described in detail as follows: The band brightness of the RPA product was relatively stable among the tested reaction time points. Among them, M: Trans 2K DNA marker; CK: negative control using ddH2O as the template; S: genomic DNA template from a homozygous sensitive individual (Y4667D or I4758M); R: genomic DNA template from a homozygous resistant individual (Y4667D or I4758M); Figure 2It can be seen that the optimal reaction time of the RPA primer pair for detecting Y4667D is 10 min; the optimal reaction time of the RPA primer pair for detecting I4758M is 5 min; (2) Screening of crRNA and RPA reaction primer combination: under the conditions that the parameters such as 37°C, 30 min, 200 nM Cas12a, 100 nM crRNA, 2 μM fluorescent reporter ssDNA, 2 μL RPA amplification product remain unchanged, the optimal fluorescent detection results of SS DNA1 and RPA / tcrRNA two combinations (RPA1 and tcrRNA1 and RPA2 and tcrRNA2) for each mutation are screened to determine the most efficient and specific detection system; wherein RPA1 refers to the combination of YD-RPA-F1 (SEQ ID NO: 1) and YD-RPA-R (SEQ ID NO: 3), or the combination of IM-RPA-F1 (SEQ ID NO: 4) and IM-RPA-R (SEQ ID NO: 6); RPA2 refers to the combination of YD-RPA-F2 (SEQ ID NO: 2) and YD-RPA-R (SEQ ID NO: 3), or the combination of IM-RPA-F2 (SEQ ID NO: 5) and IM-RPA-R (SEQ ID NO: 6); tcrRNA1 refers to YD-tCR1 (SEQ ID NO: 7) or IM-tCR1 (SEQ ID NO: 9); tcrRNA2 refers to YD-tCR2 (SEQ ID NO: 8) or IM-tCR2 (SEQ ID NO: 10).

[0062] The sequence of SS DNA1 is as follows: SS DNA1: 5'-F-TTTTT-Q-3' Wherein, F is a fluorescent group, and Q is a fluorescent quenching group.

[0063] The experimental results are as follows: Figure 3As shown, the combination of YD-RPA1 and YD-tCR1 for detecting Y4667D and the combination of IM-RPA2 and IM-tCR2 for detecting I4758M showed high specificity. Green fluorescence signal was observed in reactions containing mutant DNA templates, while no signal was detected in reactions of sensitive DNA or blank controls. Among them, A is for detecting Y4667D mutant target site. B is for detecting I4758M mutant target site. CK1: using ddH2O as template; CK2: using ddH2O as template in RPA reaction, and then CRISPR / Cas12a detection; S: genomic DNA template from homozygous sensitive individuals (Y4667D or I4758M); R: genomic DNA template from homozygous resistant individuals (Y4667D or I4758M); As shown in A and D of FIG. 6, for the detection system of Y4667D and I4758M two sites, the fluorescence intensity gradually increased with the increase of the ratio of Cas12a to crRNA. Among them, Figure 3 As shown in A and D of FIG. 6, for the detection system of Y4667D and I4758M two sites, the fluorescence intensity gradually increased with the increase of the ratio of Cas12a to crRNA. Among them,

[0064] (3) Optimization of Cas12a enzyme and crRNA ratio: Under the condition of fixing Cas12a as 100 nM, the ratio of Cas12a to crRNA was adjusted to 1:1, 1:2, 1:4, 1:6 and 1:8 for a total of 5 gradients to determine the best ratio; The experimental results are shown in FIG. 6A and FIG. 6D, for the detection system of Y4667D and I4758M two sites, the fluorescence intensity gradually increased with the increase of the ratio of Cas12a to crRNA. Among them, Figure 4 A is the optimized ratio for detecting Y4667D mutant site; Figure 4 D is the optimized ratio for detecting I4758M mutant site; Figure 4 As shown in A and D of FIG. 6, for the detection system of Y4667D and I4758M two sites, the fluorescence intensity gradually increased with the increase of the ratio of Cas12a to crRNA. Among them, As shown in A and D of FIG. 6, for the detection system of Y4667D and I4758M two sites, the fluorescence intensity gradually increased with the increase of the ratio of Cas12a to crRNA. Among them, Figure 4 As shown in A and D of FIG. 6, for the detection system of Y4667D and I4758M two sites, the fluorescence intensity gradually increased with the increase of the ratio of Cas12a to crRNA. Among them,

[0065] (4) Optimization of Cas12a enzyme concentration: Under the optimal Cas12a enzyme and crRNA ratio of the two systems Y4667D and I4758M screened above, the Cas12a enzyme concentration was adjusted to 50, 100, 150, 200 and 250 nM to determine the optimal reaction concentration; The experimental results are shown in B and E of Figure 4 , and for the fluorescence intensity of the two mutant targets Y4667D and I4758M, it can be seen from the figure that the fluorescence reaction becomes stronger and stronger with the increase of the concentration of Cas12a protein. Considering the cost, the Cas12a protein concentration of 150 nM is selected for Y4667D and I4758M. Among them, Figure 4 B is the optimal Cas12a enzyme concentration for detecting Y4667D mutant site; Figure 4 E is the optimal Cas12a enzyme concentration for detecting I4758M mutant site; It can be seen from B and E of Figure 4 that preferably the optimal concentration of Cas12a enzyme is 150 nM.

[0066] (5) Optimization of the concentration of fluorescent reporter probe SSDL: Under the optimal Cas12a enzyme and crRNA ratio and the optimal concentration of Cas12a enzyme of the two systems Y4667D and I4758M screened above, the SSDL concentration was adjusted to 1, 2, 4, 6 and 8 μM to determine the optimal reaction concentration; The experimental results are shown in C and F of Figure 4 , and the fluorescence intensity increases with the increase of the probe concentration. For the two mutant targets, 4 μM is selected considering the cost. Among them, Figure 4 C is the optimal SSDL concentration for detecting Y4667D mutant site; Figure 5 F is the optimal SSDL concentration for detecting I4758M mutant site; It can be seen from C and F of Figure 6 that preferably the optimal concentration of SSDL is 4 nM.

[0067] Example 4, One-pot method for constructing RPA-CRISPR / Cas12a detection system for Chilo suppressalis Y4667D / I4758M resistance mutant site The traditional RPA-CRISPR / Cas12a workflow needs to be performed independently for amplification and detection steps, which has high operation complexity and cross contamination risk. In order to simplify the process and reduce the risk of contamination, a one-pot RPA-CRISPR detection system for detecting Chilo suppressalis Y4667D / I4758M resistance mutant site is developed in this embodiment.

[0068] The detection process is shown in Figure 6The specific steps are as follows: (1) Reaction system assembly (pre-dispensing): (1) Y4667D detection reaction system pre-dispensing: the reaction system is pre-disposed in a sealed EP tube. The RPA reaction system is pre-dispensed at the bottom of the EP tube. The specific information is 13.4 μL of primer free rehydration buffer, 0.8 μL of positive and negative RPA primers, 2 μL of DNA template, and 1 microsphere; the Cas12a detection reaction liquid is dispensed in the EP tube cover. The specific information is 2.5 μL of NEBuffer r2.1 Reaction Buffer (10x), 1.1 μL of crRNA (20 μM), 1.9 μL of Cas12a (2 μM), and 2.5 μL of ssDNA reporter molecule (40 μM).

[0069] I4758M detection reaction system pre-dispensing: the reaction system is pre-disposed in a sealed EP tube. The RPA reaction system is pre-dispensed at the bottom of the EP tube. The specific information is 13.75 μL of primer free rehydration buffer, 0.8 μL of positive and negative RPA primers, 2 μL of DNA template, and 1 microsphere; the Cas12a detection reaction liquid is dispensed in the EP tube cover. The specific information is 2.5 μL of NEBuffer r2.1 Reaction Buffer (10x), 0.75 μL of crRNA (20 μM), 1.9 μL of Cas12a (2 μM), and 2.5 μL of ssDNA reporter molecule (40 μM).

[0070] All reaction systems use the optimal proportion and concentration determined in Examples 1-3; (2) DNA extraction: field collection of Chilo suppressalis larvae, using: TIANcombi DNA Lyse&Det PCR Kit (Tiangen, Beijing, China). Extract crude DNA liquid, boil in water bath for 10 min, transfer the supernatant to a 1.5 mL centrifuge tube; (3) RPA reaction initiation: add 2 μL of DNA crude extract to the RPA reaction reagent at the bottom of the PCR tube. Place the reaction tube in a 37°C incubator for 5 or 10 min of RPA amplification; (4) Mixed reaction system: after RPA amplification, manually shake the reaction tube to fully mix the Cas12a reaction mixture pre-coated on the tube cover with the RPA reaction liquid completed at the bottom of the tube (this process does not need to open the tube cover). Continue to incubate at 37°C for 30 min for CRISPR / Cas12a reaction; (5) Fluorescence visualization results: using 365 nm LED light irradiation, the RPA / Cas12a reaction product of step (4) was observed, and bright green fluorescence signal was observed by naked eye. This indicates that the collected diamondback moth larvae have Y4667D or I4758M resistance mutations.

[0071] Example 5, one-pot method-based field diamondback moth sample Y4667D / I4758M resistance mutation site RPA-CRISPR detection To evaluate the applicability of the one-pot method RPA-CRISPR / Cas12a detection system described in Example 4 in field applications, 15 field-collected diamondback moth samples and 3 laboratory sensitive strain samples were tested.

[0072] The experimental results are shown in Table 2. Figure 6 As shown in Table 2, the genotypes of all samples at Y4667D ( Figure 6 C) and I4758M ( Figure 6 D) mutation sites were independently verified by DNA sequencing. Sequencing confirmed that the 3 laboratory sensitive samples were homozygous sensitive at both sites: Y4667 site was TAC, and I4758 site was ATA. Among the 15 field samples, the genotyping results of the Y4667D site showed that 5 were homozygous sensitive (TAC), and 10 were mutant genotypes (including 5 homozygous resistant GAC and 5 heterozygotes, the latter showed double peaks at the mutation site). For the I4758M mutation, sequencing of the field samples identified 8 homozygous sensitive (ATA) and 7 mutant genotypes (including 4 homozygous resistant ATG and 3 heterozygotes). At the same time, all samples were tested under 365 nm LED ultraviolet light, and the fluorescence signal was observed by naked eye. Among them, Figure 6 C samples 4-6, 8-10, 12, 15, 17-18; Figure 7 D samples 4-5, 11-12, 16-18 all showed significant green fluorescence signal, and all mutant genotypes were accurately identified (Y4667D mutation: 10; I4758M mutation: 7). At the same time, no false positive fluorescence signal was observed in all sensitive samples and no template control (NTC) Figure 7 A, B). The fluorescence detection results were completely consistent with the DNA sequencing results, fully verifying the accuracy, specificity and reliability of the one-pot system for rapid genotyping of Y4667D and I4758M mutations in field samples.

[0073] Example 6, DNA crude extract detection optimization and evaluation To simplify sample preparation and facilitate field application, the performance of integrated one-pot RPA-CRISPR / Cas12a detection of Y4667D / I4758M resistance mutation sites using Chilo suppressalis larvae crude DNA solution was optimized and evaluated in this embodiment. After serial dilution (×1, ×10, ×20, ×50) of crude DNA solution with ddH2O, the optimal crude DNA dilution concentration was determined, and the optimal crude DNA solution was used to detect two laboratory susceptible lines and seven field samples.

[0074] The experimental results are shown in Figure 7 ×50 dilution produces the strongest and clearest green fluorescence for Y4667D ( Figure 7 A) and I4758M ( Figure 7 C) mutations.

[0075] Preferably, the optimal dilution of crude DNA solution is ×50.

[0076] Using this ×50 crude DNA solution, Y4667D ( Figure 7 B, 1-6) and I4758M ( Figure 7 D, 1-7) were not detected in two laboratory susceptible lines and seven field samples, which were consistent with their sensitive genotypes; 3 Y4667D positives ( ​ B, 7-9) and 2 I4758M positives ( ​ D, 8-9) were detected, and all results were completely consistent with sequencing. The entire crude DNA one-pot process can be completed within 40-50 min, highlighting its high efficiency and potential for practical application in rapid and accurate diagnosis of Chilo suppressalis resistance in the field.

[0077] The above is only a preferred specific embodiment of the present application, but the protection scope of the present application is not limited thereto, and any skilled person in the art can make equivalent substitutions or changes within the technical scope disclosed by the present application according to the technical solutions and inventive concepts of the present application, which should be covered within the protection scope of the present application.

Claims

1. A RPA primer pair for detecting Chilo suppressalis bithionol resistance, characterized by, The RPA primer pair comprises an RPA primer pair for detecting Y4667D and / or I4758M resistance mutation sites in the Chilo suppressalis ryanodine receptor gene, wherein, the sequence of the forward primer of the RPA primer pair for detecting the Y4667D resistance mutation site is shown in SEQ ID NO: 1 or 2, and the sequence of the reverse primer is shown in SEQ ID NO: 3; the sequence of the forward primer of the RPA primer pair for detecting the I4758M resistance mutation site is shown in SEQ ID NO: 4 or 5, and the sequence of the reverse primer is shown in SEQ ID NO:

6.

2. A crRNA for detecting Chilo suppressalis bithionine insecticide resistance, characterized by, The crRNA comprises a crRNA for detecting Y4667D and / or I4758M resistance mutation sites in the Chilo suppressalis ryanodine receptor gene, wherein, the sequence of the crRNA for detecting the Y4667D resistance mutation site is shown in SEQ ID NO: 7 or 8; the sequence of the crRNA for detecting the I4758M resistance mutation site is shown in SEQ ID NO: 9 or 10.

3. A sequence composition for detecting resistance to chikwid, characterized in that, The sequence composition comprises the RPA primer pair of claim 1 and the crRNA of claim 2.

4. A rapid visual detection reagent for Chilo suppressalis Bialaphos-resistant, characterized by, The reagent comprises: sample genomic DNA rapid extraction reaction reagent, recombinase polymerase amplification reaction reagent, CRISPR / Cas12a reaction reagent; The recombinase polymerase amplification reaction reagent comprises a pair of RPA primer pairs of claim 1; The CRISPR / Cas12a reaction reagent comprises the crRNA of claim 2 and a ssDNA fluorescent reporter probe.

5. The reagent of claim 4, wherein, The sample genomic DNA rapid extraction reaction reagent comprises PCR amplification primers for amplifying Y4667D and / or I4758M resistance mutation sites in the Chilo suppressalis ryanodine receptor gene; The sequence of the PCR amplification primer for amplifying the Y4667D resistance mutation site is shown in SEQ ID NO: 11-12, and the sequence of the PCR amplification primer for amplifying the I4758M resistance mutation site is shown in SEQ ID NO: 13-14.

6. The agent of claim 4, wherein The sequence of the ssDNA fluorescent reporter probe is 5'-F-TTTTT-Q-3'; Wherein, F is a fluorescent group, and Q is a fluorescent quenching group.

7. A rapid visual detection kit for Chilo suppressalis Bialaphos-resistant, characterized in that, The detection kit comprises the reagent of any one of claims 4-6.

8. Use of the RPA primer pair of claim 1 or the crRNA of claim 2 or the sequence composition of claim 3 or the reagent of any one of claims 4 to 6 or the detection kit of claim 7, characterized in that, The application comprises any one of the following: 1) In the application of detecting the resistance of Chilo suppressalis to diacyl amide insecticides; 2) In the application of genotyping Y4667D and / or I4758M resistance mutation sites in the Chilo suppressalis ryanodine receptor gene.

9. A method for rapid visual detection of resistance to bensultap in Chilo spp. using the reagent of any one of claims 4 to 6 or the test kit of claim 7, characterized in that, The method comprises the following steps: (1) Extracting Chilo suppressalis sample genomic DNA; (2) Adding recombinase polymerase amplification reaction reagent to the bottom of the reaction tube, adding sample genomic DNA obtained in step (1), combining with the RPA primer pair, and performing RPA isothermal amplification reaction to obtain RPA amplification product; (3) taking the RPA product obtained in step (2) as a template, adding CRISPR / Cas12a reaction reagents, and performing CRISPR / Cas12a reaction; (4) after the reaction is completed, the reaction product of step (3) is irradiated with a 365 nm LED lamp, and whether a fluorescent signal is observed under the blue light lamp is observed by naked eye; If a fluorescent signal is observed in step (4), it indicates that the sample to be tested contains a homozygous or heterozygous mutation of the ryanodine receptor Y4667D / I4758M resistance mutation site.

10. A method for rapid visual detection of Chilo suppressalis Kuroko resistance to bisamide insecticides by closed-tube one-pot method using the reagent according to any one of claims 4 to 6 or the test kit according to claim 7, characterized in that, The method comprises the following steps: (1) Y4667D detection reaction system preloading: the reaction system is pre- partitioned in a sealed EP tube, the RPA reaction system is preloaded at the bottom of the EP tube, and the RPA reaction system specifically comprises: 13.4 μL of primer free rehydration buffer, 0.8 μL of positive and negative RPA primers, 2 μL of DNA template, and 1 microsphere; the Cas12a detection reaction liquid is divided into the inner cover of the EP tube, and the Cas12a detection reaction liquid specifically comprises: 2.5 μL of NEBuffer r2.1 Reaction Buffer, 1.1 μL of crRNA with a concentration of 20 μM, 1.9 μL of Cas12a with a concentration of 2 μM, and 2.5 μL of ssDNA fluorescent reporter probe with a concentration of 40 μM; I4758M detection reaction system preloading: the reaction system is pre- partitioned in a sealed EP tube, the RPA reaction system is preloaded at the bottom of the EP tube, and the RPA reaction system specifically comprises: 13.75 μL of primer free rehydration buffer, 0.8 μL of positive and negative RPA primers, 2 μL of DNA template, and 1 microsphere; the Cas12a detection reaction liquid is divided into the inner cover of the EP tube, and the Cas12a detection reaction liquid specifically comprises: 2.5 μL of NEBuffer r2.1 Reaction Buffer, 0.75 μL of crRNA with a concentration of 20 μM, 1.9 μL of Cas12a with a concentration of 2 μM, and 2.5 μL of ssDNA fluorescent reporter probe with a concentration of 40 μM; (2) RPA amplification stage: the sealed EP tube is placed in a constant temperature environment at 37℃ and incubated for 5-10 min to complete the rapid isothermal amplification of the target fragment; (3) reaction liquid mixing: the EP tube is manually shaken to mix the Cas12a detection reaction liquid in the inner cover and the newly generated RPA amplification product at the bottom of the tube; (4) Cas12a detection reaction: the EP tube is continuously incubated at 37℃ for 30 min to perform CRISPR / Cas12a mediated specific detection reaction; (5) fluorescent visualization analysis: after the reaction is completed, the reaction tube is irradiated with a 365 nm LED lamp, and whether a visible fluorescent signal is generated in the mixed liquid in the tube is directly observed by naked eye; If the fluorescence signal is observed in step (5), it indicates that the homozygous or heterozygous mutation of the ryanodine receptor Y4667D / I4758M resistance mutation site exists in the Chilo suppressalis sample to be tested.

Images