Compounds and methods for reducing APP expression

Abstract

The present disclosure provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of APP RNA and, in some cases, the amount of APP protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or sign of a neurodegenerative disease or disorder associated with APP. Such symptoms and markers include cognitive impairment (including memory and language skill decline), behavioral and psychological symptoms (such as emotional desert and lack of motivation), gait disorders, seizures, progressive dementia, and abnormal amyloid deposition.

Description

[0001] sequence list

[0002] This application is submitted together with the electronic sequence listing. The sequence listing is provided as a file named BIOL0460SEQ.xml, created on January 31, 2024, and is 384KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0003] This disclosure provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of amyloid precursor protein (APP) RNA in cells or animals and, in some cases, reducing the amount of APP protein in cells or subjects. Certain of these compounds, methods, and pharmaceutical compositions can be used to improve at least one symptom or marker of APP-related neurodegenerative diseases or conditions. Such symptoms and markers include cognitive impairment (including memory and / or language skill decline), behavioral and psychological symptoms (such as emotional blunting and lack of motivation), gait disturbances, seizures, progressive dementia, and abnormal amyloid protein deposition. Such APP-related neurodegenerative diseases and conditions include sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, and sporadic and familial cerebral amyloid angiopathy. Background Technology

[0004] Alzheimer's disease (AD), including sporadic Alzheimer's disease and hereditary / familial Alzheimer's disease, is the most common cause of age-related dementia, affecting an estimated 5.7 million Americans each year (Alzheimer's Association. 2018 Alzheimer's Disease Facts and Figures. Alzheimer's Dement. 2018; 14(3):367-429). AD is characterized by the accumulation of β-amyloid plaques in the brain before the appearance of obvious clinical symptoms. Such obvious clinical symptoms include cognitive impairment, including decline in memory and language skills, behavioral and psychological symptoms (such as emotional blunting and lack of motivation), gait disturbances, seizures, and progressive dementia.

[0005] Patients with Down syndrome (DS) may experience early-onset Alzheimer's disease (DS with AD (AD inDS)), in which most DS patients observe amyloid plaque formation by age 40, and more than 50% of Down syndrome patients observe Alzheimer's dementia by age 50.

[0006] Cerebral amyloid angiopathy (CAA) is a disease characterized by the deposition of β-amyloid protein in the blood vessels of the CNS. CAA is frequently observed in AD patients during autopsies, but it is also associated with aging even without clinical symptoms of AD.

[0007] Alzheimer's disease (AD), distemper with AD (DS), and coronary artery disease (CAA) are all characterized by the abnormal accumulation of β-amyloid plaques. β-amyloid protein (Aβ) originates from the amyloid precursor protein (APP) processed by α-secretase, β-secretase, and γ-secretase. In addition to the 42-amino acid fragment Aβ, several other fragments of APP are formed, some of which are thought to contribute to the onset of AD-related dementia (reviewed in Nhan et al., "The multifaceted nature of amyloid precursor protein and its proteolytic fragments: friends and foes", Acta Neuropath., 2015, 129(1):1-19). The increased incidence of AD in DS patients is thought to be directly related to an increased copy number of the APP gene located on chromosome 21.

[0008] Currently, there is a lack of acceptable options for treating neurodegenerative diseases and conditions, such as Alzheimer's disease (AD), diabetic dysplasia with AD, and coronary artery disease (CAA). Therefore, the purpose of this article is to provide compounds, methods, and pharmaceutical compositions for treating such diseases and conditions. Summary of the Invention

[0009] This document provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of APP RNA and, in some embodiments, reducing the amount of APP protein in cells or subjects. In some embodiments, the subject has or is at risk of developing an APP-related neurodegenerative disease or condition. In some embodiments, the subject has Alzheimer's disease (AD). In some embodiments, the subject has Alzheimer's disease with Down syndrome (DS with AD). In some embodiments, the subject has cerebral amyloid angiopathy (CAA). In some embodiments, the compound that can be used to reduce APP RNA expression is an oligomeric compound. In some embodiments, the compound that can be used to reduce APP RNA expression is a modified oligonucleotide.

[0010] This document also provides methods for improving at least one symptom or marker of an APP-related neurodegenerative disease or condition. In some embodiments, the neurodegenerative disease is Alzheimer's disease. In some embodiments, the neurodegenerative disease or condition is Alzheimer's disease in patients with Down syndrome. In some embodiments, the neurodegenerative disease or condition is cerebral amyloid angiopathy (CAA). In some embodiments, symptoms or markers include cognitive impairment (including memory and language skill decline), behavioral and psychological symptoms (such as emotional blunting and lack of motivation), gait disturbances, seizures, progressive dementia, and / or abnormal amyloid deposition. Detailed Implementation

[0011] It should be understood that the foregoing general description and the following detailed description are exemplary and illustrative only, and not restrictive. In this document, unless otherwise specified, the use of the singular includes the plural. As used herein, unless otherwise specified, the use of “or” means “and / or”. Furthermore, the use of the term “including” and other forms such as “includes” and “included” is not restrictive. Moreover, unless otherwise specified, terms such as “element” or “component” cover both elements and components that comprise a single unit and elements and components that comprise more than one subunit.

[0012] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions thereof cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are hereby expressly incorporated herein by reference in whole or in part in respect of the documents discussed herein.

[0013] definition

[0014] Unless specifically defined herein, the nomenclature, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry as described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, as well as other data, mentioned throughout this disclosure are incorporated herein by reference in their entirety.

[0015] Unless otherwise stated, the following terms have the following meanings:

[0016] As used herein, “2’-deoxynucleoside” means a nucleoside comprising a 2’-H(H)deoxyfuranosyl sugar moiety. In some embodiments, the 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside and comprises a 2’-β-D-deoxyribosyl sugar moiety having the β-D ribosyl conformation found in naturally occurring deoxyribonucleic acid (DNA). In some embodiments, the 2’-deoxynucleoside may comprise modified nucleotides or may comprise RNA nucleotides (uracil).

[0017] As used herein, “2’-MOE” refers to an OCH2CH2OCH3 group that replaces the 2’-OH group of the furanyl sugar moiety. “2’-MOE sugar moiety” or “2’-O-methoxyethyl sugar moiety” refers to a sugar moiety having an OCH2CH2OCH3 group that replaces the 2’-OH group of the furanyl sugar moiety. Unless otherwise stated, the 2’-MOE sugar moiety is β-D-ribosyl. “MOE” means O-methoxyethyl.

[0018] As used in this article, "2'-MOE nucleoside" or "2'-OCH2CH2OCH3 nucleoside" refers to a nucleoside containing a 2'-MOE sugar moiety (or a 2'-OCH2CH2OCH3 ribosyl sugar moiety).

[0019] As used herein, “2'-OMe” refers to a 2'-OCH3 group that replaces the 2'-OH group of the ribosyl sugar moiety. “2'-O-methyl sugar moiety” or “2'-OMe sugar moiety” refers to a sugar moiety having a 2'-OCH3 group that replaces the 2'-OH group of the ribosyl sugar moiety. Unless otherwise stated, 2'-OMe has a β-D ribosyl stereochemistry.

[0020] As used in this article, "2'-OMe nucleoside" refers to a nucleoside containing the 2'-OMe sugar moiety.

[0021] As used herein, “2’-F” refers to a 2’-fluorine group that replaces the 2’-OH group of the furanyl sugar moiety. “2’-F sugar moiety” refers to a sugar moiety having a 2’-F group that replaces the 2’-OH group of the furanyl sugar moiety. Unless otherwise stated, the 2’-F sugar moiety is β-D-ribosyl.

[0022] As used in this article, "2'-F nucleoside" refers to a nucleoside containing a 2'-F modified sugar moiety.

[0023] As used herein, “2’-NMA” refers to the 2’-OCH2C(=O)-N(H)CH3 group at the 2’ position of the furanyl sugar moiety. “2-NMA sugar moiety” refers to the sugar moiety having a 2’-OCH2C(=O)-N(H)CH3 group that replaces the 2’-OH group of the furanyl sugar moiety.

[0024] As used in this article, "2'-NMA nucleoside" refers to a nucleoside containing the 2'-NMA sugar moiety.

[0025] As used herein, “2’-substituted nucleoside” means a nucleoside containing a 2’-substituted furanose glycosyl moiety. As used herein, “2’-substituted” with respect to the glycosyl moiety means a glycosyl moiety containing at least one 2’-substituent group other than H or OH.

[0026] As used in this article, "termination site" refers to the 3' end nucleotide of the target nucleic acid that is complementary to the oligonucleotide when the oligonucleotide hybridizes with the target nucleic acid.

[0027] As used in this article, "start site" refers to the 5' end nucleotide of the target nucleic acid that is complementary to the oligonucleotide when the oligonucleotide hybridizes with the target nucleic acid.

[0028] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleobase.

[0029] As used herein, "debased sugar moiety" refers to the sugar moiety that is not attached to a nucleobase. Such debased sugar moieties are sometimes referred to in the art as "debased nucleosides".

[0030] As used in this article, “administration” means to administer a drug to a subject.

[0031] As used herein, “improvement” in relation to treatment means an improvement in at least one symptom or marker relative to the same symptom or marker in the absence of treatment. In some embodiments, improvement is a reduction in the severity or frequency of symptoms, a delay in the onset of symptoms, or a slowing of their progression. In some embodiments, a symptom or marker is one or more of the following: cognitive impairment (including memory and / or language skill decline), behavioral and psychological symptoms (such as emotional blunting and lack of motivation), gait disturbances, seizures, progressive dementia, or abnormal amyloid deposition.

[0032] As used herein, “antisense activity” means any detectable and / or measurable change attributable to the hybridization of an antisense compound with its target nucleic acid. In some embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or protein encoded by such a target nucleic acid compared to the level of the target nucleic acid or target protein in the absence of an antisense compound.

[0033] As used herein, “antense” means an antisense compound and optionally one or more additional features, such as sense compounds.

[0034] As used herein, “antisense compound” means antisense oligonucleotide and optionally one or more additional features, such as conjugation groups.

[0035] As used herein, "antisense oligonucleotide" means an oligonucleotide capable of hybridizing with a target nucleic acid and possessing at least one antisense activity, including the oligonucleotide moiety of an antisense compound. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0036] As used in this article, "bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.

[0037] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In some embodiments, the first ring of the bicyclic sugar moiety is a furanyl sugar moiety. In some embodiments, the furanyl sugar moiety is a ribosyl sugar moiety. In some embodiments, the bicyclic sugar moiety does not contain a furanyl sugar moiety.

[0038] As used in this article, "bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.

[0039] As used in this article, "cell-targeting portion" means a portion of a conjugate or conjugate that can bind to one or more specific cell types.

[0040] As used herein, “cerebrospinal fluid” or “CSF” refers to the fluid that fills the space surrounding the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” refers to a fluid that has certain properties similar to cerebrospinal fluid (e.g., osmotic pressure, pH, and / or electrolytes) and is biocompatible with CSF.

[0041] As used in this article, “chiral controlled” in relation to nucleotide inter-bonds means that the chirality at that bond is enriched due to a specific stereochemical configuration.

[0042] As used herein, "chiral enriched" in the context of a group means a plurality of molecules having the same molecular formula, wherein if a particular chiral center is stereorandom as defined herein, the number or percentage of molecules within the group containing a particular stereochemical configuration at that particular chiral center is greater than the number or percentage of molecules within the group expected to contain the same particular stereochemical configuration at the same particular chiral center. A group of chiral enriched molecules, each containing multiple chiral centers, may contain one or more stereorandom chiral centers. In some embodiments, the molecule is a modified oligonucleotide. In some embodiments, the molecule is an oligomeric compound comprising a modified oligonucleotide. In some embodiments, the chiral center is located at the phosphorus atom of the thiophosphate nucleoside internucleotide bond. In some embodiments, the chiral center is located at the phosphorus atom of the methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the group of modified oligonucleotides is enriched with modified oligonucleotides having at least one (Sp)-configured thiophosphate and / or methanesulfonyl phosphate. In some embodiments, the modified oligonucleotides are enriched in groups having at least one modified oligonucleotide with a (Rp) configuration of a thiophosphate ester and / or a methanesulfonyl phosphate ester. Unless otherwise stated, the chiral internucleotide bonds of the modified oligonucleotides described herein may be stereorandom or chiral enriched.

[0043] As used herein, “cleavable portion” means a bond or group of atoms that breaks down after being administered to a subject, for example, within a cell, subject, or person.

[0044] As used herein, the term "complementary" for an oligonucleotide means that, when the nucleotide sequence of the oligonucleotide is aligned in opposite directions with the nucleotide sequence of another nucleic acid, at least 70% of the nucleotides of the oligonucleotide are hydrogen-bonded to the nucleotides of the other nucleic acid or one or more regions thereof. The term "complementary region" for a region of an oligonucleotide means that, when the nucleotide sequence of the oligonucleotide is aligned in opposite directions with the nucleotide sequence of another nucleic acid, at least 70% of the nucleotides of that region are hydrogen-bonded to the nucleotides of the other nucleic acid or one or more regions thereof. As used herein, "complementary nucleobase" means nucleobases that are capable of forming hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (G). mC) and guanine (G). Certain modified nucleobases that pair with unmodified (natural) nucleobases or with other modified nucleobases are known in the art. For example, hypoxanthine can pair with adenosine, cytosine, thymine, or uracil, but is not considered complementary to them. In this document, hypoxanthine (I) is considered a complementary nucleobase to thymine (T), adenine (A), uracil (U), and cytosine (C). Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at each nucleoside. Instead, some mismatches are tolerable. As used herein, “perfect complementarity” or “100% complementarity” with respect to an oligonucleotide or portion thereof means that the oligonucleotide or portion thereof is complementary to the other oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or, if the oligonucleotides are of the same length, to the other oligonucleotide or nucleic acid at each nucleoside.

[0045] As used in this article, the “complementary region” of an oligonucleotide is the series of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or a target nucleic acid.

[0046] As used herein, a "conjugation group" means a group of atoms directly attached to an oligonucleotide that imparts at least one property to the resulting conjugated oligonucleotide. A conjugation group comprises a conjugation moiety and a conjugation linker that attaches the conjugation moiety to the oligonucleotide.

[0047] As used herein, “conjugate linker” means a single bond or a group of atoms containing at least one bond that links the conjugate portion to the oligonucleotide.

[0048] As used herein, “conjugated moiety” means a group of atoms that, when covalently bound to a molecule, alters one or more properties of that molecule compared to the same molecule lacking a conjugated moiety. Such properties include, but are not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0049] As used herein, “restricted ethyl” or “cEt” or “cEt sugar moiety” means β-D ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is in the S configuration.

[0050] As used in this article, "cEt nucleoside" refers to a nucleoside that contains the cEt sugar moiety.

[0051] As used herein, “continuous” in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleotide bonds that are adjacent to each other. For example, “continuous nucleobases” means nucleobases that are adjacent to each other in the sequence.

[0052] As used herein, "deoxyregion" refers to a region of 5 to 12 consecutive nucleotides in which at least 70% of the nucleosides contain a β-D-2'-deoxyribosyl sugar moiety. In some embodiments, each nucleoside in the deoxyregion is selected from 2'-β-D-deoxynucleosides, bicyclic nucleosides, and 2'-substituted nucleosides. The deoxyregion supports RNase H activity. In some embodiments, the deoxyregion is a gap or internal region of a spacer.

[0053] As used herein, the term "double-stranded" in relation to a region or oligonucleotide means a double-stranded structure formed by complementary strands of nucleic acids (including, but not limited to, oligonucleotides) that have hybridized with each other. In some embodiments, the two strands of a double-stranded region are separate molecules. In some embodiments, the two strands are regions of the same molecule that have folded onto themselves (e.g., hairpin structures).

[0054] As used in this article, "double strand" or "double strand region" refers to a structure formed by two oligonucleotides or portions thereof that hybridize with each other.

[0055] As used herein, "spacer" means a modified oligonucleotide comprising an inner region located between an outer region having one or more nucleotides, wherein the nucleotides comprising the inner region are chemically different from the one or more nucleotides comprising the outer region, and wherein the modified oligonucleotide supports RNase H cleavage. The inner region may be referred to as a "gap," and the outer region may be referred to as a "wing." In some embodiments, the inner region is a deoxygenated region. The position of the inner region or gap refers to the sequence of the nucleotides in the inner region, and is counted starting from the 5' end of the inner region. Unless otherwise stated, "spacer" refers to a glycosylation motif. In some embodiments, each nucleotide of the gap is a 2'-β-D-deoxynucleotide. In some embodiments, the gap contains a 2'-substituted nucleotide at positions 1, 2, 3, 4, or 5, and the remainder of the nucleotides in the gap is a 2'-β-D-deoxynucleotide. As used herein, the term "MOE spacer" refers to a spacer having a gap containing a 2'-β-D-deoxynucleotide and wings containing a 2'-MOE nucleotide. Unless otherwise stated, spacers may contain one or more modified nucleoside interbonds and / or modified nucleobases, and such modifications do not necessarily follow the sugar-modified spacer pattern.

[0056] As used herein, “hybridization” means the annealing of oligonucleotides and / or nucleic acids. While not limited to a specific mechanism, the most common hybridization mechanisms involve hydrogen bonds between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds. In some embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets.

[0057] As used herein, “nucleoside bond” refers to a covalent bond between adjacent (e.g., consecutive) nucleosides in an oligonucleotide. As used herein, “unmodified nucleoside bond” refers to a phosphodiester nucleoside bond. As used herein, “modified nucleoside bond” refers to any nucleoside bond other than a phosphodiester nucleoside bond. A “thiophosphate nucleoside bond” or “PS nucleoside bond” is a modified nucleoside bond in which one of the non-bridging oxygen atoms in the phosphodiester nucleoside bond is replaced by a sulfur atom. A “methanesulfonylaminophosphate nucleoside bond” is a modified nucleoside bond in which one of the non-bridging oxygen atoms in the phosphodiester nucleoside bond is replaced by NS(=O)₂CH₃.

[0058] As used in this article, "reverse nucleoside" refers to a nucleotide having a 3' to 3' and / or 5' to 5' internucleotide bond.

[0059] As used in this article, “linked nucleosides” are nucleosides linked by a continuous sequence (i.e., nucleosides that are adjacent to each other, with no additional nucleosides between the linked nucleosides).

[0060] As used herein, "linker nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to the conjugate moiety. Linker nucleosides reside within the conjugate linker of the oligomer. Linker nucleosides are not considered part of the oligonucleotide moiety of the oligomer, even if they are contiguous with the oligonucleotide.

[0061] As used in this article, "mismatch" or "non-complementary" means that when a first nucleic acid sequence and a second nucleic acid sequence are compared, the nucleobases of the first nucleic acid sequence are not complementary to the corresponding nucleobases of the second nucleic acid sequence or the target nucleic acid.

[0062] As used in this article, "motif" refers to the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or nucleoside bonds in an oligonucleotide.

[0063] As used herein, “modified nucleoside” means a nucleoside that contains modified nucleobases and / or modified sugar moieties.

[0064] As used in this article, "modified sugar moiety" refers to the sugar moiety of a nucleoside other than the 2'-β-D-deoxyribosyl sugar moiety (the sugar moiety of unmodified DNA) or the β-D-ribosyl sugar moiety (the sugar moiety of unmodified RNA).

[0065] As used herein, “non-bicyclic modified sugar moiety” means sugar moiety containing modified elements, such as substituents, that do not form a bridging bond between two atoms of the sugar to form a second ring.

[0066] As used herein, "nucleobase" means an unmodified or modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0067] As used in this article, "nucleobase sequence" refers to the sequence of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or nucleoside inter-bond modifications.

[0068] As used herein, the “nucleobase sequence” of reference to SEQ ID NO refers only to the nucleobase sequence provided in SEQ ID NO, and therefore, unless otherwise stated, includes compounds in which each nucleobase, each sugar moiety and each nucleoside bond may be independently modified or unmodified, regardless of whether the modifications shown in the referenced SEQ ID NO are present.

[0069] As used herein, "nucleoside" refers to a compound or fragment of a compound that contains a nucleobase and a sugar moiety. The nucleobase and sugar moiety are either independently unmodified or modified.

[0070] As used herein, “oligomer” means an oligomer compound and optionally one or more additional features, such as a second oligomer compound. An oligomer can be a single-chain oligomer compound or an oligomeric duplex formed from two complementary oligomer compounds.

[0071] As used herein, “oligomeric compound” means oligonucleotide and optionally one or more additional features, such as conjugation groups or terminal groups. An oligomeric compound may be paired with a second oligomeric compound complementary to the first oligomeric compound, or may not be paired. A “single-chain oligomeric compound” is an unpaired oligomeric compound.

[0072] The term "oligoduplex" refers to a duplex formed by two oligomers with complementary nucleobase sequences. Each oligomer in an oligoduplex may be referred to as a "duplex oligomer".

[0073] As used herein, "oligonucleotide" means a chain of nucleosides linked by nucleotide bonds, wherein each nucleoside and nucleotide bond may be modified or unmodified. Unless otherwise stated, an oligonucleotide consists of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or nucleotide bond is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not contain any nucleoside or nucleotide modifications. An oligonucleotide may pair with a second oligonucleotide complementary to it, or it may not pair with any other oligonucleotide.

[0074] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for administration to a subject. Certain such diluents enable pharmaceutical compositions to be formulated, for example, into tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solutions, or sterile artificial cerebrospinal fluid.

[0075] As used herein, "pharmaceutically acceptable salt" means a compound that is physiologically and pharmaceutically acceptable. Pharmacologically acceptable salts retain the desired biological activity of the parent compound without conferring undesirable toxicological effects.

[0076] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In some embodiments, the pharmaceutical composition has shown activity in free uptake assays in certain cell lines.

[0077] As used in this article, "group" refers to multiple molecules that have the same molecular formula.

[0078] As used herein, "prodrug" refers to a therapeutic agent that exists in a first form in vitro and is converted into a second form within a subject or their cells. Typically, the conversion of a prodrug within a subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in cells or tissues and / or by physiological conditions. The first form of a prodrug may be less active than the second form.

[0079] As used herein, unless otherwise stated, “RNA” means RNA transcript and includes both precursor mRNA and mature mRNA.

[0080] As used herein, "RNAi agent" means an antisense agent that acts at least partially via RISC or Ago2 to regulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may contain conjugation groups and / or terminal groups. In some embodiments, RNAi agents regulate the amount and / or activity of the target nucleic acid. The term RNAi agent does not include antisense agents that act primarily via RNase H.

[0081] As used herein, "RNase H agent" means an antisense agent that acts via RNase H to regulate target nucleic acids and / or proteins encoded by the target nucleic acids. In some embodiments, the RNase H agent is single-stranded. In some embodiments, the RNase H agent is double-stranded. RNase H compounds may contain conjugation groups and / or terminal groups. In some embodiments, the RNase H agent regulates the amount and / or activity of the target nucleic acid. The term RNase H agent does not include antisense agents that act primarily via RISC / Ago2.

[0082] As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as conjugation groups.

[0083] As used in this article, “sense oligonucleotide” means an oligonucleotide that can hybridize with antisense oligonucleotides, including the oligonucleotide portion of a sense compound.

[0084] As used in this article, "single-stranded" refers to nucleic acids (including but not limited to oligonucleotides) that are not paired and are not part of a double strand. Single-stranded compounds can hybridize with complementary nucleic acids to form double strands, at which point they are no longer single-stranded.

[0085] As used in this article, “in vivo standard determination” means the determination and its reasonable variations described in Examples 2, 3, 4, 5, 6 or 7.

[0086] As used herein, in the context of a group of molecules with the same molecular formula, "stereo-random" or "stereo-random chiral center" means a chiral center that is uncontrolled during synthesis or enriched after synthesis for a particular absolute stereochemical configuration. A stereochemical configuration is random when the stereochemical configuration of the chiral center is the result of a synthetic method that does not aim to control the stereochemical configuration. For example, in a group of molecules containing stereo-random chiral centers, the number of molecules with the (S) configuration having a stereo-random chiral center can be the same as the number of molecules with the (R) configuration having a stereo-random chiral center ("racemic"). A stereochemical configuration is random when the stereochemical configuration of the chiral center is the result of a synthetic method that does not aim to control the stereochemical configuration. In some embodiments, the stereo-random chiral center is located at the phosphorus atom of a stereo-random thiophosphate nucleoside internucleotide bond or a methanesulfonylaminophosphate nucleoside internucleotide bond having a random stereochemical configuration. For example, in a group of molecules containing stereoironic chiral centers, the number of molecules with a stereoironic chiral center (S) configuration may, but is not necessarily, the same as the number of molecules with a stereoironic chiral center (R) configuration. When the stereochemical configuration of the chiral center is the result of a synthetic method designed to control the stereochemical configuration, the stereochemical configuration is considered attributive. In some embodiments, the stereoironic chiral center is a stereoironic thiophosphate nucleoside bond or a methanesulfonyl phosphate nucleoside bond.

[0087] As used herein, "subject" means human or non-human animal. In some embodiments, the subject is a human.

[0088] As used herein, “glycan” means an unmodified or modified sugar moiety. As used herein, “unmodified sugar moiety” means, for example, the 2'-OH(H)β-D-ribosyl glycan moiety found in RNA (“unmodified RNA sugar moiety”) or the 2'-H(H)β-D-ribosyl glycan moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen atom at each of the 1', 3', and 4' positions, one oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanyl glycan moiety or a sugar substitute.

[0089] As used herein, "sugar substitute" means a modified sugar moiety other than the furanyl group that can link a nucleobase to another group, such as an internucleotide bond, conjugation group, or terminal group in an oligonucleotide. Modified nucleosides containing sugar substitutes can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can hybridize with complementary oligomers or target nucleic acids.

[0090] As used herein, “symptom or sign” means any physical characteristic or test result that indicates the presence or extent of a disease or condition. In some embodiments, symptoms are obvious to the subject or to a medical professional examining or testing the subject. In some embodiments, signs are obvious during invasive diagnostic tests (including, but not limited to, post-mortem tests). In some embodiments, signs are the result of diagnostic tests, including, but not limited to, post-mortem tests. In some embodiments, symptoms and signs include cognitive impairment (including memory and / or language skill decline), behavioral and psychological symptoms (such as emotional blunting and lack of motivation), gait disturbances, seizures, progressive dementia, and abnormal amyloid deposition.

[0091] As used herein, “target nucleic acid” and “target RNA” refer to nucleic acids that are designed to be affected by oligomeric compounds. Unless otherwise stated, target RNA refers to RNA transcripts and includes pre-mRNA and mRNA.

[0092] As used in this article, "target region" refers to a portion of the target nucleic acid to which the oligomeric compound is designed to hybridize.

[0093] As used in this article, "terminal group" refers to a chemical group or atomic group covalently attached to the end of an oligonucleotide.

[0094] As used herein, “treatment” means improving a subject’s disease or condition by administering the oligomers or oligomers described herein. In some embodiments, treatment improves a subject’s symptoms relative to the same symptoms without treatment. In some embodiments, treatment reduces the severity or frequency of symptoms, or delays the onset of symptoms, slows the progression of symptoms, or reduces the severity or frequency of symptoms.

[0095] As used herein, "therapeutic effective amount" refers to the amount of a drug or composition that provides a therapeutic benefit to a subject. For example, a therapeutic effective amount improves the symptoms of a disease.

[0096] Some embodiments

[0097] This disclosure provides the following non-limiting numbered embodiments:

[0098] Example 1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases, wherein at least one nucleoside bond of the modified oligonucleotide is a methanesulfonyl phosphate nucleoside bond.

[0099] Example 2. The oligomeric compound according to Example 1, wherein the modified oligonucleotide has a nucleobase sequence comprising any one of SEQ ID NO: 15 to 18.

[0100] Example 3. An oligomeric compound according to any one of Example 1 or Example 2, wherein the modified oligonucleotide consists of 20 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:15 or SEQ ID NO:18.

[0101] Example 4. An oligomeric compound according to any one of Examples 1 to 3, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO:15 or SEQ ID NO:18.

[0102] Example 5. An oligomeric compound according to any one of Examples 1 to 4, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an isolength portion of the APP nucleic acid, wherein the APP nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0103] Example 6. An oligomeric compound according to any one of Examples 1 to 5, wherein the modified oligonucleotide comprises 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 1 Composed of 6 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

[0104] Example 7. An oligomeric compound according to any one of Examples 1 to 6, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0105] Example 8. An oligomeric compound according to any one of Examples 1 to 7, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

[0106] Example 9. The oligomeric compound according to Example 8, wherein the modified nucleoside comprises a modified sugar moiety.

[0107] Example 10. The oligomer compound according to Example 9, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0108] Example 11. The oligomeric compound according to Example 10, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0109] Example 12. An oligomeric compound according to any one of Examples 8 to 9, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

[0110] Example 13. The oligomeric compound according to Example 12, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0111] Example 14. The oligomeric compound according to Example 12 or Example 13, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety.

[0112] Example 15. An oligomeric compound according to any one of Examples 1 to 14, wherein at least two, at least three, at least four, at least five, or at least six nucleoside internucleotide bonds of the modified oligonucleotide are methanesulfonyl phosphate nucleoside internucleotide bonds.

[0113] Example 16. An oligomeric compound according to any one of Examples 1 to 15, wherein at least one nucleoside internucleotide bond of the modified oligonucleotide is a phosphate thioester nucleoside internucleotide bond.

[0114] Example 17. The oligomeric compound according to Example 16, wherein at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or at least 18 nucleoside bonds of the modified oligonucleotide are phosphate thioester nucleoside bonds.

[0115] Example 18. An oligomeric compound according to any one of Examples 1 to 17, wherein at least one nucleoside internucleotide bond of the modified oligonucleotide is a phosphodiester nucleoside internucleotide bond.

[0116] Example 19. An oligomeric compound according to any one of Examples 1 to 18, wherein the modified oligonucleotide has a nucleoside internucleotide motif (5' to 3') selected from the following: soooossssszzszsooss, soooosssssszszsssooss, soooosszsssszsssooss, sooooszssszzsssooss, soooosszzssszssssooss, soooosssszzzszsssooss, soooosssszzzszssooss, soooossszzzzzzsssooss, soooosszsszzzsssooss, sooooszsszzzsssooss, sooooszsszzzsssooss ss、sssossssszzszsosss、ssoosssssszszszssss、ssooszsssszsssss、sssoszssszzssss、ssoossssszzzzssss、sssssssszzzzzsssss、sssoszssszzzsssss、sssoszsszzzsssssss、sssoszsszzzsssssss、sssoszsszzzsssssss、ssssszsszzzssssss、ssssszsszzzssssss、ssssszsszzzssssss、ssssszsszzzssssss、ssssszsszzzssssss、ssssszsszzzsssss、ssssszsszzzsssss、ssssszsszzzsssss、where each “s” represents a thiophosphate nucleoside bond, each “o” represents a phosphodiester nucleoside bond, and each “z” represents a methanesulfonyl phosphate nucleoside bond.

[0117] Example 20. An oligomeric compound according to any one of Examples 1 to 19, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0118] Example 21. The oligomeric compound according to Example 20, wherein the modified nucleobase is 5-methylcytosine.

[0119] Example 22. The oligomeric compound according to Example 21, wherein each cytosine is 5-methylcytosine.

[0120] Example 23. An oligomeric compound according to any one of Examples 1 to 22, wherein one or more nucleosides of the modified oligonucleotide comprise unmodified nucleobases.

[0121] Example 24. An oligomeric compound according to any one of Examples 1 to 23, wherein the modified oligonucleotide comprises a deoxygenated region.

[0122] Example 25. The oligomeric compound according to Example 24, wherein each nucleoside in the deoxygenated region is a 2'-β-D-deoxynucleoside.

[0123] Example 26. An oligomeric compound according to Example 24 or Example 25, wherein the deoxygenated region is composed of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides.

[0124] Example 27. An oligomeric compound according to any one of Examples 24 to 26, wherein each nucleoside immediately adjacent to the deoxygenated region comprises a modified sugar moiety.

[0125] Example 28. An oligomeric compound according to any one of Examples 24 to 28, wherein the deoxygenated region is connected on the 5' side by a 5' outer region and on the 3' side by a 3' outer region, the 5' outer region being composed of 1 to 6 linked 5' outer region nucleosides, and the 3' outer region being composed of 1 to 6 linked 3' outer region nucleosides, wherein:

[0126] The 3' end nucleotide of the 5' outer region contains a modified sugar moiety; and

[0127] The 5'-terminal nucleotide of the 3' outer region contains a modified sugar moiety.

[0128] Example 29. The oligomeric compound according to Example 28, wherein each nucleoside in the 3' outer region comprises a modified sugar moiety.

[0129] Example 30. An oligomeric compound according to Example 28 or Example 29, wherein each nucleoside in the 5' outer region comprises a modified sugar moiety.

[0130] Example 31. The oligomeric compound according to Example 30, wherein the modified oligonucleotide has:

[0131] The 5' outer region consists of 5 linked nucleosides;

[0132] The deoxygenated region consists of 10 linked nucleosides; and

[0133] The 3' outer region consists of 5 linked nucleosides;

[0134] Each of the 5' outer region nucleosides and each of the 3' outer region nucleosides are 2'-MOE nucleosides, and each of the deoxygenated region nucleosides is a 2'-β-D-deoxynucleoside.

[0135] Example 32. An oligomeric compound according to any one of Examples 24 to 31, wherein at least three nucleoside internucleotide bonds in the deoxygenated region are methanesulfonyl phosphate nucleoside internucleotide bonds.

[0136] Example 33. A modified oligonucleotide according to the following chemical structure

[0137]

[0138] Or its pharmaceutically acceptable salt.

[0139] Example 34. The modified oligonucleotide according to Example 33, wherein the modified oligonucleotide is a pharmaceutically acceptable salt, including one or more cations selected from sodium, potassium, calcium and magnesium.

[0140] Example 35. The modified oligonucleotide according to Example 34, wherein the modified oligonucleotide is a sodium or potassium salt.

[0141] Example 36. A modified oligonucleotide based on the following chemical structure:

[0142]

[0143] Or its pharmaceutically acceptable salt.

[0144] Example 37. A modified oligonucleotide according to the following structure:

[0145]

[0146] Or its salt.

[0147] Example 38. The modified oligonucleotide according to Example 37 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

[0148] Example 39. The modified oligonucleotide according to Example 38, wherein the modified oligonucleotide is a sodium or potassium salt.

[0149] Example 40. A modified oligonucleotide based on the following chemical structure:

[0150]

[0151] Example 41. A modified oligonucleotide based on the following chemical structure:

[0152] Or its pharmaceutically acceptable salt.

[0153] Example 42. The modified oligonucleotide according to Example 41 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

[0154] Example 43. The modified oligonucleotide according to Example 42, wherein the modified oligonucleotide is a sodium or potassium salt.

[0155] Example 44. A modified oligonucleotide based on the following chemical structure:

[0156]

[0157] Example 45. A modified oligonucleotide based on the following chemical structure:

[0158]

[0159] Or its pharmaceutically acceptable salt.

[0160] Example 46. The modified oligonucleotide according to Example 45 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

[0161] Example 47. The modified oligonucleotide according to Example 46, wherein the modified oligonucleotide is a sodium or potassium salt.

[0162] Example 48. A modified oligonucleotide based on the following chemical structure:

[0163]

[0164] Example 49. A modified oligonucleotide based on the following chemical structure:

[0165]

[0166] Or its pharmaceutically acceptable salt.

[0167] Example 50. The modified oligonucleotide according to Example 49 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

[0168] Example 51. The modified oligonucleotide according to Example 50, wherein the modified oligonucleotide is a sodium or potassium salt.

[0169] Example 52. A modified oligonucleotide based on the following chemical structure:

[0170]

[0171] Example 53. A modified oligonucleotide based on the following chemical structure:

[0172]

[0173] Or its pharmaceutically acceptable salt.

[0174] Example 54. The modified oligonucleotide according to Example 53 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

[0175] Example 55. The modified oligonucleotide according to Example 54, wherein the modified oligonucleotide is a sodium or potassium salt.

[0176] Example 56. A modified oligonucleotide based on the following chemical structure:

[0177]

[0178] Example 57. An oligomeric compound comprising modified oligonucleotides according to the following chemical symbols: m C e s T es m C es m C eo A es A dz T ds T ds T ds T ds A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO:19),

[0179] in:

[0180] A = adenine nucleobase,

[0181] m C = 5-methylcytosine nucleobase,

[0182] G = guanine nucleobase

[0183] T = thymine nucleobase,

[0184] e = 2'-MOE sugar moiety,

[0185] d = 2'-β-D-deoxyribosyl sugar moiety,

[0186] s = thiophosphate nucleoside bond,

[0187] o = phosphate diester nucleoside bond, and

[0188] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and

[0189] The oligomeric compound optionally contains a conjugated group or a terminal group.

[0190] Example 58. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: G e s T es T eo T eo A es m C ds m C ds T ds T ds T dz A dz A dz m C ds A dz T ds T eo m C es m C es T es m C e (SEQ ID NO:20)

[0191] in:

[0192] A = adenine nucleobase,

[0193] m C = 5-methylcytosine nucleobase,

[0194] G = guanine nucleobase

[0195] T = thymine nucleobase,

[0196] e = 2'-MOE sugar moiety,

[0197] d = 2'-β-D-deoxyribosyl sugar moiety,

[0198] s = thiophosphate nucleoside bond,

[0199] o = phosphate diester nucleoside bond, and

[0200] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and

[0201] The oligomeric compound optionally contains a conjugated group or a terminal group.

[0202] Example 59. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: G e s T es T es T es A es m C ds m C ds T ds T ds T dz A dz A dz m C dz A dz T ds T es m C es m C es T es m C e (SEQ ID NO:21),

[0203] in:

[0204] A = adenine nucleobase,

[0205] m C = 5-methylcytosine nucleobase,

[0206] G = guanine nucleobase

[0207] T = thymine nucleobase,

[0208] e = 2'-MOE sugar moiety,

[0209] d = 2'-β-D-deoxyribosyl sugar moiety,

[0210] s = thiophosphate nucleoside internucleotide bond, and

[0211] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and

[0212] The oligomeric compound optionally contains a conjugated group or a terminal group.

[0213] Example 60. An oligomeric compound comprising modified oligonucleotides according to the following chemical symbols: mC e s T es m C es m C eo A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO:22),

[0214] in:

[0215] A = adenine nucleobase,

[0216] m C = 5-methylcytosine nucleobase,

[0217] G = guanine nucleobase

[0218] T = thymine nucleobase,

[0219] e = 2'-MOE sugar moiety,

[0220] d = 2'-β-D-deoxyribosyl sugar moiety,

[0221] s = thiophosphate nucleoside bond,

[0222] o = phosphate diester nucleoside bond, and

[0223] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and

[0224] The oligomeric compound optionally contains a conjugated group or a terminal group.

[0225] Example 61. An oligomeric compound comprising modified oligonucleotides according to the following chemical symbols: m C e s T es m C es m C eo Aes A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G es m C es A es m C es m C e (SEQ ID NO:23),

[0226] in:

[0227] A = adenine nucleobase,

[0228] m C = 5-methylcytosine nucleobase,

[0229] G = guanine nucleobase

[0230] T = thymine nucleobase,

[0231] e = 2'-MOE sugar moiety,

[0232] d = 2'-β-D-deoxyribosyl sugar moiety,

[0233] s = thiophosphate nucleoside bond,

[0234] o = phosphate diester nucleoside bond, and

[0235] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and

[0236] The oligomeric compound optionally contains a conjugated group or a terminal group.

[0237] Example 62. An oligomeric compound comprising modified oligonucleotides according to the following chemical symbols: m C e s T es m C es m C es A es A dz T ds T ds T ds T dz A dz Adz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO:24),

[0238] in:

[0239] A = adenine nucleobase,

[0240] m C = 5-methylcytosine nucleobase,

[0241] G = guanine nucleobase

[0242] T = thymine nucleobase,

[0243] e = 2'-MOE sugar moiety,

[0244] d = 2'-β-D-deoxyribosyl sugar moiety,

[0245] s = thiophosphate nucleoside bond,

[0246] o = phosphate diester nucleoside bond, and

[0247] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and

[0248] The oligomeric compound optionally contains a conjugated group or a terminal group.

[0249] Example 63. The group of oligomeric compounds according to any one of Examples 1 to 27 or 52 to 57, or the group of modified oligonucleotides according to any one of Examples 28 to 51, wherein all thiophosphate nucleoside inter-links in the thiophosphate nucleoside inter-links of the modified oligonucleotides are stereoatactic.

[0250] Example 64. A pharmaceutical composition comprising an oligomeric compound according to any one of Examples 1 to 32 or 57 to 62, or a modified oligonucleotide according to any one of Examples 33 to 56, or the group according to Example 63, and a pharmaceutically acceptable diluent.

[0251] Example 65. The pharmaceutical composition according to Example 64, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline.

[0252] Example 66. A pharmaceutical composition according to any one of Examples 64 to 65, wherein the pharmaceutical composition is substantially composed of the modified oligonucleotide, the oligomeric compound or the group and the artificial cerebrospinal fluid.

[0253] Example 67. A pharmaceutical composition according to any one of Examples 64 to 66, wherein the pharmaceutical composition comprises substantially the modified oligonucleotide, the oligomeric compound or the group and the phosphate buffered saline.

[0254] Example 68. A method comprising administering to a subject an oligomeric compound according to any one of Examples 1 to 32 or 57 to 62, a modified oligonucleotide according to any one of Examples 33 to 56, the group according to Example 63, or a pharmaceutical composition according to any one of Examples 64 to 67.

[0255] Example 69. The method according to Example 68, wherein the subject has or is at risk of having an APP-related disease or condition.

[0256] Example 70. The method according to Example 68 or Example 69, wherein administration of the oligomeric compound, the modified oligonucleotide, the group, or the pharmaceutical composition improves at least one symptom or sign of APP-related disease or condition.

[0257] Example 71. The method according to any one of Examples 68 to 70, wherein the administration of the modified oligonucleotide, the oligomer compound, the group or the pharmaceutical composition delays or slows the progression of cognitive impairment, delays or slows memory decline, delays or slows language skill decline, improves behavioral and psychological symptoms, alleviates emotional apathy, improves motivation, reduces gait disturbances, reduces seizures, delays or slows progressive dementia and / or reduces abnormal amyloid deposition.

[0258] Example 72. The method according to any one of Examples 68 to 71, wherein the APP protein level in the subject is reduced.

[0259] Example 73. The method according to any one of Examples 69 to 72, wherein the disease or condition associated with APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy.

[0260] Example 74. A method of treating an APP-related disease or condition, comprising administering to a subject who has or is at risk of developing an APP-related disease or condition a therapeutically effective amount of an oligomeric compound according to any one of Examples 1 to 32 or 57 to 62, a modified oligonucleotide according to any one of Examples 33 to 56, the group according to Example 63, or a pharmaceutical composition according to any one of Examples 64 to 67, thereby treating the APP-related disease or condition.

[0261] Example 75. The method according to Example 73, wherein administration of the modified oligonucleotide, the oligomer compound, the group, or the pharmaceutical composition improves at least one symptom or sign of the APP-related disease or condition.

[0262] Example 76. The method according to any one of Examples 73 to 74, wherein the administration of the modified oligonucleotide, the oligomer compound, the group, or the pharmaceutical composition delays or slows the progression of cognitive impairment, delays or slows memory decline, delays or slows language skill decline, improves behavioral and psychological symptoms, alleviates emotional apathy, improves motivation, reduces gait disturbances, reduces seizures, delays or slows progressive dementia, and / or reduces abnormal amyloid deposition.

[0263] Example 77. The method according to any one of Examples 74 to 76, wherein the APP protein level in the subject is reduced.

[0264] Example 78. The method according to any one of Examples 74 to 77, wherein the disease or condition associated with APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy.

[0265] Example 79. The method according to any one of Examples 74 to 78, wherein the subject is a human.

[0266] Example 80. A method for reducing APP expression in cells, comprising contacting the cells with an oligomeric compound according to any one of Examples 1 to 32 or 56 to 62, a modified oligonucleotide according to any one of Examples 33 to 56, the group according to Example 63, or a pharmaceutical composition according to any one of Examples 62 to 65.

[0267] Example 81. The method according to Example 80, wherein the cell is a cortical brain cell or a hippocampal cell.

[0268] Example 82. The method according to Example 80 or Example 81, wherein the cell is a human cell.

[0269] Example 83. Use of the oligomeric compound according to any one of Examples 1 to 32 or 57 to 62, the modified oligonucleotide according to any one of Examples 33 to 56, the group according to Example 63, or the pharmaceutical composition according to any one of Examples 64 to 67 for the treatment of diseases or conditions related to APP.

[0270] Example 84. Use of the oligomeric compound according to any one of Examples 1 to 32 or 57 to 62, the modified oligonucleotide according to any one of Examples 33 to 56, the group according to Example 63, or the pharmaceutical composition according to any one of Examples 64 to 67 in the manufacture of a medicament for treating diseases or conditions related to APP.

[0271] Example 85. The use according to any one of Examples 83 to 84, wherein the disease or symptom is associated with an elevated level of APP.

[0272] Example 86. The use according to any one of Examples 83 to 85, wherein the disease or condition associated with the APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy.

[0273] Certain oligomers and oligomer compounds

[0274] Some embodiments provide oligomers targeting APP nucleic acids. In some embodiments, the APP nucleic acid has the sequence shown in SEQ ID NO:1 (cDNA of Ensembl transcript ENST00000346798.7, from 94th edition: October 2018) or SEQ ID NO:2 (GENBANK accession number NC_000021.9, truncated from nucleosides 25878001 to 26174000). In some embodiments, the oligomer is a single-stranded oligomeric compound. In some embodiments, the oligomer is an oligomeric duplex.

[0275] Some embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an isolength portion of an APP nucleic acid, and wherein at least one internucleotide bond of the modified oligonucleotide is a methanesulfonyl phosphate nucleobase bond. In some embodiments, the APP nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an isolength portion of the APP nucleic acid. In any oligomeric compound provided herein, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an isolength portion of the APP nucleic acid, wherein the APP nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0276] Some embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases. In some embodiments, the modified oligonucleotide has a nucleobase sequence comprising any of the nucleobase sequences in SEQ ID NO: 15 to 18.

[0277] Some embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases, including the nucleobase sequence of SEQ ID NO:15 or SEQ ID NO:18. In some embodiments, the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:15 or SEQ ID NO:18.

[0278] Some embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides and having a nucleobase sequence comprising any one of SEQ ID NO: 15 to 18. Some embodiments provide an oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising any one of SEQ ID NO: 15 to 18.

[0279] Some embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:15 or SEQ ID NO:18. Some embodiments provide an oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising SEQ ID NO:15 or SEQ ID NO:18.

[0280] Some embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO:15. Some embodiments also provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO:15.

[0281] Some embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO:16. Some embodiments also provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO:16.

[0282] Some embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO:17. Some embodiments also provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO:17.

[0283] Some embodiments provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO:18. Some embodiments also provide an oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO:18.

[0284] In any of the oligomers provided herein, the modified oligonucleotides may be in quantities of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 3 The oligonucleotide consists of 0, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

[0285] In any of the oligomers provided herein, the modified oligonucleotide comprises at least one modified internucleotide bond, wherein the at least one modified internucleotide bond of the modified oligonucleotide is a methanesulfonyl phosphate internucleotide bond. In any of the oligomers provided herein, the modified oligonucleotide has at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight internucleotide bonds that are methanesulfonyl phosphate internucleotide bonds. In some embodiments, the modified oligonucleotide comprises one, two, three, four, five, six, or one to six methanesulfonyl phosphate internucleotide bonds. In any of the oligomers provided herein, the modified oligonucleotide has an internucleotide bond motif comprising at least one methanesulfonyl phosphate internucleotide bond. In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide motif containing at least 2, 3, 4, 5, 6, 7, or 8 methanesulfonyl phosphate nucleoside internucleotides. In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide motif containing 1, 2, 3, 4, 5, 6, or 1 to 6 methanesulfonyl phosphate nucleoside internucleotides. In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide motif containing 2 to 5 methanesulfonyl phosphate nucleoside internucleotides. In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide motif containing 2 methanesulfonyl phosphate nucleoside internucleotides. In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide motif containing 3 methanesulfonyl phosphate nucleoside internucleotides. In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide motif containing 4 methanesulfonyl phosphate nucleoside internucleotides. In some embodiments, the modified oligonucleotide contains a nucleoside internucleotide motif comprising five methanesulfonyl phosphate nucleoside internucleotides.

[0286] In any of the oligomeric compounds provided herein, at least one internucleotide bond of the modified oligonucleotide may be a phosphate thioester internucleotide bond. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising at least one methanesulfonyl phosphate internucleotide bond and at least one phosphate thioester internucleotide bond. In some embodiments, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising 9 to 18 phosphate thioester internucleotide bonds. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising 10 to 14 phosphate thioester internucleotide bonds. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising 14 phosphate thioester internucleotide bonds.

[0287] In some embodiments, at least one internucleotide bond in the modified oligonucleotide may be a phosphodiester internucleotide bond. In some embodiments, the modified oligonucleotide comprises at least one methanesulfonyl phosphate internucleotide bond and at least one phosphodiester internucleotide bond. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising at least one phosphodiester internucleotide bond. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising at least one, at least two, at least three, at least four, at least five, or at least six phosphodiester internucleotide bonds. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising one to three phosphodiester internucleotide bonds. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising one phosphodiester internucleotide bond. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising two phosphodiester internucleotide bonds.

[0288] In some embodiments, the modified oligonucleotide comprises at least one methanesulfonyl phosphate nucleoside bond, at least one thiophosphate nucleoside bond, and at least one phosphodiester nucleoside bond. In some embodiments, the modified oligonucleotide comprises at least one methanesulfonyl phosphate nucleoside bond, at least one thiophosphate nucleoside bond, and at least one phosphodiester nucleoside bond.

[0289] In any of the oligomers provided herein, at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In some embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2'-MOE sugar moiety or a 2'-OMe sugar moiety. In some embodiments, the modified sugar moiety is a 2'-MOE sugar moiety.

[0290] In any of the oligomers provided herein, at least one nucleobase of the modified oligonucleotide may be a modified nucleobase, such as 5-methylcytosine. In some embodiments, each cytosine is 5-methylcytosine.

[0291] In any of the oligomers provided herein, the modified oligonucleotide may comprise a deoxygenated region consisting of 5 to 12 consecutive 2'-deoxynucleosides. In some embodiments, each nucleoside in the deoxygenated region is a 2'-β-D-deoxynucleoside. In some embodiments, the deoxygenated region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In some embodiments, each nucleoside immediately adjacent to the deoxygenated region comprises a modified sugar moiety. In some embodiments, the deoxygenated region is side-attached on the 5' side by a 5' outer region and on the 3' side by a 3' outer region, the 5' outer region consisting of 1 to 6 linked 5' outer region nucleosides, and the 3' outer region consisting of 1 to 6 linked 3' outer region nucleosides; wherein the 3'most nucleoside of the 5' outer region comprises a modified sugar moiety; and the 5'most nucleoside of the 3' outer region comprises a modified sugar moiety. In some embodiments, each nucleoside in the 3' outer region comprises a modified sugar moiety. In some embodiments, each nucleotide in the 5' outer region comprises a modified sugar moiety. In some embodiments, each of the 5' outer region nucleotides and each of the 3' outer region nucleotides are 2'-MOE nucleotides. In some embodiments, the modified oligonucleotide has a 5' outer region consisting of 5 linked nucleotides, a deoxy region consisting of 10 linked nucleotides, and a 3' outer region consisting of 5 linked nucleotides, wherein each of the 5' outer region nucleotides and each of the 3' outer region nucleotides are 2'-MOE nucleotides.

[0292] 1. Compound No. 1620705

[0293] Compound No. 1620705 was characterized as a 5-10-5 MOE spacer consisting of 20 linked nucleosides and having (from 5' to 3') CTCCAATTTTAACTTGCACC (SEQ ID NO: 1620705). The nucleobase sequence of NO:18, wherein each of nucleosides 1 to 5 and 16 to 20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6 to 15 is a 2'-β-D-deoxy nucleoside, wherein the internucleotide bond between nucleosides 4 to 5 and 16 to 17 is a phosphodiester internucleotide bond, the internucleotide bond between nucleosides 1 to 2, 2 to 3, 3 to 4, 5 to 6, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 13 to 14, 14 to 15, 15 to 16, 17 to 18, 18 to 19 and 19 to 20 is a thiophosphate internucleotide bond, and the internucleotide bond between nucleosides 6 to 7, 11 to 12 and 12 to 13 is a methanesulfonylaminophosphate bond, and wherein each cytosine is 5-methylcytosine.

[0294] Compound No. 1620705 is represented by the following chemical symbols (5' to 3'): m C es T esm C es m C eo A es A dz T ds T ds T ds T d s A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO:19), where,

[0295] A = adenine nucleobase,

[0296] m C = 5-methylcytosine nucleobase,

[0297] G = guanine nucleobase

[0298] T = thymine nucleobase,

[0299] e = 2'MOE sugar portion,

[0300] d = 2'-β-D deoxyribosyl sugar moiety,

[0301] s = thiophosphate nucleoside bond,

[0302] o = phosphate diester nucleoside bond, and

[0303] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and the compound does not contain conjugation groups or terminal groups.

[0304] Compound No. 1620705 is represented by the following chemical structure:

[0305] Or its pharmaceutically acceptable salt.

[0306] In some embodiments, compound 1620705 is a pharmaceutically acceptable salt, comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In some embodiments, compound 1620705 is a sodium or potassium salt.

[0307] The sodium salt of compound No. 1620705 is represented by the following chemical structure:

[0308]

[0309] 2. Compound No. 1681029

[0310] Compound No. 1681029 was characterized as a 5-10-5 MOE spacer composed of 20 linked nucleosides and having (from 5' to 3')GTTTACCTTTAACATTCCTC (SEQ ID NO: 1681029). The nucleobase sequence of NO:15, wherein each of nucleosides 1 to 5 and 16 to 20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6 to 15 is a 2'-β-D-deoxy nucleoside, wherein the internucleotide bonds between nucleosides 3 to 4, 4 to 5 and 16 to 17 are phosphodiester internucleotide bonds, the internucleotide bonds between nucleosides 1 to 2, 2 to 3, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 13 to 14, 15 to 16, 17 to 18, 18 to 19 and 19 to 20 are thiophosphate internucleotide bonds, and the internucleotide bonds between nucleosides 10 to 11, 11 to 12, 12 to 13 and 14 to 15 are methanesulfonylaminophosphate bonds, and wherein each cytosine is 5-methylcytosine.

[0311] Compound No. 1681029 is represented by the following chemical symbols (5' to 3'): G es T es T eo T eo A es m C ds m C ds T ds T ds T d z A dz A dz m C ds A dz T ds T eo m C es m C es T es m C e (SEQ ID NO:20), where,

[0312] A = unmodified adenine nucleobase.

[0313] m C = 5-methylcytosine nucleobase,

[0314] G = unmodified guanine nucleobase.

[0315] T = unmodified thymine nucleobase,

[0316] e = 2'-MOE sugar moiety,

[0317] d = 2'-β-D-deoxyribosyl sugar moiety,

[0318] s = thiophosphate nucleoside bond,

[0319] o = phosphate diester nucleoside bond, and

[0320] z = methanesulfonylaminophosphate nucleoside internucleotide bond; and the compound does not contain conjugation groups or terminal groups.

[0321] Compound No. 1681029 is represented by the following chemical structure:

[0322] Or its pharmaceutically acceptable salt.

[0323] In some embodiments, compound 1621029 is a pharmaceutically acceptable salt, comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In some embodiments, compound 1621029 is a sodium or potassium salt.

[0324] The sodium salt of compound No. 1621029 is represented by the following chemical structure:

[0325]

[0326] 3. Compound No. 1681031

[0327] Compound No. 1681031 was characterized as a 5-10-5 MOE spacer composed of 20 linked nucleosides and having (from 5' to 3')GTTTACCTTTAACATTCCTC (SEQ ID NO: 1681031). The nucleobase sequence of NO:15, wherein each of nucleosides 1 to 5 and 16 to 20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6 to 15 is a 2'-β-D-deoxy nucleoside, wherein the internucleotide bonds between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 15 to 16, 16 to 17, 17 to 18, 18 to 19 and 19 to 20 are thiophosphate internucleotide bonds, and the internucleotide bonds between nucleosides 10 to 11, 11 to 12, 12 to 13, 13 to 14 and 14 to 15 are methanesulfonyl phosphate internucleotide bonds, and wherein each cytosine is 5-methylcytosine.

[0328] Compound No. 1681031 is represented by the following chemical symbols (5' to 3'): G es T es T es T es A es m C ds m C ds T ds T ds T d z A dz A dz m C dz A dz T ds T es m C es m C es T es m C e (SEQ ID NO:21), where,

[0329] A = adenine nucleobase,

[0330] m C = 5-methylcytosine nucleobase,

[0331] G = guanine nucleobase

[0332] T = thymine nucleobase,

[0333] e = 2'MOE sugar portion,

[0334] d = 2'-β-D deoxyribosyl sugar moiety,

[0335] s = thiophosphate nucleoside internucleotide bond, and

[0336] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and the compound does not contain conjugation groups or terminal groups.

[0337] Compound No. 1681031 is represented by the following chemical structure:

[0338] Or its pharmaceutically acceptable salt.

[0339] In some embodiments, compound 1681031 is a pharmaceutically acceptable salt, comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In some embodiments, compound 1681031 is a sodium or potassium salt.

[0340] The sodium salt of compound No. 1681031 is represented by the following chemical structure:

[0341]

[0342] 4. Compound No. 1683009

[0343] Compound No. 1683009 was characterized as a 5-10-5 MOE spacer consisting of 20 linked nucleosides and having (from 5' to 3') CTCCAATTTTAACTTGCACC (SEQ ID NO: 1683009). The nucleobase sequence of NO:18, wherein each of nucleosides 1 to 5 and 16 to 20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6 to 15 is a 2'-β-D-deoxy nucleoside, wherein the internucleotide bond between nucleosides 4 to 5 and 16 to 17 is a phosphodiester internucleotide bond, the internucleotide bond between nucleosides 1 to 2, 2 to 3, 3 to 4, 5 to 6, 7 to 8, 8 to 9, 9 to 10, 13 to 14, 14 to 15, 15 to 16, 17 to 18, 18 to 19 and 19 to 20 is a thiophosphate internucleotide bond, and the internucleotide bond between nucleosides 6 to 7, 10 to 11, 11 to 12 and 12 to 13 is a methanesulfonylaminophosphate internucleotide bond, and wherein each cytosine is 5-methylcytosine.

[0344] Compound No. 1683009 is represented by the following chemical symbols (5' to 3'): m C es T es m C es m C eo A es A dz T ds T ds T ds T d z A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO:22), where,

[0345] A = adenine nucleobase,

[0346] mC = 5-methylcytosine nucleobase,

[0347] G = guanine nucleobase

[0348] T = thymine nucleobase,

[0349] e = 2'MOE sugar portion,

[0350] d = 2'-β-D deoxyribosyl sugar moiety,

[0351] s = thiophosphate nucleoside bond,

[0352] o = phosphate diester nucleoside bond, and

[0353] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and the compound does not contain conjugation groups or terminal groups.

[0354] Compound No. 1683009 is represented by the following chemical structure:

[0355] Or its pharmaceutically acceptable salt.

[0356] In some embodiments, compound 1683009 is a pharmaceutically acceptable salt, comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In some embodiments, compound 1683009 is a sodium or potassium salt.

[0357] The sodium salt of compound No. 1683009 is represented by the following chemical structure:

[0358]

[0359] 5. Compound No. 1683010

[0360] Compound No. 1683010 was characterized as a 5-10-5 MOE spacer consisting of 20 linked nucleosides and having (from 5' to 3') CTCCAATTTTAACTTGCACC (SEQ ID NO: 1683010). The nucleobase sequence of NO:18, wherein each of nucleosides 1 to 5 and 16 to 20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6 to 15 is a 2'-β-D-deoxy nucleoside, wherein the internucleotide bond between nucleosides 4 and 5 is a phosphodiester internucleotide bond, the internucleotide bonds between nucleosides 1 to 2, 2 to 3, 3 to 4, 5 to 6, 7 to 8, 8 to 9, 9 to 10, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19 and 19 to 20 are thiophosphate internucleotide bonds, and the internucleotide bonds between nucleosides 6 to 7, 10 to 11, 11 to 12 and 12 to 13 are methanesulfonylaminophosphate internucleotide bonds, and wherein each cytosine is 5-methylcytosine.

[0361] Compound No. 1683010 is represented by the following chemical symbols (from 5' to 3'): m C es T es m C es m C eo A es A dz T ds T ds T d s T dz A dz A dz m C ds T ds T ds G es m C es A es m C es m C e (SEQ ID NO:23), where,

[0362] A = adenine nucleobase,

[0363] m C = 5-methylcytosine nucleobase,

[0364] G = guanine nucleobase

[0365] T = thymine nucleobase,

[0366] e = 2'MOE sugar portion,

[0367] d = 2'-β-D deoxyribosyl sugar moiety,

[0368] s = thiophosphate nucleoside bond,

[0369] o = phosphate diester nucleoside bond, and

[0370] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and the compound does not contain conjugation groups or terminal groups.

[0371] Compound No. 1683010 is represented by the following chemical structure:

[0372] Or its pharmaceutically acceptable salt.

[0373] In some embodiments, compound 1683010 is a pharmaceutically acceptable salt, comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In some embodiments, compound 1683010 is a sodium or potassium salt.

[0374] The sodium salt of compound No. 1683010 is represented by the following chemical structure:

[0375]

[0376] 6. Compound No. 1683011

[0377] Compound No. 1683011 was characterized as a 5-10-5 MOE spacer consisting of 20 linked nucleosides and having (from 5' to 3') CTCCAATTTTAACTTGCACC (SEQ ID NO: 1683011). The nucleobase sequence of NO:18, wherein each of nucleosides 1 to 5 and 16 to 20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6 to 15 is a 2'-β-D-deoxy nucleoside, wherein the internucleotide bond between nucleosides 16 and 17 is a phosphodiester internucleotide bond, the internucleotide bonds between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 7 to 8, 8 to 9, 9 to 10, 13 to 14, 14 to 15, 15 to 16, 17 to 18, 18 to 19 and 19 to 20 are thiophosphate internucleotide bonds, and the internucleotide bonds between nucleosides 6 to 7, 10 to 11, 11 to 12 and 12 to 13 are methanesulfonylaminophosphate internucleotide bonds, and wherein each cytosine is 5-methylcytosine.

[0378] Compound No. 1683011 is represented by the following chemical symbols (5' to 3'): m C es T es m C esm C es A es A dz T ds T ds T ds T d z A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO:24), where,

[0379] A = adenine nucleobase,

[0380] m C = 5-methylcytosine nucleobase,

[0381] G = guanine nucleobase

[0382] T = thymine nucleobase,

[0383] e = 2'MOE sugar portion,

[0384] d = 2'-β-D deoxyribosyl sugar moiety,

[0385] s = thiophosphate nucleoside bond,

[0386] o = phosphate diester nucleoside bond, and

[0387] z = methanesulfonylaminophosphate nucleoside internucleotide bond, and the compound does not contain conjugation groups or terminal groups.

[0388] Compound No. 1683011 is represented by the following chemical structure:

[0389] Or its pharmaceutically acceptable salt.

[0390] In some embodiments, compound 1683011 is a pharmaceutically acceptable salt, comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In some embodiments, compound 1683011 is a sodium or potassium salt.

[0391] The sodium salt of compound No. 1683011 is represented by the following chemical structure:

[0392]

[0393] I. certain oligonucleotides

[0394] In some embodiments, this document provides oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleotide bond. Certain modified nucleosides and modified internucleotide bonds suitable for use in modified oligonucleotides are described below.

[0395] A. Some modified nucleosides

[0396] The modified nucleoside comprises a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In some embodiments, a modified nucleoside comprising the following modified sugar moiety and / or the following modified nucleobase may be incorporated into an antisense oligonucleotide.

[0397] 1. Some sugar portions

[0398] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In some embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may contain one or more substitutions corresponding to substitutions for other types of modified sugar moiety.

[0399] In some embodiments, the modified sugar moiety is a non-bicyclic modified furanyl sugar moiety containing one or more acyclic substituents (including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions). In some embodiments, the furanyl sugar moiety is a ribosyl sugar moiety. In some embodiments, one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched.

[0400] In some embodiments, the non-bicyclic modified sugar moiety contains a substituent group at the 2' position. Examples of suitable substituent groups for the 2' position of the modified sugar moiety include, but are not limited to: F, OCH3 (“OMe” or “O-methyl”), and OCH2CH2OCH3 (“MOE” or “O-methoxyethyl”). In some embodiments, the 2'-substituent group is selected from: halogen, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C. 10 Alkoxy, O-C1-C10 Substituted alkoxy groups, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R) m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-alkynyl, S-alkynyl, N(R m )-Alkyne, O-alkylene-O-alkyl, Alkyne, Alkylaryl, Arylalkyl, O-Alkylaryl, O-Arylalkyl, O(CH2)2SCH3, O(CH2)2ON(R m (R) n ) or OCH2C(=O)-N(R m (R) n ), where each R m and R n Independently H, amino protecting group, or substituted or unsubstituted C1-C 10 Alkyl groups, -O(CH2)2ON(CH3)2 (“DMAOE”) or 2'-O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”) and 2'-substituent groups described in the following documents: Cook et al., US6,531,584; Cook et al., US5,859,221; and Cook et al., US6,005,087.

[0401] Methods for synthesizing some of these 2'-substituent groups can be found, for example, in the following literature: Cook et al., US6,531,584; and Cook et al., US5,859,221. Certain embodiments of these 2'-substituent groups may be further substituted with one or more substituent groups independently selected from the group consisting of: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0402] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent group selected from the following: F,NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R) m (R) n O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R) m (R) n )), where each Rm and R n Independently H, amino protecting group, or substituted or unsubstituted C1-C 10 alkyl.

[0403] In some embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a 2'-substituent group selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”) and OCH2C(=O)-N(H)CH3 (“NMA”).

[0404] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent group selected from the following: F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 (“NMA”).

[0405] In some embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a 2'-substituent group selected from the following: F, OCH3, and OCH2CH2OCH3.

[0406] In some embodiments, the modified furanyl sugar moiety and the nucleotide incorporated into such modified furanyl sugar moiety are further defined by isomer configurations. For example, in addition to the naturally occurring β-D-deoxyribosyl configuration, the 2'-deoxyfuranyl sugar moiety can have seven isomer configurations. Such modified sugar moieties are described, for example, in WO 2020 / 072991. The 2'-modified sugar moiety has an additional stereocenter at the 2' position relative to the 2'-deoxyfuranyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomer configurations. Unless otherwise stated, the modified furanyl sugar moieties described herein are in the β-D-ribosyl isomer configuration.

[0407] In some embodiments, the non-bicyclic modified sugar moiety is a stereoisomer of DNA, such as the 2'-β-D-deoxyxylose moiety:

[0408]

[0409] In some embodiments, the non-bicyclic modified nucleoside comprises a 2'-α-L-deoxyribosyl sugar moiety:

[0410]

[0411] In some embodiments, the non-bicyclic modified sugar moiety contains a substituent group at the 3' position. Examples of suitable substituent groups for the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy) and alkyl (e.g., methyl, ethyl).

[0412] In some embodiments, the non-bicyclic modified sugar moiety contains a substituent group at the 4' position. Examples of suitable substituent groups for the 4' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and substituent groups described in Manoharan et al., WO 2015 / 106128.

[0413] In some embodiments, the non-bicyclic modified sugar moiety contains a substituent group at the 5' position. Examples of suitable substituent groups for the 5' position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy (e.g., methoxy), and alkyl (e.g., methyl (R or S), ethyl).

[0414] In some embodiments, the non-bicyclic modified sugar moiety comprises more than one non-bridging sugar substituent, such as, for example, a 2'-F-5'-methyl sugar moiety as described in Migawa et al., US2010 / 0190837, or alternative 2'-modified sugar moieties and 5'-modified sugar moieties as described in Rajeev et al., US2013 / 0203836.

[0415] In naturally occurring nucleic acids, sugars are linked together from 3' to 5'. In some embodiments, oligonucleotides contain one or more nucleoside or sugar moieties linked at alternative positions (e.g., at the 2' position or inverted 5' to 3' positions). For example, when the bond is at the 2' position, the 2'-substituent group may be located at the 3' position instead.

[0416] Certain modified sugar moieties are bicyclic sugar moieties and contain substituents that bridge the two atoms of the furanyl ring to form a second ring, thereby producing a bicyclic sugar moiety. In some embodiments, the bicyclic sugar moieties contain a bridge between the 4' and 2' furanyl ring atoms. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (referred to as “restricted ethyl” or “cEt” when in the S configuration), 4'-CH2-O-CH2-2', 4' -CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' (“restricted MOE” or “cMOE”) and their analogues, 4'-C(CH3)(CH3)-O-2' and their analogues, 4'-CH2-N(OCH3)-2' and their analogues, 4'-CH2-ON(CH3)-2', 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)-2' and their analogues, 4'-C(R)-2' ..., 4'-CH2-OCH3)-2', 4'-CH2-C(CH2OCH3)-O-2', and their analogues. a R b )-N(R)-O-2'、4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2', wherein each R, R a and R b Independently H, protecting group or C1-C 12 Alkyl groups. Representative U.S. patents teaching the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., US7,427,672; Swayze et al., US7,741,457 and Swayze et al., US8,022,193; Seth et al., US8,278,283; Prakash et al., US8,278,425; Seth et al., US8,278,426.

[0417] In some embodiments, such 4' to 2' bridges independently comprise 1 to 4 linked groups independently selected from: -[C(R a (R) b )] n -、-[C(R a (R) b )] n -O-、-C(R a )=C(R b )-、-C(R a) = N-, -C( = NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and-N(R) a )-;

[0418] in:

[0419] x is 0, 1, or 2;

[0420] n is 1, 2, 3 or 4;

[0421] Each R a and R b Independently, it is H, protecting group, hydroxyl group, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or thionyl (S(=O)-J1); and each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl groups or protecting groups.

[0422] The additional bicyclic sugar moiety is known in the art; see, for example: Wan et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., US8,080,644; Ramasamy et al., US6,525,191; Seth et al., US7,547,684; and Seth et al., US7,666,854.

[0423] In some embodiments, the bicyclic sugar moiety and the nucleotide incorporated into such a bicyclic sugar moiety are further defined by isomer configuration. For example, LNA nucleotides (described herein) can be in the α-L or β-D configuration.

[0424]

[0425] α-L-methyleneoxy(4'-CH2-O-2') or α-L-LNA bicyclic nucleotides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Addition of locked nucleic acids to siRNA has been shown to improve siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this paper, the general description of bicyclic nucleotides includes two isomer configurations. Unless otherwise stated, when identifying the position of a particular bicyclic nucleotide (e.g., LNA or cEt) in the exemplary embodiments herein, they are in the β-D configuration.

[0426] In some embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5'-substituted sugar and 4'-2'-bridging sugar).

[0427] In some embodiments, the modified sugar moiety is a sugar substitute. In some such embodiments, the oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom. In some such embodiments, the modified sugar moiety also contains bridging substituents and / or non-bridging substituents as described herein. For example, some sugar substitutes contain a 4'-sulfur atom and substitutions at the 2' and / or 5' positions.

[0428] In some embodiments, the sugar substitute comprises a ring having atoms other than five atoms. For example, in some embodiments, the sugar substitute comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anisole nucleic acid (“ANA”), mannitol nucleic acid (“MNA”), and fluoroHNA.

[0429]

[0430] (“F-HNA”, see, for example, Egli et al., J Am Chem (2011) 133(41): 16642-16649, Swayze et al., US 8,088,904; and Swayze et al., US 8,440,803). F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran or 3'-FHNA, and nucleosides containing additional modified THP compounds having the following formula:

[0431]

[0432] Independently, for each of the aforementioned modified THP nucleotides:

[0433] Bx is the nucleobase portion;

[0434] T3 and T4 are each independently an internucleotide linker group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleotide linker group that links the modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-terminal group or a 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, a C1-C6 alkyl group, or a substituted group. C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and each of R1 and R2 is independently hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 or CN, wherein X is O, S or NJ1, and each J1, J2 and J3 is independently H or C1-C6 alkyl.

[0435] In some embodiments, a modified THP nucleoside is provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In some embodiments, a modified THP nucleoside is provided, wherein one of R1 and R2 is F. In some embodiments, R1 is F and R2 is H; in some embodiments, R1 is methoxy and R2 is H; and in some embodiments, R1 is methoxyethoxy and R2 is H.

[0436] In some embodiments, the sugar substitute comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, nucleosides comprising a morpholine sugar moiety and their use in oligonucleotides have been reported. As used herein, the term "morpholine" refers to a sugar substitute having the following structure:

[0437]

[0438] In some embodiments, the morpholino may be modified, for example, by adding or altering various substituent groups derived from the morpholino structure described above. Such sugar substitutes are referred to herein as "modified morpholino".

[0439] In some embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar substitutes include, but are not limited to, peptide nucleic acids (“PNA”), acyclic butyl nucleic acids, and nucleosides and oligonucleotides described in Manoharan et al., US10,913,767. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262.

[0440] In some embodiments, the sugar substitute is the “unlocked” sugar structure of an UNA (unlocked nucleic acid) nucleotide. An UNA is a nucleotide in which any bonds in the sugar moiety have been removed, thereby forming the unlocked sugar substitute. Representative U.S. publications teaching the preparation of UNA include, but are not limited to, U.S. Patent Publication No. 2011 / 0313020.

[0441] In some embodiments, the sugar substitute is glycerol found in GNA (glycolic acid) nucleosides as shown below:

[0442]

[0443] Where Bx represents any nucleobase.

[0444] Many other bicyclic and tricyclic sugars and sugar substitutes are known in the art and can be used for modified nucleosides.

[0445] 2. certain modified nucleobases

[0446] In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleosides, referred to as debased nucleosides. In some embodiments, the modified oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides containing hypoxanthine nucleosides). An "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is a group of atoms other than the unmodified A, T, C, U, or G that can pair with at least one other nucleobase. 5-Methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleosides.

[0447] In some embodiments, the modified adenine has structure (I):

[0448]

[0449] Where: R 2A It is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl or substituted C1-C6 thioalkyl, C1-C6 alkoxy or substituted C1-C6 alkoxy; R 6A It is H, N(R) a (R) b ), oxo, acetyl, formyl, or o-phenyl; Y 7A It is N, and R 7A It either does not exist or is a C1-C6 alkyl group; or Y 7A It is C, and R 7A It is H, C1-C6 alkyl or CN(R) a (R) b );Y 8A It is N, and R 8A Does not exist, or Y 8A It is C, and R 8A It is H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R bIndependently, it can be H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together to form a 5- to 7-membered heterocycle; excluding Y. 7A This is the case of N; Y 8A It is C, R 8A It is H, R 2A It is H, and R 6A It is NH2 (unmodified adenine).

[0450] In some embodiments, unmodified guanine has structure (II):

[0451]

[0452] Where R 2G It is N(R) a (R) b R 6G It is oxidative, and R 1G It's H, or R. 6G It is an O-C1-C6 alkyl or an S-C1-C6 alkyl, and R 1G Does not exist; Y 7G It is N, and R 7A It either does not exist or is a C1-C6 alkyl group; or Y 7G It is C, and R 7G It is H, C1-C6 alkyl or CN(R) a (R) b );Y 8G It is N, and R 8G Does not exist, or Y 8G It is C, and R 8G It is H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R b Independently, it can be H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together to form a 5- to 7-membered heterocycle; excluding Y. 7G This is the case of N; Y 8G It is C, R 8G It is H, R 2G It is NH2, and R 6G It is = O (unmodified guanosine).

[0453] In some embodiments, the modified thymine or the modified uracil has structure (III):

[0454]

[0455] Where: each X is independently O or S, and R5U It is H, OH, halogen, O-Cl-C 12 Alkyl, O-C1-C 12 Substituted alkyl groups, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl or substituted C1-C 12 Alkenyl; where if each X is O, then R 5U It is neither H nor CH3 (which are unmodified uracil and unmodified thymine, respectively).

[0456] In some embodiments, the modified cytosine has structure (IV):

[0457]

[0458] Where: X is O or S; R 4C It is N(R) a (R) b ); R 5C It is H, OH, halogen, O-Cl-C 12 Alkyl, O-C1-C 12 Substituted alkyl groups, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl or substituted C1-C 12 alkenyl; R a and R b Independently, it can be H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together to form a 5- to 7-membered heterocycle; excluding X which is O or R. 4C It is NH2, and R 5C This is the case for H (unmodified cytosine).

[0459] In some embodiments, the modified nucleobase is selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In some embodiments, the modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymidine and 2-thiocytosine, 5-propynyl(-C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8- Aza and other 8-substituted purines, 5-halogenated (especially 5-bromine), 5-trifluoromethyl, 5-haloururacil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deadenine, 7-deadenine, 3-deadenine, 3-deadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, mixed bases, size-enlarged bases and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include nucleobases in which purine or pyrimidine bases are replaced by other heterocycles (e.g., 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone). Other nucleobases include those disclosed in the following literature: Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., eds., CRC Press, 1993, 273-288; and those disclosed in the following literature: Chapters 6 and 15, Antisense Drug Technology, Crooke ST ed., CRC Press, 2008, 163-166 and 442-443.

[0460] Publications teaching the preparation of certain modified nucleosides and other modified nucleosides are, but are not limited to, Rogers et al., US5,134,066; Benner et al., US5,432,272; Matteucci et al., US5,502,177; Froehler et al., US5,594,121; and Cook et al., US5,681,941.

[0461] In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase selected from modified adenine (A) having a structure represented by structure I, modified guanine (G) having a structure represented by structure II, modified thymine (T) or modified uracil (U) having a structure represented by structure III, and modified cytosine (C) having a structure represented by structure IV.

[0462] In some embodiments, each nucleobase of the modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, and m C. 5-Methylcytosine is a modified nucleobase with structure IV, where X is O, R 4C It is NH2, and R 5C It is CH3.

[0463] In some embodiments, each nucleobase of the modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, m C or hypoxanthine. Hypoxanthine is a modified adenine, in which Y... 7A It is N, and R 7A It does not exist, Y 8A It is C, R 8A It is H, R 2A It is H, and R 6A It is oxygenation.

[0464] In some embodiments, the modified oligonucleotide does not contain any modified nucleobases, and each nucleobase of the modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U.

[0465] 3. Certain modified nucleoside bonds

[0466] Naturally occurring RNA and DNA nucleoside linkages are 3' to 5' phosphodiester bonds. In some embodiments, the nucleosides of modified oligonucleotides may be linked together using one or more modified nucleoside linkages. Two main classes of linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing nucleoside linkages include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, aminophosphate, thiophosphate (“P=S”), and dithiophosphate (“HS-P=S”), which contain a phosphodiester bond (“P=O”) (also referred to as an unmodified or naturally occurring bond). Representative non-phosphoside linkage groups include, but are not limited to, methylene methylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thiocarbonyl carbamate (-OC(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified nucleoside bonds, compared to naturally occurring phosphodiester nucleoside bonds, can be used to alter, and typically increase, the nuclease resistance of oligonucleotides. In some embodiments, nucleoside bonds with chiral atoms can be prepared as racemic mixtures or as individual enantiomers. Methods for preparing phosphorus-containing and phosphorus-free nucleoside bonds are well known to those skilled in the art.

[0467] In some embodiments, the modified nucleoside interbond is any modified nucleoside interbond described in WO 2021 / 030778. In some embodiments, the modified nucleoside interbond comprises the following formula:

[0468]

[0469] Independently, for each of these nucleoside linking groups of the modified oligonucleotide:

[0470] X is O or S;

[0471] R1 is H, a C1-C6 alkyl group, or a substituted C1-C6 alkyl group; and

[0472] T is SO2R2, C(=O)R3, or P(=O)R4R5, where:

[0473] R2 is an aryl, substituted aryl, heterocyclic, substituted heterocyclic, aromatic heterocyclic, substituted aromatic heterocyclic, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl, substituted C1-C6 alkynyl, or conjugate group.

[0474] R3 is an aryl, substituted aryl, CH3, N(CH3)2, OCH3 or a conjugate group;

[0475] R4 is an OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, or conjugate group; and

[0476] R5 is OCH3, OH, C1-C6 alkyl, or a substituted C1-C6 alkyl.

[0477] In some embodiments, the modified nucleoside interbond comprises a methanesulfonyl phosphate linker group having the following formula:

[0478]

[0479] The methanesulfonyl phosphate nucleoside internucleotide bond contains a chiral center. In some embodiments, the modified oligonucleotide comprises (Rp) and / or (Sp) methanesulfonyl phosphate, as shown in the following formulas, where "B" represents a nucleobase:

[0480]

[0481] Representative internucleotide bonds with chiral centers include, but are not limited to, alkyl phosphate esters and thiophosphate esters. Modified oligonucleotides containing internucleotide bonds with chiral centers can be prepared as groups of modified oligonucleotides containing stereorandom internucleotide bonds, or as groups of modified oligonucleotides containing such internucleotide bonds exhibiting a specific stereochemical configuration. In some embodiments, the group of modified oligonucleotides contains thiophosphate internucleotide bonds, wherein all of the thiophosphate internucleotide bonds are stereorandom. In some embodiments, the group of modified oligonucleotides contains methanesulfonyl phosphate internucleotide bonds, wherein all of the methanesulfonyl phosphate internucleotide bonds are stereorandom. Such modified oligonucleotides can be produced using a randomly selected synthetic method that induces a stereochemical configuration for each internucleotide bond with a chiral center. Nevertheless, each individual internucleotide bond with a chiral center in each individual oligonucleotide molecule has a defined stereochemical configuration. In some embodiments, the modified oligonucleotide clusters are enriched with modified oligonucleotides comprising one or more specific thiophosphate nucleoside internucleotide bonds and / or methanesulfonyl phosphate nucleoside internucleotide bonds, each exhibiting a specific, independently selected stereochemical configuration. In some embodiments, the specific configuration of the specific thiophosphate bond and / or methanesulfonyl phosphate bond is present in at least 65% of the molecules in the cluster. In some embodiments, the specific configuration of the specific thiophosphate bond and / or methanesulfonyl phosphate bond is present in at least 70% of the molecules in the cluster. In some embodiments, the specific configuration of the specific thiophosphate bond and / or methanesulfonyl phosphate bond is present in at least 80% of the molecules in the cluster. In some embodiments, the specific configuration of the specific thiophosphate bond and / or methanesulfonyl phosphate bond is present in at least 90% of the molecules in the cluster. In some embodiments, the specific configuration of the specific thiophosphate bond and / or methanesulfonyl phosphate bond is present in at least 99% of the molecules in the cluster. Such chiral enriched groups of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in the following literature: Oka et al., JACS125, 8307 (2003), Wan et al., Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555. In some embodiments, the modified oligonucleotide groups are enriched with modified oligonucleotides having at least one of the (Sp)-configured thiophosphate and / or methanesulfonyl phosphate. In some embodiments, the modified oligonucleotide groups are enriched with at least one of the (Rp)-configured thiophosphate and / or methanesulfonyl phosphate. In some embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) thiophosphates each comprise one or more of the following formula, where “B” represents a nucleobase:

[0482]

[0483] Unless otherwise stated, the internucleotide bonds of the chiral centers of the modified oligonucleotides described herein may be stereorandom or have a specific stereochemical configuration.

[0484] Neutral nucleoside interbonds include, but are not limited to, triphosphates, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), methyl acetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thiomethyl acetal (3'-S-CH2-O-5'). Other neutral nucleoside interbonds include nonionic bonds, including siloxanes (dialkylsiloxanes), carboxylic esters, formamides, sulfides, sulfonates, and amides (see, for example: Carbohydrate Modifications in Antisense Research; YSSanghvi and PDCook, eds., ACS Symposium Series 580; Chapters 3 and 4, 40–65). Further neutral nucleoside interbonds include nonionic bonds, including mixed N, O, S, and CH2 components.

[0485] In some embodiments, the modified oligonucleotide comprises one or more reverse nucleosides, as shown below:

[0486]

[0487] Each Bx represents any nucleobase independently.

[0488] In some embodiments, the reverse nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), so there will be only one of the aforementioned internucleotide bonds. In some such embodiments, additional features (such as conjugation groups) may be attached to the reverse nucleoside. Such terminal reverse nucleosides may be attached to either end or both ends of the oligonucleotide.

[0489] In some embodiments, nucleic acids can be linked from 2' to 5' instead of the standard 3' to 5' linkage. This linkage is illustrated below.

[0490]

[0491] Each Bx represents any nucleobase.

[0492] B. certain motifs

[0493] In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleotide. In some embodiments, the modified oligonucleotide comprises one or more modified nucleotide interbonds. In such embodiments, the modified, unmodified, and differently modified sugar moiety, nucleotide, and / or nucleotide interbond of the modified oligonucleotide define a pattern or motif. In some embodiments, the patterns of the sugar moiety, nucleotide, and nucleotide interbond are each independent of each other. Therefore, the modified oligonucleotide can be described by its sugar motif, nucleotide motif, and / or nucleotide interbond motif (as used herein, the nucleotide motif describes modifications to the nucleotide sequence independent of the nucleotide sequence).

[0494] 1. certain glycosylations

[0495] In some embodiments, the oligonucleotide comprises one or more types of modified and / or unmodified sugar motifs arranged along the oligonucleotide or its regions in a defined pattern or glycomolecular motif. In some cases, such glycomolecular motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0496] In some embodiments, the modified oligonucleotide includes a deoxygenated region. In some embodiments, each nucleotide in the deoxygenated region is a 2'-β-D-deoxynucleotide. In some embodiments, the deoxygenated region consists of 5 to 12 linked nucleotides. In some embodiments, the deoxygenated region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleotides. In some embodiments, at least one nucleotide in the deoxygenated region contains a modified sugar moiety. In some embodiments, exactly one nucleotide in the deoxygenated region contains a modified sugar moiety. In some embodiments, two or three nucleotides in the deoxygenated region contain modified sugar moieties.

[0497] In some embodiments, the deoxygenated region is connected to a 5' region on the 5' side and to a 3' region on the 3' side, the 5' region consisting of connected 5' region nucleosides, and the 3' region consisting of connected 3' region nucleosides; wherein the 3'th terminal nucleoside of the 5' region is a modified nucleoside, and the 5'th terminal nucleoside of the 3' region is a modified nucleoside. At least one nucleoside in the 5' region contains a modified sugar moiety; and at least one nucleoside in the 3' region contains a modified sugar moiety. These three regions (5' region, deoxygenated region, and 3' region) form a continuous nucleoside sequence. In some embodiments, the sugar moiety of the 3'th terminal nucleoside in the 5' region and the sugar moiety of the 5'th terminal nucleoside in the 3' region are each different from the sugar moiety of the corresponding adjacent nucleoside in the deoxygenated region, thereby defining the boundary between the 5' region, the deoxygenated region, and the 3' region. In some embodiments, each nucleoside in the 5' region and each nucleoside in the 3' region contains a modified sugar moiety. In some embodiments, the nucleosides within the 5' region contain the same sugar modification. In some embodiments, the nucleoside in the 5' region contains two or more different sugar modifications. In some embodiments, the nucleoside in the 3' region contains the same sugar modification. In some embodiments, the nucleoside in the 3' region contains two or more different sugar modifications.

[0498] In some embodiments, the 5' and 3' regions of the modified oligonucleotide each contain 1 to 8 nucleosides. In some embodiments, the 5' region contains 1 to 7 nucleosides. In some embodiments, the 5' region contains 1 to 6 nucleosides. In some embodiments, the 5' region contains 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In some embodiments, the 3' region contains 1 to 7 nucleosides. In some embodiments, the 3' region contains 1 to 6 nucleosides. In some embodiments, the 3' region contains 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.

[0499] In some embodiments, the modified oligonucleotide comprises or consists of a region having a spacer motif, defined by two outer regions or "wings" and a central or inner region or "gap". The three regions of the spacer motif (5' wing, gap, and 3' wing) form a continuous nucleotide sequence, wherein at least some sugar moieties of the nucleotide in each wing differ from at least some sugar moieties of the nucleotide in the gap. Specifically, the sugar moieties of at least the nucleotide closest to the gap in each wing (the 3' end nucleotide of the 5' wing and the 5' end nucleotide of the 3' wing) differ from the sugar moieties of the adjacent gap nucleotide, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In some embodiments, the sugar moieties within the gap are identical to each other. In some embodiments, the gap contains one or more nucleotides having sugar moieties different from the sugar moieties of one or more other nucleotides in the gap. In some embodiments, the sugar motifs of the two wings are identical to each other (symmetric spacers). In some embodiments, the glycosylation of the 5' wing region is different from that of the 3' wing region (asymmetric spacer).

[0500] In some embodiments, the wings of the spacer contain 1 to 6 nucleosides. In some embodiments, each nucleoside of each wing of the spacer contains a modified sugar moiety. In some embodiments, at least one nucleoside of each wing of the spacer contains a modified sugar moiety. In some embodiments, at least two nucleosides of each wing of the spacer contain a modified sugar moiety. In some embodiments, at least three nucleosides of each wing of the spacer contain a modified sugar moiety. In some embodiments, at least four nucleosides of each wing of the spacer contain a modified sugar moiety.

[0501] In some embodiments, the gaps in the spacers contain 7 to 12 nucleotides. In some embodiments, each nucleotide in the gaps of the spacers contains a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, at least one nucleotide in the gaps of the spacers contains a modified sugar moiety.

[0502] In some embodiments, the spacer is a deoxygenated spacer. In some embodiments, the nucleoside on the gap side of each wing / gap connection comprises a 2'-deoxyribosyl sugar moiety, and the nucleoside on the wing side of each wing / gap connection comprises a modified sugar moiety. In some embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, each nucleoside of each wing of the spacer comprises a modified sugar moiety. In some embodiments, at least one nucleoside of the gap of the spacer comprises a modified sugar moiety. In some embodiments, one nucleoside of the gap comprises a modified sugar moiety, and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In some embodiments, at least one nucleoside of the gap of the spacer comprises a 2'-MOE sugar moiety.

[0503] In this paper, the lengths (number of nucleosides) of the three regions of the spacer can be provided using the notation [number of nucleosides in the 5' wing] – [number of nucleosides in the interstitial space] – [number of nucleosides in the 3' wing]. Therefore, the 3-10-3 spacer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the interstitial space. In the case of a specific modification following this nomenclature, the modification is in each sugar moiety of each wing, and the interstitial nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Therefore, the 5-10-5 MOE spacer consists of 5 linked 2'-MOE nucleosides in the 5' wing, 10 linked 2'-β-D-deoxynucleosides in the interstitial space, and 5 linked 2'-MOE nucleosides in the 3' wing. The 5-8-5 spacer consists of 5 linked nucleosides in the 5' wing containing a modified sugar moiety, 8 linked 2'-β-D-deoxynucleosides in the interstitial space, and 5 linked nucleosides in the 3' wing containing a modified sugar moiety. The 5-8-5 mixed spacer has at least two distinct modified sugar moieties in the 5' and / or 3' wings.

[0504] In some embodiments, the modified oligonucleotides disclosed herein are modified by specific sugar modifications. In some embodiments, the modified oligonucleotides are 5-10-5 MOE spacers.

[0505] In some embodiments, the modified oligonucleotides disclosed herein are modified by two or more sugar modifications. In some embodiments, the modified oligonucleotides are 5-10-5 mixed spacers, wherein each nucleoside within the 5' and 3' wings comprises a 2'-MOE sugar moiety, and each nucleoside within the spacer comprises a sugar moiety selected from 2'-β-D-deoxyxylose, 2'-α-L-deoxyribosylose, and 2'-β-D-deoxyribosylose. In some embodiments, the modified oligonucleotides are 5-10-5 mixed spacers, wherein each nucleoside within the 5' and 3' wings comprises a 2'-MOE sugar moiety, and each nucleoside within the spacer comprises a 2'-β-D-deoxyribosylose moiety.

[0506] In some embodiments, the modified oligonucleotide has a glycosyl sequence selected from 5' to 3': eeeeeddddddddddeeeee; wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.

[0507] In some embodiments, each nucleobase of the modified oligonucleotides disclosed herein is selected from A, G, C, T, U, and m C.

[0508] In some embodiments, each nucleobase of the modified oligonucleotides disclosed herein is selected from A, G, T, andm C (i.e., unmodified purines and 5-methylpyrimidine).

[0509] 2. certain nucleobase sequences

[0510] In some embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or its regions. In some embodiments, at least one nucleobase is modified. In some embodiments, each nucleobase is modified. In some embodiments, none of the nucleobases are modified. In some embodiments, each purine or each pyrimidine is modified. In some embodiments, each adenine is modified. In some embodiments, each guanine is modified. In some embodiments, each thymine is modified. In some embodiments, each cytosine is modified. In some embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In some embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all other nucleobases in the modified oligonucleotide are unmodified. In some embodiments, each nucleobase is independently selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and unmodified hypoxanthine.

[0511] In some embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In some such embodiments, the block is located at the 3' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 3' end of the oligonucleotide. In some embodiments, the block is located at the 5' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 5' end of the oligonucleotide.

[0512] In some embodiments, the oligonucleotide having a spacer motif comprises a nucleoside containing a modified nucleobase. In some such embodiments, a nucleoside containing a modified nucleobase is located in the central interstitial space of the oligonucleotide having the spacer motif. In some such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In some embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynylpyrimidine.

[0513] 3. certain nucleoside interbond motifs

[0514] In some embodiments, the oligonucleotide comprises modified and / or unmodified internucleotide bonds arranged in a defined pattern or motif along the oligonucleotide or its regions. In some embodiments, at least one internucleotide linking group is a phosphodiester internucleotide bond (P=O). In some embodiments, at least one internucleotide linking group of the modified oligonucleotide is a thiophosphate internucleotide bond (P=S). In some embodiments, at least one internucleotide linking group of the modified oligonucleotide is a methanesulfonyl phosphate internucleotide bond. In some embodiments, each internucleotide bond of the modified oligonucleotide is independently selected from thiophosphate internucleotide bonds, phosphodiester internucleotide bonds, and methanesulfonyl phosphate internucleotide bonds. In some embodiments, each internucleotide bond of the modified oligonucleotide is independently selected from thiophosphate internucleotide bonds and methanesulfonyl phosphate internucleotide bonds. In some embodiments, each thiophosphate internucleotide bond is independently selected from stereorandom thiophosphate, (Sp) thiophosphate, and (Rp) thiophosphate. In some embodiments, each methanesulfonyl phosphate nucleoside interbond is independently selected from stereorandom methanesulfonyl phosphate, (Sp) methanesulfonyl phosphate, and (Rp) methanesulfonyl phosphate.

[0515] In some embodiments, the glycosylation motif of the modified oligonucleotide is a spacer, and all internucleotide bonds within the spacer are modified. In some such embodiments, the glycosylation motif of the modified oligonucleotide is a spacer, and all internucleotide bonds within the spacer are modified, wherein at least one, at least two, at least three, or at least four internucleotide bonds within the spacer are methanesulfonyl phosphate bonds, and the remaining internucleotide bonds are thiophosphate bonds. In some such embodiments, one, two, three, four, or one to four internucleotide bonds within the spacer are methanesulfonyl phosphate bonds. In some such embodiments, some or all of the internucleotide bonds in the wing are unmodified phosphodiester bonds. In some embodiments, the terminal internucleotide bonds are modified. In some embodiments, the glycosylation motif of the modified oligonucleotide is a spacer, and the internucleotide motif contains at least one phosphodiester internucleotide bond in at least one wing, wherein the at least one phosphodiester bond is not a terminal internucleotide bond, and the remaining internucleotide bonds are thiophosphate internucleotide bonds and methanesulfonyl phosphate bonds. In some such embodiments, all thiophosphate internucleotide bonds and methanesulfonyl phosphate internucleotide bonds in the thiophosphate and methanesulfonyl phosphate internucleotide bonds are stereorandom. In some embodiments, all thiophosphate internucleotide bonds and methanesulfonyl phosphate internucleotide bonds in the wing are (Sp) thiophosphate, and the interstitial spacer contains at least one Sp, Sp, Rp motif. In some embodiments, the modified oligonucleotide cluster enrichment includes modified oligonucleotides containing such internucleotide motifs.

[0516] In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of soooossssszzszsooss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of soooossssszszsssooss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of soooosszsssszsssooss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of sooooszsssszzsssooss, wherein each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of soooosszzssszsssooss, wherein each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of soooosssszzzszsooss, wherein each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of soooossssszzzzssooss, wherein each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of soooosszssszzzzsssooss, wherein each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of sooooszssszzzzzzssooss, wherein each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond.In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of sssossssszzszsosss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of ssoossssszszszsosss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of ssooszsssszsssosss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of sssoszssszzsssss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of ssoosssszzzszsosss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of sssssssszzzzzzzsssss, where each "s" represents a thiophosphate nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of sssoszssszzsssss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of sssoszsszzzsssssss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified nucleotide has a nucleoside internucleotide motif of ssssszsszzzsssssss, where each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond.

[0517] In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide motif (5' to 3') selected from the following: soooosssssszzszsooss, soooosssssszssssooss, soooosszsssszssssooss, soooosszzssszssssooss, soooossssszzzszssooss, soooossssszzzzzsssooss, soooosszssszzzzzsssooss, soooosszssszzzssssooss, soooosssszzzssssss, sssosssss szzszsosss、ssoosssssszszszssss、ssooszsssszsssss、sssoszssszzssss、ssoossssszzzzssss、sssssssszzzzzsssss、sssoszssszzzssssss、sssoszsszzzsssssss、sssoszsszzzsssssss、ssssszsszzzssssss、ssssszsszzzssssss、ssssszsszzzssssss、ssssszsszzzssssss、where each “s” represents a thiophosphate nucleoside bond, each “o” represents a phosphodiester nucleoside bond, and each “z” represents a methanesulfonyl phosphate nucleoside bond. In some embodiments, the modified oligonucleotide comprises a nucleoside internucleotide motif (5' to 3') selected from the following: sssoszssszzssssss, ssoossssszzzzssss, ssssssssszzzzzzzsssss, sssoszsszzzssssss, sssoszsszzzssssssss and ssssszsszzzssssss, wherein each "s" represents a thiophosphate nucleoside internucleotide bond, each "o" represents a phosphodiester nucleoside internucleotide bond, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide bond. In some embodiments, the modified oligonucleotide contains a nucleoside internucleotide motif (5' to 3') of sssoszssszzssssosss, wherein each "s" represents a thiophosphate nucleoside internucleotide, each "o" represents a phosphodiester nucleoside internucleotide, and each "z" represents a methanesulfonyl phosphate nucleoside internucleotide.

[0518] C. certain length

[0519] The length of oligonucleotides can be increased or decreased without eliminating their activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), the ability of a series of oligonucleotides ranging from 13 to 25 nucleotides in length to induce target RNA cleavage in an oocyte injection model was tested. Oligonucleotides of 25 nucleotides in length with 8 or 11 mismatched bases near the end of the oligonucleotide were able to direct specific cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleotide oligonucleotides (including those with 1 or 3 mismatches).

[0520] In some embodiments, the oligonucleotide (including modified oligonucleotides) can have any length within a variety of length ranges. In some embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in that range and Y represents the maximum number of nucleosides in that range. In some such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X ≤ Y. For example, in some embodiments, the oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 Up to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-2918 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25 Composed of 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0521] In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 16 linked nucleosides. In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 17 linked nucleosides. In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 18 linked nucleosides. In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 19 linked nucleosides. In some embodiments, the oligonucleotide (including modified oligonucleotides) consists of 20 linked nucleosides.

[0522] D. Some modified oligonucleotides

[0523] In some embodiments, the above modifications (sugars, nucleotides, internucleotide bonds) are incorporated into the modified oligonucleotides. In some embodiments, the modified oligonucleotides are characterized by their modification motifs and total length. In some embodiments, these parameters are independent of each other. Therefore, unless otherwise stated, each internucleotide bond of an oligonucleotide having a spacer glycosyl motif may be modified or unmodified, and may or may not follow a sugar-modified spacer modification pattern. For example, internucleotide bonds within the wing regions of a sugar spacer may be the same or different from each other, and may be the same or different from the internucleotide bonds in the interstitial regions of the glycosyl motif. Similarly, such sugar-spacer oligonucleotides may contain one or more modified nucleotides independent of a sugar-modified spacer pattern. Unless otherwise stated, all modifications are independent of the nucleotide sequence.

[0524] E. Groups of certain modified oligonucleotides

[0525] A group of modified oligonucleotides (where all modified oligonucleotides in the group have the same molecular formula) can be a stereorandom group or a chiral enriched group. In a stereorandom group, all chiral centers of all oligonucleotides in the modified group are stereorandom. In a chiral enriched group, at least one specific chiral center in the modified oligonucleotides of the group is not stereorandom. In some embodiments, the modified oligonucleotides in the chiral enriched group are enriched for the β-D-ribosyl sugar moiety, and all thiophosphate nucleoside internucleotides are stereorandom. In some embodiments, the modified oligonucleotides in the chiral enriched group are enriched for both the β-D-ribosyl sugar moiety and at least one specific thiophosphate nucleoside internucleotide and / or a methanesulfonyl phosphate nucleoside internucleotide exhibiting a specific stereochemical configuration.

[0526] F. Nucleobase sequence

[0527] In some embodiments, the oligonucleotide (unmodified or modified) is further described by its nucleotide sequence. In some embodiments, the oligonucleotide (or a portion thereof) has a nucleotide sequence complementary to a second oligonucleotide or an identified reference nucleic acid (or a portion thereof) (such as a target nucleic acid). In some embodiments, a region or the full length of the oligonucleotide's nucleotide sequence is complementary to the second oligonucleotide or nucleic acid (or a portion thereof) by at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0528] II. Some oligomers

[0529] In some embodiments, this document provides oligomeric compounds comprising an oligonucleotide and optionally one or more conjugating groups and / or terminal groups. A conjugating group comprises one or more conjugated moieties and a conjugation linker connecting the conjugated moieties to the oligonucleotide. The conjugating group may be attached to either end or both ends of the oligonucleotide and / or attached at any internal location. In some embodiments, the conjugating group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In some embodiments, the conjugating group is attached to either end or both ends of the oligonucleotide (such conjugating groups are also terminal groups). In some such embodiments, the conjugating group or terminal group is attached to the 3' and / or 5' end of the oligonucleotide. In some such embodiments, the conjugating group (or terminal group) is attached to the 3' end of the oligonucleotide. In some embodiments, the conjugating group is attached near the 3' end of the oligonucleotide. In some embodiments, the conjugating group (or terminal group) is attached to the 5' end of the oligonucleotide.

[0530] Examples of terminal groups include, but are not limited to, conjugation groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

[0531] A. certain conjugate groups

[0532] In some embodiments, the oligonucleotide is covalently attached to one or more conjugation groups. In some embodiments, the conjugation groups alter one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0533] In some embodiments, the conjugation of one or more carbohydrate moieties to the modified oligonucleotide can alter one or more properties of the modified oligonucleotide. In some embodiments, the carbohydrate moieties are attached to the modified subunits of the modified oligonucleotide. For example, the ribose of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced by another moieties (e.g., a non-carbohydrate (preferably cyclic) carrier with a carbohydrate ligand attached). The ribonucleotide subunits in which the ribose has been so replaced are referred herein as ribose-substituted modified subunits (RRMS), which are the modified sugar moieties. The cyclic carrier can be a carbocyclic system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated cyclic system, or it can contain one or more double bonds. In some embodiments, the modified oligonucleotide is a spacer.

[0534] In some embodiments, the conjugation group imparts novel properties to the attached oligonucleotide, such as the ability to detect the oligonucleotide's fluorophore or reporter group. Certain conjugation groups and conjugation moieties have been previously described, such as: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), bile acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), and thioethers, such as hexyl-S-triphenylmethylthiol (Manoharan et al., Ann. NY). Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, such as di-hexadecyl-racemic-glycerol or triethylammonium 1,2-di-O-hexadecyl-racemic-glycerol-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973) or adamantane acetate palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholate moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740) or GalNAc cluster (e.g., WO2014 / 179620).

[0535] In some embodiments, the conjugate group may comprise a conjugate portion selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0536] In some embodiments, the conjugation group may comprise a conjugation moiety selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds. In some embodiments, the conjugation group is a lipid having the following structure:

[0537]

[0538] 1. Conjugate portion

[0539] The conjugated portion includes, but is not limited to, intercalating agents, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin portions, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0540] In some embodiments, the conjugate moiety comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprafen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, leucovorin, benzothiadiazide, chlorothiazide, diazoxide, etc. Diazepine, indomethacin, barbiturate, cephalosporin, sulfonamides, antidiabetic drugs, antibacterial drugs, or antibiotics.

[0541] In some embodiments, the conjugate portion is selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0542] In some embodiments, the conjugate portion is selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0543] 2. Conjugate joint

[0544] The conjugated moiety is attached to the oligonucleotide via a conjugation linker. In some oligomers, the conjugation linker is a single chemical bond (i.e., the conjugated moiety is directly attached to the oligonucleotide via a single bond). In some embodiments, the conjugation linker comprises an oligomer with a chain structure, such as a hydrocarbon chain, or a repeating unit, such as an ethylene glycol, nucleoside, or amino acid unit.

[0545] In some embodiments, the conjugate connector comprises pyrrolidine.

[0546] In some embodiments, the conjugation connector comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In some such embodiments, the conjugation connector comprises groups selected from alkyl, amino, oxo, amide, and ether groups. In some embodiments, the conjugation connector comprises groups selected from alkyl and amide groups. In some embodiments, the conjugation connector comprises groups selected from alkyl and ether groups. In some embodiments, the conjugation connector comprises at least one phosphorus moiety. In some embodiments, the conjugation connector comprises at least one phosphate group. In some embodiments, the conjugation connector comprises at least one neutral linker group.

[0547] In some embodiments, the conjugate linker (including the conjugate linker described above) is a bifunctional linker, for example, bifunctional linkers known in the art for attaching conjugate portions to compounds (such as the oligonucleotides provided herein). Generally, a bifunctional linker comprises at least two functional groups. One functional group is selected to bind to a specific site on the compound, while the other functional group is selected to bind to the conjugate group. Examples of functional groups used in bifunctional linkers include, but are not limited to, electrophilic reagents for reacting with nucleophilic groups and nucleophilic reagents for reacting with electrophilic groups. In some embodiments, the bifunctional linker comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.

[0548] Examples of conjugation linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid succinimide ester (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugation linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 alkenyl or substituted or unsubstituted C2-C 10 Alkynyl, wherein a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0549] In some embodiments, the conjugate linker comprises 1-10 linker nucleosides. In some embodiments, the conjugate linker comprises 2-5 linker nucleosides. In some embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In some embodiments, the conjugate linker comprises a TCA motif. In some embodiments, such linker nucleosides are modified nucleosides. In some embodiments, such linker nucleosides comprise a modified sugar moiety. In some embodiments, the linker nucleosides are unmodified. In some embodiments, the linker nucleosides comprise an optionally protected heterocyclic base selected from purines, substituted purines, pyrimidines, or substituted pyrimidines. In some embodiments, the cleavable portion is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, the linker nucleosides need to be cleaved from the oligomer after reaching the target tissue. Therefore, linker nucleosides are usually linked to each other via cleavable bonds and to the remainder of the oligomer. In some embodiments, such cleavable bonds are phosphodiester bonds.

[0550] In this document, linker nucleosides are not considered part of an oligonucleotide. Therefore, in embodiments where the oligomer compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percentage of complementarity with a reference nucleic acid, and where the oligomer compound also comprises a conjugate group containing a linker nucleoside (which contains a linker nucleoside), those linker nucleosides are not included in the length of the oligonucleotide and are not used to determine the percentage of complementarity between the oligonucleotide and the reference nucleic acid. For example, the oligomer compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides; and (2) a conjugate group comprising 1-10 linker nucleosides consecutive to the nucleoside of the modified oligonucleotide. The total number of consecutively linked nucleosides in such an oligomer compound exceeds 30. Alternatively, the oligomer compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and without a conjugate group. The total number of consecutively linked nucleosides in such an oligomer compound does not exceed 30. Unless otherwise stated, the linker nucleoside contains no more than 10 linker nucleosides. In some embodiments, the linker nucleoside contains no more than 5 linker nucleosides. In some embodiments, the conjugate linker contains no more than three linker nucleosides. In some embodiments, the conjugate linker contains no more than two linker nucleosides. In some embodiments, the conjugate linker contains no more than one linker nucleoside.

[0551] In some embodiments, it is necessary to cleave the conjugated group from the oligonucleotide. For example, in certain cases, oligomeric compounds containing a specific conjugated moiety are better absorbed by a particular cell type, but once the oligomeric compound has been absorbed, it is necessary to cleave the conjugated group to release the unconjugated or parental oligonucleotide. Therefore, some conjugated linkers may contain one or more cleavable moieties. In some embodiments, the cleavable moieties are cleavable bonds. In some embodiments, the cleavable moieties are atomic groups containing at least one cleavable bond. In some embodiments, the cleavable moieties contain atomic groups having one, two, three, four, or more than four cleavable bonds. In some embodiments, the cleavable moieties are selectively cleaved within a cell or subcellular compartment (such as a lysosome). In some embodiments, the cleavable moieties are selectively cleaved by endogenous enzymes (such as nucleases).

[0552] In some embodiments, the cleavable bond is selected from one or two esters of amides, esters, ethers, phosphate diesters, phosphate esters, carbamates, or disulfides. In some embodiments, the cleavable bond is one or two esters of phosphate diesters. In some embodiments, the cleavable portion comprises a phosphate ester or a phosphate diester. In some embodiments, the cleavable portion is a phosphate bond between an oligonucleotide and a conjugate portion or conjugate group.

[0553] In some embodiments, the cleavable portion comprises or is composed of one or more linker nucleosides. In some such embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via cleavable bonds. In some embodiments, such cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2'-deoxynucleoside attached to the 3' or 5'-terminal nucleoside of the oligonucleotide via a phosphate-nucleoside internucleotide bond and covalently attached to the conjugate linker or the remainder of the conjugate portion via a phosphate ester or thiophosphate bond. In some such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0554] 3. Cell-targeting component

[0555] In some embodiments, the conjugation group comprises a cell-targeting moiety. In some embodiments, the conjugation group has the general formula:

[0556]

[0557] Where n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

[0558] In some embodiments, n is 1, j is 1, and k is 0. In some embodiments, n is 1, j is 0, and k is 1. In some embodiments, n is 1, j is 1, and k is 1. In some embodiments, n is 2, j is 1, and k is 0. In some embodiments, n is 2, j is 0, and k is 1. In some embodiments, n is 2, j is 1, and k is 1. In some embodiments, n is 3, j is 1, and k is 0. In some embodiments, n is 3, j is 0, and k is 1. In some embodiments, n is 3, j is 1, and k is 1.

[0559] In some embodiments, the cell-targeting portion targets neurons. In some embodiments, the cell-targeting portion targets neurotransmitter receptors. In some embodiments, the cell-targeting portion targets neurotransmitter transporters. In some embodiments, the cell-targeting portion targets GABA transporters. See, for example, WO 2011 / 131693, WO 2014 / 064257.

[0560] In some embodiments, the conjugation group comprises a cell-targeting moiety having affinity for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In some embodiments, the conjugation group described herein comprises an anti-TfR1 antibody or a fragment thereof. In some embodiments, the conjugation group comprises a protein or peptide capable of binding to TfR1. In some embodiments, the conjugation group comprises an aptamer capable of binding to TfR1. In some embodiments, the anti-TfR1 antibody or a fragment thereof may be any antibody or fragment thereof known in the art, including but not limited to antibodies or fragments thereof described in the following documents: WO 1991 / 004753; WO 2013 / 103800; WO 2014 / 144060; WO 2016 / 081643; WO 2016 / 179257; WO2016 / 207240; WO 2017 / 221883; WO 2018 / 129384; WO 2018 / 124121; WO 2019 / 151539; WO2020 / 132584; WO 2020 / 028864; US 7,208,174; US 9,034,329; and US10,550,188. In some embodiments, the fragment of the anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.

[0561] In some embodiments, the conjugation group comprises a protein or peptide capable of binding TfR1. In some embodiments, the protein or peptide capable of binding TfR1 can be any protein or peptide known in the art, including but not limited to proteins or peptides described in the following documents: WO 2019 / 140050; WO 2020 / 037150; WO 2020 / 124032; and US10,138,483.

[0562] In some embodiments, the conjugation group comprises an aptamer capable of binding TfR1. In some embodiments, the aptamer capable of binding TfR1 can be any aptamer known in the art, including but not limited to the aptamers described in the following documents: WO2013 / 163303; WO 2019 / 033051; and WO 2020 / 245198.

[0563] B. certain terminal groups

[0564] In some embodiments, the oligomeric compound comprises one or more terminal groups. In some such embodiments, the oligomeric compound comprises a stable 5'-phosphate ester. Stable 5'-phosphate esters include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonates. In some embodiments, the terminal group comprises one or more debased sugar moieties and / or reverse nucleosides. In some embodiments, the terminal group comprises a reverse debased sugar moiety. In some embodiments, the reverse debased sugar moiety may be further attached to a conjugation group. In some embodiments, the terminal group comprises one or more 2'-linked nucleoside or sugar moieties. In some such embodiments, the 2'-linked group is a debased sugar moiety. Such terminal debased sugar moieties may be attached to either end or both ends of the oligonucleotide.

[0565] III. antisense activity

[0566] In some embodiments, the oligomers and oligoduplexes are capable of hybridizing with target nucleic acids to produce at least one antisense activity; such oligomers and oligoduplexes are antisense compounds. In some embodiments, antisense compounds are antisense compounds when they reduce or inhibit the amount or activity of target nucleic acids by 25% or more in an in vivo assay using standards. In some embodiments, antisense compounds selectively affect one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes with one or more target nucleic acids to produce one or more desired antisense activities and does not hybridize with one or more non-target nucleic acids, or does not hybridize with one or more non-target nucleic acids in a manner that produces a large amount of unwanted antisense activity.

[0567] In some antisense activities, hybridization of the antisense compound with the target nucleic acid induces the recruitment of proteins that cleave the target nucleic acid. For example, some antisense compounds induce RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not need to be unmodified DNA. In some embodiments, antisense compounds sufficiently “DNA-like” to elicit RNase H activity are described herein. In some embodiments, one or more non-DNA-like nucleotides in the spacer space are tolerant.

[0568] In some antisense activities, an antisense compound, or a portion thereof, is loaded into the RNA-induced silencing complex (RISC), ultimately causing cleavage of the target nucleic acid. For example, some antisense compounds cause the target nucleic acid to be cleaved by the AGO protein (Argonaute). The antisense compound loaded into the RISC is an RNAi compound. RNAi compounds can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0569] In some embodiments, hybridization of the antisense compound with the target nucleic acid does not induce the recruitment of proteins that cleave the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid causes alterations in the splicing of the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid causes inhibition of binding interactions between the target nucleic acid and proteins or other nucleic acids. In some embodiments, hybridization of the antisense compound with the target nucleic acid causes alterations in the translation of the target nucleic acid.

[0570] Antisense activity can be observed directly or indirectly. In some embodiments, the observation or detection of antisense activity involves the observation or detection of changes in the amount of the target nucleic acid or the protein encoded by such target nucleic acid, changes in the ratio of splice variants of the nucleic acid or protein, and / or phenotypic changes in cells or animals.

[0571] IV. certain target nucleic acids

[0572] In some embodiments, the oligomeric compound comprises or is composed of oligonucleotides containing a region complementary to the target nucleic acid. In some embodiments, the target nucleic acid is an endogenous RNA molecule. In some embodiments, the target nucleic acid encodes a protein. In some such embodiments, the target nucleic acid is selected from mature mRNA and precursor mRNA, including intronic regions, exonic regions, and untranslated regions. In some embodiments, the target RNA is mature mRNA. In some embodiments, the target nucleic acid is premRNA. In some embodiments, the target region is entirely within an intron. In some embodiments, the target region spans an intron / exon junction. In some embodiments, at least 50% of the target region is within an intron. In some embodiments, the target nucleic acid is non-coding RNA. In some embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.

[0573] A. Complementarity / mismatch with target nucleic acids and duplex complementarity

[0574] In some embodiments, the oligonucleotide is complementary to the target nucleic acid along its entire length. In some embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In some embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid along its entire length and includes a region that is 100% or completely complementary to the target nucleic acid. In some embodiments, the length of the completely complementary region is 6 to 20, 10 to 18, or 18 to 20 nucleotides.

[0575] Mismatched bases can be introduced without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of oligonucleotides with 100% complementarity to bcl-2 mRNA and with three mismatches to bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, these oligonucleotides exhibited potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleotide oligonucleotides, as well as 28-nucleotide and 42-nucleotide oligonucleotides consisting of sequences of two or three tandem oligonucleotides, respectively, to inhibit the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14-nucleotide oligonucleotides can individually inhibit translation, although at a milder level than those of 28 or 42-nucleotide oligonucleotides.

[0576] In some embodiments, the oligonucleotide contains one or more mismatched nucleobases relative to the target nucleic acid. In some embodiments, antisense activity against the target is reduced due to this mismatch, but activity against non-target nucleic acids is reduced even more. Therefore, in some embodiments, the selectivity of the oligonucleotide is improved.

[0577] In some embodiments, the mismatch is specifically located within an oligonucleotide having a spacer motif. In some embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, or 8 at the 5' end of the interstitial region. In some embodiments, the mismatch is located at position 9, 8, 7, 6, 5, 4, 3, 2, or 1 at the 3' end of the interstitial region. In some embodiments, the mismatch is located at position 1, 2, 3, or 4 at the 5' end of the wing region. In some embodiments, the mismatch is located at position 4, 3, 2, or 1 at the 3' end of the wing region.

[0578] B. APP

[0579] In some embodiments, the oligomeric compound comprises or consists of an oligonucleotide containing a region complementary to a target nucleic acid, wherein the target nucleic acid is APP. In some embodiments, the APP nucleic acid has the sequence shown in SEQ ID NO:1 (cDNA of Ensembl transcript ENST00000346798.7, from 94th edition: October 2018) or the complementary sequence of SEQ ID NO:2 (GENBANK accession number NC_000021.9, truncated from nucleotides 25878001 to 26174000). In some embodiments, the APP nucleic acid has a sequence shown in any splice variant of the known splice variants of APP, including but not limited to SEQ ID NO:3 (cDNA of Ensembl transcript ENST00000357903.7, from version 94: October 2018), SEQ ID NO:4 (cDNA of Ensembl transcript ENST00000348990.9, from version 94: October 2018), SEQ ID NO:5 (cDNA of Ensembl transcript ENST00000440126.7, from version 94: October 2018), SEQ ID NO:6 (cDNA of Ensembl transcript ENST00000354192.7, from version 94: October 2018), SEQ ID NO:7 (cDNA of Ensembl transcript ENST00000358918.7, from 94th edition: October 2018) and / or SEQ ID NO:8 (GENBANK accession number NM_201414.2). In some embodiments, contacting cells with oligomeric compounds complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 as described herein reduces the amount of APP RNA and, in some embodiments, reduces the amount of APP protein. In some embodiments, the oligomeric compounds consist of modified oligonucleotides. In some embodiments, contacting cells with oligomeric compounds complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 as described herein results in a reduction in β-amyloid aggregation. In some embodiments, the oligomeric compound consists of modified oligonucleotides. In some embodiments, the oligomeric compound consists of modified oligonucleotides and conjugation groups.

[0580] In some embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2, as described herein, reduces the amount of APP RNA in the cells. In some embodiments, contacting cells with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2, as described herein, reduces the amount of APP protein in the cells. In some embodiments, the cells are in vitro. In some embodiments, contacting a subject's cells with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2, as described herein, improves one or more symptoms or markers of an APP-related disease or condition. In some embodiments, an APP-related disease or condition is any of the following: sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, and cerebral amyloid angiopathy. In some embodiments, a symptom or marker is any of the following: cognitive impairment (including memory and language skill decline), behavioral and psychological symptoms (such as emotional apathy and lack of motivation), gait disturbance, seizures, progressive dementia, and / or abnormal amyloid deposition.

[0581] In some embodiments, in standard in vivo assays, the oligomeric compounds described herein complementary to SEQ ID NO:1 or SEQ ID NO:2 are capable of reducing the detectable amount of APP RNA by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In some embodiments, the oligomeric compounds described herein complementary to SEQ ID NO:1 or SEQ ID NO:2 are capable of reducing the detectable amount of APP protein by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In some embodiments, the oligomeric compounds described herein complementary to SEQ ID NO:1 or SEQ ID NO:2 are capable of reducing the detectable amount of APP RNA in a subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compounds described herein that are complementary to SEQ ID NO:1 or SEQ ID NO:2 are capable of reducing the detectable amount of APP protein in the subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0582] C. Certain target nucleic acids in certain tissues

[0583] In some embodiments, the oligomeric compound comprises or is composed of oligonucleotides containing a region complementary to a target nucleic acid expressed in pharmacology-associated tissues. In some embodiments, pharmacology-associated cells are APP-expressing cells. In some embodiments, pharmacology-associated tissues are cells and tissues constituting the central nervous system. Such tissues include the cortex and hippocampus. Such cells include cortical brain cells and hippocampal cells. In some embodiments, such cells include cells within the limbic system, such as cells within the hippocampus, amygdala, and / or parahippocampal gyrus.

[0584] V. Some methods and uses

[0585] Some embodiments provided herein relate to methods for reducing or inhibiting APP expression or activity, which can be used to treat, prevent, or improve diseases or conditions associated with APP overexpression in a subject by administering oligomers, oligomeric compounds, oligoduplexes, or antisense agents (any of which comprises a modified oligonucleotide having a nucleobase sequence complementary to the APP nucleic acid). In some embodiments, the APP-related disease or condition is a neurodegenerative disease or condition. In some embodiments, the neurodegenerative disease or condition is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy.

[0586] In some embodiments, the method includes administering to the subject an oligomer, an oligomeric compound, an oligomeric duplex, or an antisense agent (any of which has a nucleobase sequence complementary to the APP nucleic acid). In some embodiments, the subject has or is at risk of developing sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in individuals with Down syndrome, or cerebral amyloid angiopathy.

[0587] In some embodiments, a method of treating APP-related neurodegenerative diseases or conditions includes administering a therapeutically effective amount of an oligomer, oligomeric compound, oligomeric duplex, or antisense agent (any of which has a nucleobase sequence complementary to APP) to a subject, thereby treating the subject. In some embodiments, the subject has or is at risk of developing an APP-related neurodegenerative disease or condition. In some embodiments, the disease or condition is associated with elevated levels of APP in the subject.

[0588] In some embodiments, the subject has or is at risk of developing sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy. In some embodiments, at least one symptom or marker of the neurodegenerative disease or condition associated with the app is improved. Exemplary symptoms or markers include, but are not limited to, cognitive impairment (including memory and language skill decline), behavioral and psychological symptoms (such as emotional apathy and lack of motivation), gait disturbances and seizures, progressive dementia, and abnormal amyloid deposition.

[0589] In some embodiments, methods for reducing APP nucleic acid (e.g., RNA) expression or reducing APP protein expression in cells include administering to a subject an oligomer, oligomeric compound, oligomeric duplex, or antisense agent (any of which has a nucleobase sequence complementary to APP) to inhibit APP nucleic acid expression in the subject. In some embodiments, administering an oligomer, oligomeric compound, oligomeric duplex, or antisense agent inhibits APP expression in the brain or spinal cord of a subject. In some embodiments, the subject has an APP-related neurological disorder or condition. In some embodiments, the subject has or is at risk of developing sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, and / or cerebral amyloid angiopathy.

[0590] In some embodiments, methods for inhibiting the expression of APP nucleic acid in cells include contacting the cells with an oligomer, oligomeric compound, oligomeric duplex, or antisense agent (any of which has a nucleobase sequence complementary to APP) to inhibit the expression of APP nucleic acid in the cells. In some embodiments, the cells are human cells. In some embodiments, the cells are brain cells. In some embodiments, the cells are cortical brain cells or hippocampal cells. In some embodiments, the cells are obtained from a subject, for example, a subject who has or is at risk of developing an APP-related disease or condition. In some embodiments, the cells are present in a subject who has an APP-related disease or condition (such as sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy).

[0591] Some embodiments involve oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents (any of which have a nucleobase sequence complementary to the APP nucleic acid) for the treatment of diseases or conditions associated with elevated APP signaling or overexpression of APP. In some embodiments, the disease or condition is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy. In some embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents are used to improve symptoms or markers of diseases or conditions associated with sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy. In some embodiments, symptoms or markers are selected from cognitive impairment (including memory and language skill decline), behavioral and psychological symptoms (such as emotional blunting and lack of motivation), gait disturbances, seizures, progressive dementia, and abnormal amyloid deposition. In some embodiments, oligomers, oligomeric compounds, modified oligonucleotides, oligoduplexes, or antisense agents are used to reduce APP expression in subjects.

[0592] Some embodiments involve oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents (any of which comprises a modified oligonucleotide having a nucleobase sequence complementary to the APP nucleic acid) for manufacturing or preparing a medicament for treating APP-related diseases. In some embodiments, the disease or condition is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy. In some embodiments, oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents are used to manufacture or prepare a medicament for improving symptoms or markers associated with APP. In some embodiments, symptoms or markers are selected from seizures, cognitive impairment (including memory and language skill decline), behavioral and psychological symptoms (such as emotional blunting and lack of motivation), gait disturbances, seizures, progressive dementia, and abnormal amyloid deposition. In some embodiments, oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents are used to manufacture or prepare a medicament for reducing APP expression in subjects.

[0593] In any of the methods or uses described herein, the oligomeric compound, oligodichain, or antisense agent can be any oligomeric compound, oligodichain, or antisense agent described herein.

[0594] VI. Certain pharmaceutical compositions

[0595] In some embodiments, this document describes pharmaceutical compositions comprising one or more oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents. In some embodiments, each of the one or more oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents comprises a modified oligonucleotide. In some embodiments, each of the one or more oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents is composed of a modified oligonucleotide. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent. In some embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compounds, oligomeric duplexes, or antisense agents, or is composed of a sterile saline solution and one or more oligomeric compounds, oligomeric duplexes, or antisense agents. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises one or more oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents and sterile water, or is composed of one or more oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents and sterile water. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises one or more oligomers, oligomeric compounds, oligomeric duplexes or antisense agents, and phosphate-buffered saline (PBS), or is composed of one or more oligomers, oligomeric compounds, oligomeric duplexes or antisense agents, and phosphate-buffered saline. In some embodiments, the sterile PBS is pharmaceutical-grade PBS. In some embodiments, the pharmaceutical composition comprises one or more oligomers, oligomeric compounds, oligomeric duplexes or antisense agents, and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”), or is composed of one or more oligomers, oligomeric compounds, oligomeric duplexes or antisense agents, and artificial cerebrospinal fluid. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade artificial cerebrospinal fluid.

[0596] In some embodiments, the pharmaceutical composition comprises an oligomeric compound and PBS. In some embodiments, the pharmaceutical composition consists of an oligomeric compound and PBS. In some embodiments, the pharmaceutical composition consists essentially of an oligomeric compound and PBS. In some embodiments, the PBS is pharmaceutical grade. In some embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In some embodiments, the pharmaceutical composition consists of a modified oligonucleotide and PBS. In some embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and PBS. In some embodiments, the PBS is pharmaceutical grade.

[0597] In some embodiments, the pharmaceutical composition comprises an oligomeric compound and artificial cerebrospinal fluid (aCSF). In some embodiments, the pharmaceutical composition consists of an oligomeric compound and aCSF. In some embodiments, the pharmaceutical composition consists essentially of an oligomeric compound and aCSF. In some embodiments, the aCSF is pharmaceutical grade. In some embodiments, the pharmaceutical composition comprises a modified oligonucleotide and aCSF. In some embodiments, the pharmaceutical composition consists of a modified oligonucleotide and aCSF. In some embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and aCSF. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In some embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, anhydrous disodium hydrogen phosphate, calcium chloride dihydrate, and magnesium chloride hexahydrate. The pH of the aCSF solution is adjusted to a range of about 7.1 to 7.3 or to about 7.2 using a suitable pH adjuster (e.g., an acid, such as hydrochloric acid, and a base, such as sodium hydroxide).

[0598] In some embodiments, the pharmaceutical composition comprises one or more oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents and one or more excipients. In some embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0599] In some embodiments, oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents may be mixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. The composition and formulation of pharmaceutical compositions depend on many criteria, including but not limited to route of administration, disease severity, or dosage.

[0600] In some embodiments, pharmaceutical compositions comprising oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents encompass any pharmaceutically acceptable salt, ester, or salt of such esters of oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents. In some embodiments, pharmaceutical compositions comprising oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents containing one or more modified oligonucleotides are capable of providing (directly or indirectly) their biologically active metabolites or residues when administered to a subject (including a human). Therefore, for example, this disclosure also relates to pharmaceutically acceptable salts of oligomers, oligomeric compounds, oligomeric duplexes, or antisense agents, their prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In some embodiments, a prodrug comprises one or more conjugate groups attached to an oligonucleotide, wherein such conjugate groups are cleaved by endogenous nucleases in vivo.

[0601] In some embodiments, the oligomer, oligomeric compound, oligodichain, or antisense agent is lyophilized and isolated as a sodium salt. In some embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In some embodiments, the pharmaceutically acceptable diluent includes sterile saline, sterile water, PBS, or aCSF. In some embodiments, the sodium salt of the oligomer, oligomeric compound, oligodichain, or antisense agent is mixed with PBS. In some embodiments, the sodium salt of the oligomer, oligomeric compound, oligodichain, or antisense agent is mixed with aCSF. In some embodiments, the sodium salt of the oligomeric compound, oligodichain, or antisense agent is a sodium salt of a modified oligonucleotide.

[0602] Lipid moieties have been used in nucleic acid therapy in various ways. In some of these methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In some methods, DNA complexes with mono- or poly-cationic lipids are formed in the absence of neutral lipids. In some embodiments, lipid moieties are selected to increase the distribution of agents to specific cells or tissues. In some embodiments, lipid moieties are selected to increase the distribution of agents to adipose tissue. In some embodiments, lipid moieties are selected to increase the distribution of agents to muscle tissue.

[0603] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those comprising hydrophobic compounds. In some embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0604] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more of the agents disclosed herein to a specific tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0605] In some embodiments, the pharmaceutical composition comprises a cosolvent system. Some of these cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which comprises 3% w / v benzyl alcohol and 8% w / v polysorbate, a nonpolar surfactant. TM And an absolute ethanol solution of 65% w / v polyethylene glycol 300. The proportions of such co-solvent systems can vary considerably without significantly altering their solubility and toxicity properties. Furthermore, the properties of the co-solvent components may differ: for example, other surfactants may be used instead of polysorbate 80.TM The fractional size of polyethylene glycol may vary; other biocompatible polymers can replace polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides can replace glucose.

[0606] In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.). In some such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks' solution, Ringer's solution, or physiological saline buffer. In some embodiments, other components are included (e.g., components that contribute to solubility or act as preservatives). In some embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Some injectable pharmaceutical compositions are present in a single dosage form, such as an ampoule or a multi-dose container. Some injectable pharmaceutical compositions are oily or aqueous media containing suspensions, solutions, or emulsions, and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.

[0607] Under certain conditions, some of the compounds disclosed herein act as acids. Although such compounds can be drawn or described as protonated (free acid) or ionized and associated with cations (salts), aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate ester bonds of oligonucleotides in aqueous solutions exist in equilibrium between free acid, anionic, and salt forms. Unless otherwise stated, the compounds described herein are intended to include all such forms. Furthermore, some oligonucleotides have multiple such bonds, each in equilibrium. Thus, oligonucleotides in solution exist in multiple forms at multiple locations, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The drawn structures necessarily depict a single form. However, unless otherwise stated, such figures are also intended to include corresponding forms. In this document, the depiction of the structure of a compound as a free acid and the subsequent term "or its salt" explicitly include all such forms that can be fully or partially protonated / deprotonated / associated with cations. In some cases, one or more specific cations are identified.

[0608] In some embodiments, the modified oligonucleotide or oligomer is present in an aqueous solution with sodium. In some embodiments, the modified oligonucleotide or oligomer is present in an aqueous solution with potassium. In some embodiments, the modified oligonucleotide or oligomer is in PBS. In some embodiments, the modified oligonucleotide or oligomer is in water. In some such embodiments, the pH of the solution is adjusted to a desired pH using NaOH and / or HCl.

[0609] This article describes certain specific dosages. Dosages may be expressed in units of dosage. For clarity, the dosage (or units of dosage) of a modified oligonucleotide or oligomer in milligrams represents the mass of the free acid form of the modified oligonucleotide or oligomer. As mentioned above, in aqueous solution, the free acid is in equilibrium with its anionic and salt forms. However, for the purpose of dosage calculation, it is assumed that the modified oligonucleotide or oligomer exists as a solvent-free, sodium acetate-free, anhydrous, free acid.

[0610] For example, when a modified oligonucleotide or oligomer is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomer may be partially or completely deprotonated and associated with sodium ions. However, the mass of the protons is still included in the weight of the dose, and the mass of the sodium ions is not included in the weight of the dose. Thus, for example, the dose or dose unit of 10 mg of a number of fully protonated molecules is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.57 mg of solvent-free, sodium acetate-free, anhydrous sodium-containing compound No. 1620705. When the oligomer contains a conjugate group, the mass of that conjugate group is included in the calculation of the dose of such oligomer. If the conjugate group also has an acid, it is also assumed that the conjugate group is fully protonated for the purpose of calculating the dose.

[0611] In some embodiments, when the modified oligonucleotide or oligomer is in a solution containing sodium, potassium, calcium, and magnesium (such as aCSF), the modified oligonucleotide or oligomer may be partially or completely deprotonated and associated with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is still included in the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not included in the weight of the dose.

[0612] In some embodiments, when the oligomer compound contains a conjugating group, the mass of that conjugating group may be included in the dosage calculation of such oligomer compound. If the conjugating group also has an acid, it is also assumed that the conjugating group is fully protonated for dosage calculation purposes.

[0613] VII. Certain comparative compositions

[0614] Compound 1353884 is a comparative compound and was previously described in WO 2022 / 026589. Compound 1353884 consists of the following sequence (from 5' to 3'): GTTTACCTTTAACATTCCTC, designated herein as SEQ ID NO:15. The glycosylation motif for compound 1353884 is (from 5' to 3'): eeeeddddddddddeeeee; where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the ribose-2'-MOE sugar moiety. The internucleotide motif for compound 1353884 is (from 5' to 3'): sooosssssssssssooss; where each "s" represents the thiophosphate internucleotide bond and each "o" represents the phosphodiester internucleotide bond. Each cytosine nucleobase in compound No. 1353884 is 5-methylcytosine.

[0615] Compound 1398227 is a comparative compound and was previously described in WO 2022 / 026589. Compound 1398227 consists of the following sequence (from 5' to 3'): CTCCAATTTTAACTTGCACC, designated herein as SEQ ID NO:18. The glycosylation motif for compound 1398227 is (from 5' to 3'): eeeeddddddddddeeeee; where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the ribose-2'-MOE sugar moiety. The internucleotide motif for compound 1398227 is (from 5' to 3'): sooosssssssssssooss; where each "s" represents the thiophosphate internucleotide bond and each "o" represents the phosphodiester internucleotide bond. Each cytosine nucleobase in compound No. 1398227 is 5-methylcytosine.

[0616] In some embodiments, the compounds described herein are superior to those described in WO 2022 / 026589 because the compounds described herein exhibit one or more improved properties, such as duration of action and potency.

[0617] For example, in the assays shown in Example 7, compound 1620705 exhibited a longer duration of action in vivo compared to compounds 1353884 and 1398227. Specifically, at day 112 (16 weeks) post-administration, compound 1620705 achieved an 88% reduction in cortical human APP RNA, while compound 1353884 achieved a 54% reduction, and compound 1393227 achieved a 32% reduction. Further, at day 140 (20 weeks) post-administration, compound 1620705 achieved a 60% reduction in cortical human APP RNA, while compound 1353884 achieved a 43% reduction, and compound 1393227 achieved a 37% reduction. Therefore, compound 1620705 exhibits a longer duration of action compared to compounds 1353884 and 1393227.

[0618] Furthermore, in the assays shown in Example 4, compound 1620705 exhibited greater potency in vivo compared to compounds 1353884 and 1398227. Specifically, in transgenic mice expressing the full-length human APP gene (APP YAC transgenic mice), the half-maximum effective dose (ED50) of compound 1620705 was measured in the spinal cord, cortex, and hippocampus of APP YAC transgenic mice 4 weeks after administration. 50 The effective doses were 48 μg, 57 μg, and 62 μg, respectively. In contrast, at 4 weeks post-administration, the ED50 of compound 1353884, measured in the spinal cord, cortex, and hippocampus of APP YAC transgenic mice, was significantly lower. 50 The doses were 95 μg, 116 μg, and 76 μg, respectively, and the ED50 of compound No. 1398227 was measured in the spinal cord, cortex, and hippocampus of APP YAC transgenic mice 4 weeks after administration. 50 The concentrations were 72 μg, 190 μg, and 120 μg, respectively. Further, as shown in Examples 5 and 6, the ED50 of compound 1620705 was measured in the spinal cord, cortex, and hippocampus of APP YAC transgenic mice 12 weeks after administration. 50 The concentrations were 89 μg, 57 μg, and 71 μg, respectively. At 12 weeks post-administration, the ED50 of compound 1398227 was measured in the spinal cord, cortex, and hippocampus of APP YAC transgenic mice. 50 The values ​​were 157 μg, 206 μg, and 210 μg, respectively. Therefore, in these assays, compound 1620705 showed enhanced potency compared to compounds 1353884 and 1393227.

[0619] Unrestricted disclosure and incorporation by reference

[0620] Each document and patent publication listed in this article is incorporated in its entirety by reference.

[0621] While certain compounds, compositions, and methods described herein have been specifically described with reference to certain embodiments, the following examples are for illustrative purposes only and are not intended to limit the scope of the compounds described herein. Every reference, GenBank accession number, ENSEMBL identifier, etc., cited in this application is incorporated herein by reference in its entirety.

[0622] The sequence listing accompanying this application identifies each nucleic acid sequence as “RNA” or “DNA” as needed; however, those skilled in the art will readily understand that the naming of “RNA” or “DNA” to describe modified oligonucleotides is arbitrary in some cases. For example, an oligonucleotide containing a nucleoside comprising a 2'-OH sugar moiety and a thymine base may be described as DNA having a modified sugar (2'-OH replacing a 2'-H in DNA) or as RNA having a modified base (thymine (5-methyluracil) replacing uracil in RNA); and certain nucleic acid compounds described herein contain one or more nucleosides comprising a modified sugar moiety having a 2'-substituent that is neither OH nor H. Those skilled in the art will readily understand that labeling such nucleic acid compounds as “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds.

[0623] In this document, the description of compounds having the nucleobase sequence of SEQ ID NO “ ” describes only the nucleobase sequence. Therefore, unless otherwise described, such description of compounds by reference to the nucleobase sequence of SEQ ID NO does not limit the presence or absence of sugar or nucleoside inter-bond modifications or additional substituents (such as conjugation groups). Furthermore, unless otherwise described, the nucleobases of compounds having the nucleobase sequence of SEQ ID NO “ ” include modified forms of such compounds having the nucleobases identified as described herein.

[0624] In this document, unless otherwise stated, the description of compounds by chemical symbols (subscripts and / or superscripts indicating chemical modifications) does not involve specific compound numbers, but only includes each indicated modification, but may include additional substituents, such as conjugated groups. For example, the chemical symbol "A es T ko m C ez G ds C dThe compound is defined as follows: the first nucleoside comprises a 2'-MOE sugar moiety (indicated by the subscript "e") and an unmodified adenine nucleobase linked to the second nucleoside via a thiophosphate bond (indicated by the subscript "s"); the second nucleoside comprises a cEt sugar moiety (indicated by the subscript "k") and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester bond (indicated by the subscript "o"); the third nucleoside comprises a 2'-MOE sugar moiety and an unmodified thymine nucleobase linked to the third nucleoside via a methanesulfonylaminophosphate bond. (Indicated by the subscript "z") a 5-methyl modified cytosine nucleobase (indicated by the superscript "m") linked to the fourth nucleoside; the fourth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety (indicated by the subscript "d") and an unmodified guanine nucleobase linked to the fifth nucleoside by a thiophosphate bond; and the fifth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound may contain additional substituents, such as conjugation groups.

[0625] In this document, when a specific compound is described by chemical symbols (as in the examples) (e.g., referring to compound numbers), each nucleobase, sugar, and nucleotide bond of such a specific compound is modified only as indicated. Therefore, in the context of a description of a specific compound with a specific compound number, “A” es T ko m C ez G ds C d The compound is defined as follows: the first nucleoside comprises a 2'-MOE sugar moiety (indicated by the subscript "e") and an unmodified adenine nucleobase linked to the second nucleoside via a thiophosphate bond (indicated by the subscript "s"); the second nucleoside comprises a cEt sugar moiety (indicated by the subscript "k") and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester bond (indicated by the subscript "o"); the third nucleoside comprises a 2'-MOE sugar moiety and an unmodified thymine nucleobase linked to the third nucleoside via a methanesulfonylamino bond. A phosphate ester bond (indicated by the subscript "z") is linked to a 5-methyl modified cytosine nucleobase (indicated by the superscript "m") of the fourth nucleoside; the fourth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety (indicated by the subscript "d") and an unmodified guanine nucleobase linked to the fifth nucleoside by a thiophosphate ester bond; and the fifth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound does not contain any additional substituents.

[0626] In this document, sugars, nucleotide bonds, and nucleobase modifications may be represented within the nucleotide or nucleobase sequence (e.g., by superscript or subscript, as shown above) or in the accompanying text (e.g., in separate text appearing within, above, or below the compound table).

[0627] In the case of a specific compound described herein by way of a drawn chemical structure, each nucleobase, sugar, and nucleoside bond of that particular compound includes only the modifications indicated in the drawn chemical structure. However, those skilled in the art will understand that the drawn compound may exist in equilibrium between tautomeric forms and / or as a salt in equilibrium with protonated or ionic forms. The drawn structures are intended to capture all such forms of such compounds.

[0628] Although every effort has been made to accurately describe the compounds in the appended sequence listing, if there are any discrepancies between the descriptions in this specification and those in the appended sequence listing, the descriptions in this specification but not in the sequence listing are accurate descriptions.

[0629] The compounds described herein include variants in which one or more atoms are replaced by non-radioactive or radioactive isotopes of the element shown. For example, compounds containing hydrogen atoms are covered herein. 1 All possible deuterium substitutions for the hydrogen atom. Isotopic substitutions covered in the compounds described herein include, but are not limited to: 2 H or 3 H replaces 1 H, 13 C or 14 C replaces 12 C 15 N replaces 14 N、 17 O or 18 O replaces 16 O, and 33 S, 34 S, 35 S or 36 S replaces 32 S. In some embodiments, non-radioactive isotope substitution can impart new properties to the oligomeric compound that are beneficial for use as a therapeutic or research tool. In some embodiments, radioactive isotope substitution can make the compound suitable for research or diagnostic purposes, such as imaging.

[0630] Example

[0631] The following examples illustrate certain embodiments of this disclosure and are not limiting. Furthermore, in providing specific embodiments, the inventors have considered the general application of those specific embodiments. For example, the disclosure of oligonucleotides having a specific motif provides reasonable support for other oligonucleotides having the same or similar motifs. And, for example, where a specific high-affinity modification occurs at a specific position, other high-affinity modifications at the same position are considered appropriate, unless otherwise stated.

[0632] Example 1: Design of modified oligonucleotides complementary to human APP RNA

[0633] As shown in the table below, modified oligonucleotides complementary to human APP RNA were designed.

[0634] “Start site” indicates the 5' end nucleotide of the target nucleic acid sequence that is complementary to the modified oligonucleotide. “Termination site” indicates the 3' end nucleotide of the target nucleic acid sequence that is complementary to the modified oligonucleotide. Each modified oligonucleotide listed in the table below is 100% complementary to the complementary sequence of SEQ ID NO:2 (GENBANK accession number NC_000021.9, truncated from nucleotides 25878001 to 26174000).

[0635] The modified oligonucleotides in the table below are 5-10-5 MOE spacers with mixed nucleoside internucleotide motifs. The modified oligonucleotides in the table are 20 nucleotides in length, with the glycosylation motif for the modified oligonucleotide being (from 5' to 3'): eeeeeddddddddddeeeee; where each "e" represents the ribose-2'-MOE sugar motif and each "d" represents the 2'-β-D-deoxyribosyl sugar motif. The nucleoside internucleotide motif for the modified oligonucleotide is presented in the column labeled "Nucleoside Internucleotides (5' to 3')" in the table below, where each "s" represents a thiophosphate internucleotide bond, each "z" represents a methanesulfonyl phosphate internucleotide bond, and each "o" represents a phosphodiester internucleotide bond. Each cytosine residue is 5-methylcytosine.

[0636] Table 1: 5-10-5 MOE spacers with mixed nucleoside internucleotide bonds complementary to human APP

[0637]

[0638] Example 2: Duration of action of modified oligonucleotides complementary to human APP in APP YAC transgenic mice, single dose

[0639] The modified oligonucleotide described above (Lamb BT et al., PubMed: 8220418, B6.129S2-Tg(APP)8.9Btla / J, from strain 005301 at Jackson Laboratory) was tested in APP-YAC transgenic mice expressing the full-length human APP gene. APP YAC mice were created using a 650kb YAC transgene containing the whole human amyloid β (A4) precursor protein (APP) gene, with approximately 250kb flanking sequences altered to include the Swiss mutation APPK670N / M671L associated with familial Alzheimer's disease. This transgene was injected into (129X1 / SvJ x 129S1 / Sv)F1-derived R1 embryonic stem (ES) cells. The progeny animals (R1.40 line) were backcrossed with C57BL / 6J for 21 generations.

[0640] APP YAC transgenic mice were divided into groups of 3 mice each, or as otherwise specified in the column labeled “Number of Animals” in the table below. Each mouse received a single ICV bolus of 300 μg of the modified oligonucleotide. A group of 3 to 4 mice received a single ICV bolus of PBS as a negative control.

[0641] Mice were sacrificed at different time points as shown in the table below, and RNA was extracted from cortical brain tissue, spinal cord, and hippocampus for RT-PCR analysis to measure the amount of APP RNA using the human primer and probe set RTS35571 (forward sequence CCCACTTTGTGATTCCCTACC, designated as SEQ ID NO:9 in this paper; reverse sequence ATCCATCCTCTCCTGGTGTAA, designated as SEQ ID NO:10 in this paper; probe sequence TGATGCCCTTCTCGTTCCTGACAA, designated as SEQ ID NO:11 in this paper). Results are presented as a percentage of human APP RNA relative to the amount of APP in PBS-treated control animals, normalized relative to mouse PPIA (% control). Mouse PPIA was amplified using the primer and probe set m_cyclo24 (forward sequence TCGCCGCTTGCTGCA, designated as SEQ ID NO:12 in this paper; reverse sequence ATGCGCCGTGATGTCGA, designated as SEQ ID NO:13 in this paper; probe sequence CCATGGTCAACCCCACCGTGTTC, designated as SEQ ID NO:14 in this paper).

[0642] Table 2: Reduction of human APP RNA in APP YAC transgenic mice

[0643]

[0644] Table 3: Reduction of human APP RNA in APP YAC transgenic mice

[0645]

[0646] Table 4: Reduction of human APP RNA in APP YAC transgenic mice

[0647]

[0648]

[0649] This indicates that there are fewer than 3 usable samples.

[0650] Example 3: Activity of modified oligonucleotides complementary to human APP in APP YAC transgenic mice

[0651] The activity of the modified oligonucleotides described above was tested using the APP YAC transgenic mouse model (described above).

[0652] APP YAC transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of 300 μg of modified oligonucleotides. Each group of four mice received a single ICV bolus of PBS as a negative control.

[0653] Twenty weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and hippocampus for RT-PCR analysis to measure the amount of APP RNA using the human primer and probe set RTS35571 (described above). Results are presented as a percentage of human APP RNA relative to the amount of APP in PBS-treated control animals, normalized relative to mouse PPIA (% control). Mouse PPIA was amplified using the primer and probe set m_cyclo24 (described above).

[0654] Table 5: Reduction of human APP RNA in APP YAC transgenic mice

[0655]

[0656]

[0657] This indicates that there are fewer than 4 usable samples.

[0658] Example 4: The efficacy of modified oligonucleotides complementary to human APP in APP YAC transgenic mice, 4 weeks

[0659] The modified oligonucleotides described above were tested in the APP YAC transgenic mouse model described above.

[0660] deal with

[0661] APP YAC transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of the modified oligonucleotide at the doses shown in the table below. Each group of four mice received a single ICV bolus of PBS as a negative control.

[0662] RNA analysis

[0663] Four weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and hippocampus for RT-PCR analysis to measure the amount of APP RNA using the human primer and probe set RTS35571 (described above). Results are presented as a percentage of human APP RNA relative to the amount of APP in PBS-treated control animals, normalized relative to mouse PPIA (% control). Mouse PPIA was amplified using the primer and probe set m_cyclo24 (described above).

[0664] The half-maximum effective dose (ED) of each modified oligonucleotide was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). 50 NC refers to the uncalculated value.

[0665] Compound 1353884 is a comparative compound and was previously described in WO 2022 / 026589. Compound 1353884 consists of the following sequence (from 5' to 3'): GTTTACCTTTAACATTCCTC, designated herein as SEQ ID NO:15. The glycosylation motif for compound 1353884 is (from 5' to 3'): eeeeddddddddddeeeee; where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the ribose-2'-MOE sugar moiety. The internucleotide motif for compound 1353884 is (from 5' to 3'): sooosssssssssssooss; where each "s" represents the thiophosphate internucleotide bond and each "o" represents the phosphodiester internucleotide bond. Each cytosine nucleobase in compound No. 1353884 is 5-methylcytosine.

[0666] Compound 1398227 is a comparative compound and was previously described in WO 2022 / 026589. Compound 1398227 consists of the following sequence (from 5' to 3'): CTCCAATTTTAACTTGCACC, designated herein as SEQ ID NO:18. The glycosylation motif for compound 1398227 is (from 5' to 3'): eeeeddddddddddeeeee; where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the ribose-2'-MOE sugar moiety. The internucleotide motif for compound 1398227 is (from 5' to 3'): sooosssssssssssooss; where each "s" represents the thiophosphate internucleotide bond and each "o" represents the phosphodiester internucleotide bond. Each cytosine nucleobase in compound No. 1398227 is 5-methylcytosine.

[0667] Table 6: Dose-dependent percentage reduction of human APP mRNA in APP YAC transgenic mice

[0668]

[0669] Table 7: Dose-dependent percentage reduction of human APP mRNA in APP YAC transgenic mice

[0670]

[0671] Example 5: The efficacy of modified oligonucleotides complementary to human APP in APP YAC transgenic mice, 12 weeks.

[0672] The modified oligonucleotides described above were tested in the APP YAC transgenic mouse model described above.

[0673] deal with

[0674] APP YAC transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of the modified oligonucleotide at the doses shown in the table below. Each group of four mice received a single ICV bolus of PBS as a negative control.

[0675] RNA analysis

[0676] Twelve weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and hippocampus for RT-PCR analysis to measure the amount of APP RNA using the human primer and probe set RTS35571 (described above). Results are presented as a percentage of human APP RNA relative to the amount of APP in PBS-treated control animals, normalized relative to mouse PPIA (% control). Mouse PPIA was amplified using the primer and probe set m_cyclo24 (described above).

[0677] The half-maximum effective dose (ED) of each modified oligonucleotide was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). 50 ).

[0678] Table 8: Dose-dependent percentage reduction of human APP mRNA in APP YAC transgenic mice

[0679]

[0680] Example 6: The efficacy of modified oligonucleotides complementary to human APP in APP YAC transgenic mice, 12 weeks

[0681] The modified oligonucleotides described above were tested in the APP YAC transgenic mouse model described above.

[0682] deal with

[0683] APP YAC transgenic mice were randomly divided into groups of 3 to 4 mice each. Each mouse received a single ICV bolus of the modified oligonucleotide at the doses shown in the table below. A group of 4 mice received a single ICV bolus of PBS as a negative control.

[0684] RNA analysis

[0685] Twelve weeks after treatment, mice were sacrificed, and RNA was extracted from the cortical brain tissue, spinal cord, and striatum for RT-PCR analysis to measure the amount of APP RNA using the human primer and probe set RTS35571 (described above). Results are presented as a percentage of human APP RNA relative to the amount in PBS-treated control animals, normalized relative to mouse PPIA (% control). Mouse PPIA was amplified using the primer and probe set m_cyclo24 (described above).

[0686] The half-maximum effective dose (ED) of each modified oligonucleotide was calculated using GraphPad Prism 10 software (GraphPad Software, San Diego, CA). 50 ).

[0687] Table 9: Dose-dependent reduction of human APP RNA in APP YAC transgenic mice

[0688]

[0689] Example 7: Duration of action of modified oligonucleotides complementary to human APP in APP YAC transgenic mice, single dose

[0690] The modified oligonucleotides described above were tested in APP YAC transgenic mice. APP YAC transgenic mice were randomly assigned to groups of 3 to 6 mice each. Each mouse received a single ICV bolus of 300 μg of the modified oligonucleotide. A group of 3 to 4 mice received a single ICV bolus of PBS as a negative control.

[0691] Mice were sacrificed at different time points as shown in the table below, and RNA was extracted from cortical brain tissue for RT-PCR analysis to measure the amount of APP RNA using the human primer and probe set RTS35571 (described above). Results from several different experiments were pooled, and these results are presented in the table below as a percentage of the amount of human APP RNA relative to the amount of APP in PBS-treated control animals, normalized relative to mouse PPIA (% control). Mouse PPIA was amplified using the primer and probe set m_cyclo24 (described above).

[0692] Table 10: Reduction of human APP RNA in APP YAC transgenic mice

[0693]

[0694] This indicates that there are fewer than 3 usable samples.

Claims

1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 15 to 18, and wherein at least one internucleoside linkage of the modified oligonucleotide is a methionine phosphoramidite internucleoside linkage.

2. The oligomeric compound of claim 1, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15 to 18.

3. The oligomeric compound of any one of claim 1 or claim 2, wherein the modified oligonucleotide consists of 20 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 15 or SEQ ID NO:

18.

4. The oligomeric compound of any one of claims 1 to 3, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 15 or SEQ ID NO:

18.

5. The oligomeric compound of any one of claims 1 to 4, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an APP nucleic acid, wherein the APP nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO:

2.

6. The oligomeric compound of any one of claims 1 to 5, wherein the modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

7. The oligomeric compound of any one of claims 1 to 6, wherein the modified oligonucleotide consists of 20 linked nucleosides.

8. The oligomeric compound of any one of claims 1 to 7, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

9. The oligomeric compound of claim 8, wherein the modified nucleoside comprises a modified sugar moiety.

10. The oligomeric compound of claim 9, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

11. The oligomeric compound of claim 10, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -0-CH2- and -0-CH(CH3)-.

12. The oligomeric compound of any one of claims 8 to 9, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

13. The oligomeric compound of claim 12, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

14. The oligomeric compound of claim 12 or claim 13, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety.

15. The oligomeric compound of any one of claims 1 to 14, wherein at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside linkages of the modified oligonucleotide are methylenophosphonamidate internucleoside linkages.

16. The oligomeric compound of any one of claims 1 to 15, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

17. The oligomeric compound of claim 16, wherein at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

18. The oligomeric compound of any one of claims 1 to 17, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.

19. The oligomeric compound of any one of claims 1 to 18, wherein the modified oligonucleotide comprises an internucleoside linkage motif (5' to 3') selected from the group consisting of: sooosssssszzszsooss, sooosssssszszssooss, sooosszsssszsssooss, soooszsssszzsssooss, sooosszzssszsssooss, sooossssszzzszsooss, sooossssszzzzssooss, sooosszssszzsssooss, soooszssszzzsssooss, sssosssssszzszsosss, ssoosssssszszssosss, ssoosszsssszsssosss, sssoszsssszzsssosss, ssoossssszzzszsosss, sssssssssszzzzzsssss, sssoszssszzzsssosss, sssoszssszzzsssssss, and sssszssszzzsssosss, wherein each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a sulfamidate phosphoramide internucleoside linkage.

20. The oligomeric compound of any one of claims 1 to 19, wherein the modified oligonucleotide comprises at least one modified nucleobase.

21. The oligomeric compound of claim 20, wherein the modified nucleobase is 5-methylcytosine.

22. The oligomeric compound of claim 21, wherein each cytosine is 5-methylcytosine.

23. The oligomeric compound of any one of claims 1 to 22, wherein one or more nucleosides of the modified oligonucleotide comprise an unmodified nucleobase.

24. The oligomeric compound of any one of claims 1 to 23, wherein the modified oligonucleotide comprises a deoxy region.

25. The oligomeric compound of claim 24, wherein each nucleoside of the deoxy region is a 2'-beta-D-deoxynucleoside.

26. The oligomeric compound of claim 24 or claim 25, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides.

27. The oligomeric compound of any one of claims 19 to 22, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.

28. The oligomeric compound of any one of claims 24 to 27, wherein the deoxy region is flanked on the 5' side by a 5' external region and on the 3' side by a 3' external region, the 5' external region consisting of 1 to 6 linked 5' external region nucleosides, the 3' external region consisting of 1 to 6 linked 3' external region nucleosides, wherein: the 5' external region comprises a most 3' end nucleoside comprising a modified sugar moiety; and the 3' external region comprises a most 5' end nucleoside comprising a modified sugar moiety.

29. The oligomeric compound of claim 28, wherein each nucleoside of the 3' external region comprises a modified sugar moiety.

30. The oligomeric compound of claim 28 or claim 29, wherein each nucleoside of the 5' external region comprises a modified sugar moiety.

31. The oligomeric compound of claim 30, wherein the modified oligonucleotide has: a 5' external region consisting of 5 linked nucleosides; a deoxy region consisting of 10 linked nucleosides; and a 3' external region consisting of 5 linked nucleosides; wherein each of the 5' external region nucleosides and each of the 3' external region nucleosides is a 2'-MOE nucleoside.

32. The oligomeric compound of any one of claims 24 to 31, wherein at least 3 internucleoside linkages of the deoxy region are phosphor amidite internucleoside linkages.

33. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 19) or a pharmaceutically acceptable salt thereof.

34. The modified oligonucleotide of claim 33, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

35. The modified oligonucleotide of claim 34, which is the sodium salt or the potassium salt.

36. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 19).

37. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 20) or a pharmaceutically acceptable salt thereof.

38. The modified oligonucleotide of claim 37, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

39. The modified oligonucleotide of claim 38, which is the sodium salt or the potassium salt.

40. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 20).

41. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 21) or a pharmaceutically acceptable salt thereof.

42. The modified oligonucleotide of claim 41, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

43. The modified oligonucleotide of claim 42, which is the sodium salt or the potassium salt.

44. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 21).

45. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 22) or a pharmaceutically acceptable salt thereof.

46. The modified oligonucleotide of claim 45, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

47. The modified oligonucleotide of claim 46, which is the sodium salt or the potassium salt.

48. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 22).

49. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 23) or a salt thereof.

50. The modified oligonucleotide of claim 47, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

51. The modified oligonucleotide of claim 48, which is the sodium salt or the potassium salt.

52. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 23).

53. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 24) or a pharmaceutically acceptable salt thereof.

54. The modified oligonucleotide of claim 53, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

55. The modified oligonucleotide of claim 54, which is the sodium salt or the potassium salt.

56. A modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 24).

57. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: m C es T es m C es m C eo A e s A dz T ds T ds T ds T ds A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 19), wherein: A = an adenine nucleobase, m C = 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, d = a 2’-beta-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a methoxyamido phosphoramidate internucleoside linkage, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

58. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbol: G es T es T eo T eo A es m C ds m C ds T ds T ds T dz A dz A dz m C ds A dz T ds T eo m C es m C es T es m C e (SEQ ID NO: 20), wherein: A = an adenine nucleobase, m C = 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, d = a 2’-beta-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a methoxyamido phosphoramidate internucleoside linkage, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

59. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G es T es T es T es A es m C ds m C ds T ds T ds T dz A dz A dz m C dz A dz T ds T es m C es m C es T es m C e (SEQ ID NO: 21), wherein: A = an adenine nucleobase, m C = 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, d = a 2’-beta-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and z = a methoxyamido phosphoramidate internucleoside linkage, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

60. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T es m C es m C eo A e s A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 22), wherein: A = an adenine nucleobase, m C = 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, d = a 2’-beta-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a methoxyamido phosphoramidate internucleoside linkage, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

61. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T es m C es m C eo A e s A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G es m C es A es m C es m C e (SEQ ID NO: 23), wherein: A = an adenine nucleobase, m C = 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2’-MOE sugar moiety, d = a 2’-beta-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, o = a phosphodiester internucleoside linkage, and z = a methoxyamido phosphoramidate internucleoside linkage, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group. wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

62. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T es m C es m C es A e s A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 24), wherein: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2’-MOE sugar moiety, d = 2’-beta-D-deoxyribose sugar moiety, s = phosphorothioate internucleoside linkage, o = phosphodiester internucleoside linkage, and z = methoxy sulfonamidate internucleoside linkage, wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.

63. The population of oligomeric compounds of any one of claims 1-32 or 57-62 or the population of modified oligonucleotides of any one of claims 33-56, wherein each phosphorothioate internucleoside linkage of the modified oligonucleotides is stereorandom.

64. A pharmaceutical composition comprising the oligomeric compound of any one of claims 1-32 or 57-62 or the modified oligonucleotide of any one of claims 33-56 or the population of claim 63 and a pharmaceutically acceptable diluent.

65. The pharmaceutical composition of claim 64, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate buffered saline, or water.

66. The pharmaceutical composition of any one of claims 64-65, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and the artificial cerebrospinal fluid.

67. The pharmaceutical composition of any one of claims 64-66, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and the phosphate buffered saline.

68. A method comprising administering to a subject the oligomeric compound of any one of claims 1-32 or 56-62, the modified oligonucleotide of any one of claims 33-56, the population of claim 63, or the pharmaceutical composition of any one of claims 64-67.

69. The method of claim 68, wherein the subject has or is at risk of having a disease or disorder associated with APP.

70. The method of claim 68 or claim 69, wherein administering the oligomeric compound, the modified oligonucleotide, the population, or the pharmaceutical composition improves at least one symptom or marker of a disease or disorder associated with APP.

71. The method of any one of claims 68-70, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition delays or slows progression of cognitive impairment, delays or slows memory decline, delays or slows decline in language skills, improves behavioral and psychological symptoms, reduces apathy, improves motivation, reduces gait disturbance, reduces seizures, delays or slows progressive dementia, and / or reduces abnormal amyloid deposition.

72. The method of any one of claims 68-71, wherein APP protein levels are reduced in the subject.

73. The method of any one of claims 69-72, wherein the disease or disorder associated with APP is sporadic Alzheimer’s disease, hereditary / familial Alzheimer’s disease, Alzheimer’s disease in patients with Down’s syndrome, or cerebral amyloid angiopathy.

74. A method of treating a disease or disorder associated with APP, comprising administering to a subject having or at risk of having a disease or disorder associated with APP a therapeutically effective amount of the oligomeric compound of any one of claims 1-32 or 57-62, the modified oligonucleotide of any one of claims 33-56, the pool of claim 63, or the pharmaceutical composition of any one of claims 64-67, thereby treating the disease or disorder associated with APP.

75. The method of claim 74, wherein administration of the modified oligonucleotide, the oligomeric compound, the pool, or the pharmaceutical composition improves at least one symptom or marker of the disease or disorder associated with APP.

76. The method of claim 73 or claim 75, wherein administration of the modified oligonucleotide, the oligomeric compound, the pool, or the pharmaceutical composition delays or slows progression of cognitive impairment, delays or slows memory decline, delays or slows decline in language skills, improves behavioral and psychological symptoms, reduces apathy, improves motivation, reduces gait disturbance, reduces seizures, delays or slows progressive dementia, and / or reduces abnormal amyloid deposition.

77. The method of any one of claims 74-76, wherein the level of APP protein in the subject is reduced.

78. The method of any one of claims 74-77, wherein the disease or disorder associated with APP is sporadic Alzheimer’s disease, hereditary / familial Alzheimer’s disease, Alzheimer’s disease in patients with Down’s syndrome, or cerebral amyloid angiopathy.

79. The method of any one of claims 74-78, wherein the subject is a human.

80. A method of reducing expression of APP in a cell, comprising contacting the cell with the oligomeric compound of any one of claims 1-32 or 57-62, the modified oligonucleotide of any one of claims 33-56, the pool of claim 63, or the pharmaceutical composition of any one of claims 64-67.

81. The method of claim 80, wherein the cell is a cortical brain cell or a hippocampal cell.

82. The method of claim 80 or claim 81, wherein the cell is a human cell.

83. Use of the oligomeric compound of any one of claims 1-32 or 57-62, the modified oligonucleotide of any one of claims 33-56, the pool of claim 63, or the pharmaceutical composition of any one of claims 64-67 for treating a disease or disorder associated with APP.

84. Use of the oligomeric compound according to any one of claims 1 to 32 or 56 to 62, the modified oligonucleotide according to any one of claims 33 to 56, the pool according to claim 63, or the pharmaceutical composition according to any one of claims 64 to 67 in the manufacture of a medicament for the treatment of a disease or disorder associated with APP.

85. The use according to any one of claims 83 to 84, wherein the disease or disorder associated with APP is associated with an elevated level of APP.

86. The use according to any one of claims 83 to 85, wherein the disease or disorder associated with APP is sporadic Alzheimer’s disease, hereditary / familial Alzheimer’s disease, Alzheimer’s disease in patients with Down’s syndrome, or cerebral amyloid angiopathy.

Images