Application of maize RTA9 gene in enhancing plant resistance to aphids

By overexpressing the RTA9 gene in maize and enhancing its mitochondrial reactive oxygen species (ROS) generation capacity, the problem of unclear maize resistance to aphids was solved, and maize's resistance to aphids was significantly improved.

CN121006381BActive Publication Date: 2026-03-24ANHUI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511274318.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-08
Publication Date
2026-03-24
Estimated Expiration
2045-09-08

AI Technical Summary

Technical Problem

In the current technology, the resistance mechanism of corn to aphids is not clear, which leads to aphid infestation and a decline in crop yield and quality.

Method used

By overexpressing the RTA9 gene in maize and taking advantage of its location in mitochondria, the plant's ability to generate reactive oxygen species (ROS) is enhanced, thereby increasing its resistance to aphids.

Benefits of technology

Overexpression of the RTA9 gene significantly improved maize's resistance to aphids, reduced aphid survival rate and numbers, enhanced the plant's defense response, and provided a theoretical basis and genetic resources for aphid resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121006381B_ABST
    Figure CN121006381B_ABST
Patent Text Reader

Abstract

The application discloses the field of plant genetic engineering technology and relates to application of a maize RTA9 gene in enhancing the ability of plants to resist aphids, a CDS sequence of the maize RTA9 gene is shown as SEQ ID NO.1, and an amino acid sequence of the RTA9 gene is shown as SEQ ID NO.2; subcellular localization shows that RTA9 is mainly located in mitochondria; researches show that the function loss of the RTA9 gene weakens the ability of maize to produce ROS in response to aphid infestation, thereby causing the ability of maize to resist aphids to decrease; overexpression of the RTA9 gene in maize can significantly increase the content of intracellular ROS and improve the ability of maize to resist aphids; and the application provides a theoretical basis and gene resources for development of crop strains resistant to aphids.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of the maize RTA9 gene in enhancing plant resistance to aphids. Background Technology

[0002] Aphids are one of the major pests of crops, with a short life cycle and rapid reproduction, which can cause outbreaks of pests in a short period of time. Aphids pierce the phloem of plants with their mouthparts to suck nutrients, causing nutrient loss to the host. At the same time, they can also carry and spread viruses, creating indirect and cumulative damage, ultimately leading to a serious decline in the yield and quality of crops including corn, wheat, and cotton.

[0003] In the long-term co-evolution of plants and insects, diverse and complex defense systems have gradually formed. Reactive oxygen species (ROS) play a barrier role in plant defense against insect invasion and serve as core regulators of various biological programs, enabling cells to respond rapidly to different stimuli. ROS can enhance plant resistance by activating the expression of defense-related genes, reprogramming signaling networks, and altering plant secondary metabolic pathways, thereby reducing insect feeding, inhibiting insect growth and survival. Conversely, suppressing ROS bursts promotes aphid colonization on host plants. For example, mutating the NADPH oxidase RBOHD gene significantly increases the reproductive capacity of the peach aphid (Myzus persicae) in Arabidopsis thaliana. In wheat (Triticum aestivum), H2O2 accumulation inhibits the proliferation of wingless aphids while promoting the production of winged aphids, indicating that ROS generation is crucial for establishing a fully effective defense response.

[0004] Mitochondria are the main organelles in cells that produce energy and are a major source of reactive oxygen species (ROS) in plant cells. Recent research indicates that various proteins located in mitochondria are involved in biological processes such as heat tolerance, grain development, leaf senescence, and disease resistance in plants. Currently, the roles and mechanisms of mitochondrial proteins in aphid resistance in crops are not fully understood. Elucidating the functions of these proteins in aphid resistance processes has significant guiding significance and practical application value for breeding new aphid-resistant maize varieties. Summary of the Invention

[0005] The purpose of this invention is to address existing technical problems by proposing the application of the maize RTA9 gene in enhancing plant resistance to aphids.

[0006] The present invention achieves the above objectives through the following technical solutions:

[0007] As a first aspect of the present invention, the application of the maize RTA9 gene in enhancing the plant's resistance to aphids is provided. The maize RTA9 gene is an intronless gene with a full-length CDS of 1536 bp, encoding 511 amino acids. Subcellular localization shows that RTA9 is mainly located in mitochondria.

[0008] As a further optimization of the present invention, the CDS sequence of the RTA9 gene is shown in SEQ ID NO.1.

[0009] As a further optimization of the present invention, the amino acid sequence encoding the RTA9 gene is shown in SEQ ID NO.2.

[0010] As a further optimization of the present invention, the application method is: overexpressing the RTA9 gene in plants to enhance the plant's resistance to aphids.

[0011] As a further optimization of the present invention, the plant is corn.

[0012] As a second aspect of the present invention, a method for enhancing corn's resistance to aphids is also provided, comprising the following steps:

[0013] (1) The RTA9 gene with the CDS sequence shown in SEQ ID NO.1 was constructed into an overexpression vector using genetic engineering techniques;

[0014] (2) The overexpression vector constructed in step (1) was transformed into maize plants by Agrobacterium-mediated transformation to obtain maize plants with RTA9 gene overexpression, thereby enhancing the maize plants’ resistance to aphids.

[0015] As a further optimization of the present invention, the overexpression vector is the pCAMBIA-Ubi overexpression vector.

[0016] As a further optimization of the present invention, the corn variety is B73 or KN5585.

[0017] The beneficial effects of this invention are as follows:

[0018] This invention created a maize strain overexpressing RTA9 based on the maize KN5585 variety and analyzed its aphid resistance. The results showed that RTA9 overexpression improved maize's resistance to aphids. Further analysis of the aphid resistance of the RTA9 mutant revealed that loss of RTA9 function reduced maize's resistance to aphids. Furthermore, transcriptomic analysis and ROS content detection indicated that RTA9 loss of function blocked the expression of genes related to oxidoreductase activity induced by aphid infection, weakening maize's ability to produce ROS in response to aphid infection, thus reducing maize's aphid resistance. In contrast, RTA9 overexpression in maize significantly increased intracellular ROS content and improved aphid resistance. This invention provides a theoretical basis and genetic resources for developing aphid-resistant crop lines. Attached Figure Description

[0019] Figure 1 All images are agarose gel electrophoresis analyses of maize RTA9 gene PCR amplification provided by this invention. In the figure, lane 1 is the DNA marker (100bp-2000bp), and lane 2 is the maize RTA9 gene fragment.

[0020] Figure 2 The present invention provides an anti-GFP antibody for detecting RTA9 overexpressing maize.

[0021] Figure 3 The statistical results of aphid survival rate on maize overexpressing RTA9 provided by this invention;

[0022] Figure 4 The present invention provides statistical results on body weight in maize overexpressing RTA9;

[0023] Figure 5 This is a diagram of aphid colonization on maize overexpressing RTA9, provided by the present invention.

[0024] Figure 6 The present invention provides statistical results on the number of aphids on maize overexpressing RTA9.

[0025] Figure 7 Identification of the rta9 mutant provided by this invention;

[0026] Figure 8 The statistical results of aphid survival rate on the rta9 mutant provided by this invention;

[0027] Figure 9 The weight statistics of the rta9 mutant provided by this invention;

[0028] Figure 10 The statistical results of the number of aphids on the rta9 mutant provided by this invention;

[0029] Figure 11 Gene enrichment analysis of rta9 mutant aphids before and after infection, provided by this invention;

[0030] Figure 12 Analysis of ROS content in maize leaves before and after aphid infection with the rta9 mutant and RTA9 overexpression provided in this invention. Detailed Implementation

[0031] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0032] 1. Materials and Reagents

[0033] Unless otherwise specified, all materials, reagents, or instruments used in this invention are conventional products that can be purchased commercially.

[0034] 2. Method

[0035] Unless otherwise specified, the methods used in this invention are conventional methods known to those skilled in the art. Where specific conditions are not specified, they should be performed under conventional conditions or conditions recommended by the manufacturer.

[0036] 2.1 Cloning of the maize RTA9 gene

[0037] Using wild-type B73 maize as material, total RNA was extracted and then reverse transcribed to synthesize the first strand of cDNA, which was used as a template for PCR amplification.

[0038] Amplification was performed using the designed specific primers, yielding a 1536 bp gene fragment (electrophoresis results are shown below). Figure 1 As shown in the figure, the maize RTA9 gene fragment was ligated into the T-cloning vector PEASY-T3 to obtain T3-RTA9, which was transformed into E. coli. Positive clones were selected and sequenced. The sequencing results were consistent with the predicted results. The CDS sequence of the maize RTA9 gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the maize RTA9 gene is shown in SEQ ID NO.2.

[0039] The specific amplification primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.4:

[0040] SEQ ID NO.3: RTA9-F: (5'>ATGGAGACGCAAGTGGCG<3');

[0041] SEQ ID NO.4: RTA9-R: (5'>CGGCCGCCGCCCCGGCTTGGACA<3').

[0042] 2.2 Creation and Aphid Resistance Analysis of Maize Overexpressing RTA9

[0043] Using the Ubi promoter to drive the CDS sequences of the green fluorescent protein gene GFP and the target gene RTA9, the pCAMBIA-Ubi overexpression vector was constructed and transformed into maize KN5585, creating transgenic maize lines overexpressing RTA9 (denoted as RTA9-OE#1, RTA9-OE#2, and RTA9-OE#3). The overexpression lines were detected using an anti-GFP antibody, and the results are as follows: Figure 2 As shown.

[0044] The survival rate and body weight of aphids were measured using the overexpression material RTA9-OE. The specific procedures are as follows:

[0045] The overexpression material RTA9-OE was planted separately from wild-type KN5585 maize in separate pots. Twenty one-day-old aphids were inoculated into maize seedlings at stage V4. Aphid numbers were counted for seven consecutive days to analyze aphid survival rates. Results are as follows: Figure 3 As shown, in a continuous 7-day statistical study, the survival rate of aphids on the overexpression material RTA9-OE was significantly lower than that of wild-type KN5585 maize.

[0046] Simultaneously, aphids were collected on day 7 and weighed, with 5 aphids per group. The weight of each aphid was calculated to assess the resistance of RTA9 to aphids. Results are as follows: Figure 4 As shown, the aphid weight on the overexpression material RTA9-OE was significantly lower than that on wild-type KN5585 maize.

[0047] Furthermore, the number of aphids in genetically modified corn was significantly less than that in wild-type KN5585 corn two weeks later (e.g., Figure 5 ), Statistical results are as follows Figure 6 As shown, this indicates that overexpression of RTA9 can improve maize's resistance to aphids.

[0048] 2.3 Identification of the rta9 mutant and analysis of its aphid resistance

[0049] To further demonstrate the aphid resistance of the RTA9 gene, an RTA9 mutant with MU insertion was ordered from the China MU Maize Mutant Library (http: / / chinamu.jaas.ac.cn / Default.aspx).

[0050] First, specific expansion primers were designed, and PCR amplification was used to identify whether the rta9 mutant was homozygous. The primer combination RTA9-F2 + RTA9-R2 amplified no band, while the combination Mu67 + RTA9-R2 showed a band, indicating a homozygous mutant. The results are as follows: Figure 7 As shown.

[0051] The specific amplification primer sequences are shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7:

[0052] SEQ ID NO.5: RTA9-F2: (5'>AGCAGCAACAGCAGCAGAAGGC<3');

[0053] SEQ ID NO.6: RTA9-R2: (5'>TGGATCAGTGTCCGCCCGACTCT<3');

[0054] SEQ ID NO.7: Mu67: (5'>GAAGCCAACGCCAWCGCCTCYATTTCGTCGAAT<3').

[0055] Subsequently, the aphid resistance of the rta9 mutant was evaluated, and the specific steps were the same as in Section 2.2.

[0056] The results are as follows Figure 8 , Figure 9 and Figure 10 As shown, the survival rate, weight, and number of aphids on the rta9 mutant were significantly higher than those on wild-type B73 maize, indicating that the loss of function of RTA9 reduced maize's resistance to aphids.

[0057] 2.4 Detection of ROS content in rta9 mutant and RTA9 overexpressing maize

[0058] To elucidate how RTA9 regulates aphid resistance in maize, transcriptome analysis was used to examine gene expression changes in the rta9 mutant before and after aphid infection. Gene ontology enrichment analysis was also performed on the specifically altered genes in wild-type B73 maize and the rta9 mutant.

[0059] The results are as follows Figure 11 As shown, genes related to oxidoreductase activity in wild-type B73 maize were significantly enriched after aphid infection, while the oxidoreductase activity pathway was not enriched in the rta9 mutant. This indicates that RTA9 is dysfunctional and blocks the expression of genes related to oxidoreductase activity induced by aphid infection.

[0060] Furthermore, the ROS content of wild-type B73 maize, rta9 mutant, wild-type KN5585 maize, and RTA9 overexpression lines was detected using the H2DCFDA probe method. The specific procedures are as follows:

[0061] Leaves before and after aphid infection were immersed in a buffer solution (10 mM Tris-HCl, 50 mM KCl, 50 µM H2DCFDA, 0.02% [v / v]) and kept at −0.6 MPa for 20 min. After rinsing with water, the leaves were observed and photographed under a fluorescence microscope.

[0062] The results are as follows Figure 12 As shown, the ROS content in the leaves of the rta9 mutant was significantly lower than that of wild-type B73 maize after aphid infection. Conversely, the ROS content in maize overexpressing RTA9 was significantly higher than that in wild-type KN5585 maize, indicating that RTA9 overexpression can increase the ROS content in maize.

[0063] 3. Conclusion

[0064] This invention has found that overexpression of RTA9 can enhance maize's resistance to aphids, while loss of RTA9 function reduces maize's resistance to aphids. Furthermore, transcriptomic analysis and ROS content detection show that loss of RTA9 function blocks the expression of genes related to oxidoreductase activity induced by aphid infection, weakening maize's ability to produce ROS in response to aphid infection, thus leading to a decrease in maize's resistance to aphids. In contrast, overexpression of RTA9 in maize can significantly increase intracellular ROS content and enhance aphid resistance.

[0065] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of the maize RTA9 gene in enhancing plant resistance to aphids, characterized in that, The RTA9 The CDS sequence of the gene is shown in SEQ ID NO.1; The application method is as follows: overexpressing the RTA9 gene in plants to enhance their resistance to aphids, wherein the plant is corn.

2. A method for enhancing corn's resistance to aphids, characterized in that, Includes the following steps: (1) The RTA9 gene with the CDS sequence shown in SEQ ID NO.1 was constructed into an overexpression vector using genetic engineering techniques; (2) The overexpression vector constructed in step (1) was transformed into maize plants using Agrobacterium-mediated transformation to obtain... RTA9 Overexpression of the gene in maize plants enhances their resistance to aphids.

3. The method for enhancing corn's resistance to aphids according to claim 2, characterized in that, The overexpression vector is the pCAMBIA-Ubi overexpression vector.

4. The method for enhancing corn's resistance to aphids according to claim 2, characterized in that, The corn variety is B73 or KN5585.

Citation Information

Patent Citations

  • RTA1 gene for enhancing aphid resistance of plants and application of RTA1 gene

    CN118620907A

  • Insect-resistant and herbicide-resistant transgenic corn and cultivation method therefor

    WO2023093848A1