Application of nimodipine in preparing medicine for treating acute liver injury by inducing UGT1A1

Abstract

The invention discloses application of nimodipine in preparation of a medicine for treating acute liver injury by inducing UGT1A1, and belongs to the technical field of regulation and control of metabolic enzymes of medicines. According to the application of nimodipine in preparation of the medicine for treating acute liver injury by inducing UGT1A1, nimodipine can induce expression of UGT1A1, and the mRNA and protein expression level of enzyme can be remarkably up-regulated. The invention can be used for regulating drug metabolism, hyperbilirubinemia and other diseases caused by insufficient expression of UGT1A1. The application range of nimodipine is expanded, and a new strategy is provided for individualized drug therapy.

Description

Technical Field

[0001] This invention relates to the field of drug metabolism enzyme regulation technology, and more specifically to the application of nimodipine in the preparation of drugs for treating acute liver injury by inducing UGT1A1. Background Technology

[0002] Urate diphosphate glucuronide transferase 1A1 (UGT1A1) is a crucial phase II drug-metabolizing enzyme, primarily expressed in the liver. It catalyzes the glucuronidation of substrates such as bilirubin, drug metabolites, and hormones, and participates in the metabolism of various endogenous and exogenous substances. Abnormal UGT1A1 expression may lead to drug metabolism disorders or hyperbilirubinemia (such as Crigler-Najjar syndrome and Gilbert's syndrome). Although drugs like rifampin have some ability to induce UGT1A1, their significant side effects or poor selectivity limit their clinical application. Therefore, finding novel, low-toxicity, natural, and safe UGT1A1 inducers is of great importance.

[0003] Nimodipine is a selective calcium channel blocker, primarily used clinically to prevent cerebral vasospasm, treat hypertension, and angina. However, there are currently no publicly reported studies on its ability to regulate UGT1A1 expression in the field of drug metabolism.

[0004] Therefore, providing the application of nimodipine in the preparation of drugs for treating acute liver injury by inducing UGT1A1 is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides the use of nimodipine in the preparation of drugs for treating acute liver injury by inducing UGT1A1. Specifically, it discloses the use of nimodipine in inducing UGT1A1 expression or enzyme activity, particularly in drug metabolism regulation, treatment of hyperbilirubinemia, and hepatoprotection, thus expanding the application field of the compound.

[0006] The advantages of this invention are that it induces stability, has low cytotoxicity, can increase the expression of UGT1A1, and enhance bilirubin and drug metabolism.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] Application of nimodipine in the preparation of drugs for treating acute liver injury.

[0009] Furthermore, the application of nimodipine in enhancing the expression level of UGT1A1 protein.

[0010] Furthermore, nimodipine was used in the preparation of drugs for treating acute liver injury by inducing UGT1A1.

[0011] As can be seen from the above technical solution, compared with the prior art, this invention discloses the application of nimodipine in the preparation of drugs for treating acute liver injury by inducing UGT1A1. Nimodipine can induce the expression of UGT1A1, significantly upregulating the mRNA and protein expression levels of this enzyme. This invention can be used to regulate drug metabolism, hyperbilirubinemia, and other diseases caused by insufficient UGT1A1 expression. This invention expands the application scope of nimodipine and provides a new strategy for personalized drug therapy. Attached Figure Description

[0012] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0013] Figure 1 The results of CCK8 activity assays of nimodipine in HepG(A) and Caco2(B) cells.

[0014] Figure 2 Nimodipine was used to induce UGT1A1 mRNA expression in HepG2(A) and Caco2(B) cells.

[0015] Figure 3 Nimodipine upregulated the expression level of UGT1A1 protein in HepG2(A) and Caco2(B) cells.

[0016] Figure 4 This refers to the activation effect of nimodipine on PPAR(A) and AhR(B).

[0017] Figure 5 The effect of nimodipine on liver morphology in mice with CCl4-induced liver injury was investigated. A: blank control group; B: model group; C: 50 mg / kg; D: 100 mg / kg.

[0018] Figure 6 The effect of nimodipine on UGT1A1 mRNA expression in tissues of mice with CCl4-induced liver injury.

[0019] Figure 7 The effect of nimodipine on the level of UGT1A1 protein in tissues of mice with CCl4-induced liver injury was investigated; where 50: 50 mg / kg; 100: 100 mg / kg. Detailed Implementation

[0020] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] Example 1

[0022] CCK-8 cell viability assay: HepG2 cells and Caco2 cells (density 8×10⁶) were respectively used. 3 Cells were seeded in 96-well plates at 70% confluence (number of cells per well). Different concentrations (0-100 μM) of nimodipine were added and incubated for 72 h. 200 μL of CCK 8 solution was added to each well and incubated for 30 min before being analyzed using a microplate reader at 450 nm absorbance. Results are shown below. Figure 1 This study indicates that nimodipine has virtually no cytotoxicity to HepG2 and Caco-2 cells within the concentration range of 0-25 μM, therefore a concentration of 25 μM will not have any effect on the cells.

[0023] Gene-level screening results: To verify whether nimodipine can induce UGT1A1 mRNA expression, time-dependent and dose-dependent assays were performed. HepG2 cells and Caco2 cells were screened at 4 × 10⁻⁶ mRNA levels. 4 Cells were seeded at a density of [number] cells / well in 12-well plates. Cells were divided into two groups: one group received complete culture medium containing different concentrations (2, 10, 25 μM) of nimodipine, and the other group received only complete culture medium. Cells were incubated for 0, 24, 48, and 72 h, respectively. After 72 h of induction, RNA was extracted for qRT-PCR detection. The primer sequences for UGT1A1 and GAPDH were:

[0024] UGT1A1-F: 5'-ATTGATCCCAAAGAGAAAACCAC-3'; SEQ ID NO.1;

[0025] UGT1A1-R: 5'-CCTTTGCCTCAGAATTCCTTC-3'; SEQ ID NO.2;

[0026] GAPDH-F: 5'-CCAGGGCTGCTTTTAACTC-3'; SEQ ID NO.3;

[0027] GAPDH-R: 5'-GCTCCCCCCTGCAAATGA-3'; SEQ ID NO. 4.

[0028] Using GAPDH as an internal reference for calibration, the relative mRNA expression level of nimodipine-induced UGT1A1 was obtained based on the Ct value (2ΔCt formula). Results are shown below. Figure 2 This indicates that nimodipine can induce the expression of UGT1A1 mRNA.

[0029] Protein level detection: To verify whether nimodipine can increase UGT1A1 protein expression, HepG2 cells and Caco2 cells (density 4×10⁻⁶) were used. 5 Proteins were seeded per well in 6-well plates and incubated for 72 h with complete medium containing different concentrations (2, 10, 25 μM) of nimodipine. RIPA lysis buffer was added to the wells and the plates were lysed on ice. Protein concentration was determined using a BCA kit according to the manufacturer's instructions. After preparing a 10% sodium dodecyl sulfate polyacrylamide gel, appropriate amounts of sample were added to each well, and the protein was transferred to a PVDF membrane. The membrane was blocked with skim milk powder and incubated overnight at 4°C with UGT1A1 and GAPDH antibodies. The membrane was washed three times with TBST for 5-10 min each time. The membrane was then incubated with secondary antibody IgG H&L (HRP) at room temperature with gentle shaking for 60 min. After incubation with secondary antibody, the membrane was washed three more times with TBST for 5-10 min each time. Ultrasensitive ECL luminescence reagent was added, and the images were captured using BioRad. The results were then analyzed using ImageJ software. (See attached image). Figure 3 This indicates that the expression level of the UGT1A1 enzyme protein is consistent with the mRNA expression results, and the expression level of UGT1A1 protein increases with the increase of the concentration of the analyte.

[0030] Nuclear receptor screening: HEK-293-PPARs-Luc and HEK-293-AhR-Luc cells were seeded in 96-well cell plates and cultured for 24 hours until the cells were stable. Different concentrations of nimodipine were then added to the cell wells in culture medium and cultured for 48 hours. The agonistic effect of nimodipine on PPAR and AhR nuclear receptors was detected using the firefly luciferase reporter gene assay. Results are shown below. Figure 4 Studies have shown that nimodipine can significantly activate AhR in a concentration-dependent manner; different concentrations of nimodipine did not show a significant activation effect on PPAR.

[0031] Protective effect of nimodipine on acute liver injury in mice: C57BL / 6 mice were randomly divided into a blank control group, a model group, and three groups (n=10 per group): a nimodipine 50 mg / kg group, a nimodipine 100 mg / kg group, and a nimodipine 100 mg / kg group. Mice were administered the drug once daily for 7 consecutive days at a fixed time, with a dosage of 200 mL / kg and final drug concentrations of 50 mg / kg and 100 mg / kg, respectively. All mice were fasted for 12 hours before modeling. One hour after the last administration, the blank control group was injected with an equal volume of 5% CMC-Na, while the other three groups were intraperitoneally injected with 0.5% carbon tetrachloride (5 mL / kg) to establish an acute liver injury model. Twelve hours after carbon tetrachloride injection, mice were stunned with isoflurane, and their livers were harvested, placed in cryovials, and temporarily stored in liquid nitrogen for subsequent gene detection experiments and protein level assays. Figure 5 As can be seen from the comparison between the model group and concentrations of 50 mg / kg and 100 mg / kg, the degree of liver damage gradually decreased after nimodipine treatment. RNA was extracted and analyzed by qRT-PCR. The primers for Rat GAPDH and Rat UGT1A1 were designed as follows (5'-3'):

[0032] Rat GAPDH-F: AGGTCGGTGTGAACGGATTTG; SEQ ID NO.5;

[0033] Rat GAPDH-R:GGGGTCGTTGATGGCAACA; SEQ ID NO.6;

[0034] Rat UGT1A1-F: TCTGCTTCTTCCGTACCTTCT; SEQ ID NO.7;

[0035] Rat UGT1A1-R: GCTTCAGGTGCTATGACCACAA; SEQ ID NO. 8.

[0036] For protein level detection, liver tissue was collected and protein concentration was determined using a BCA kit according to the manufacturer's instructions. After preparing a 10% sodium dodecyl sulfate polyacrylamide gel, an appropriate amount of sample was added to each well, and the protein was then transferred to a PVDF membrane. The membrane was blocked with skim milk powder, then immersed in UGT1A1 and GAPDH antibodies and incubated overnight at 4°C. The PVDF membrane was washed three times with TBST for 5-10 min each time. It was then incubated with secondary antibody IgG H&L (HRP) at room temperature with gentle shaking for 60 min. After incubation with secondary antibody, the PVDF membrane was washed three more times with TBST for 5-10 min each time. A highly sensitive ECL luminescent reagent was added, and images were taken using BioRad. The images were then analyzed using ImageJ software.

[0037] Figure 6 and Figure 7 The results showed that both the nimodipine 50 mg / kg treatment group and the nimodipine 100 mg / kg treatment group increased the levels of UGT1A1 mRNA and protein.

[0038] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of nimodipine in the preparation of drugs for treating acute liver injury.

2. Application of nimodipine in enhancing UGT1A1 protein expression levels.

3. The application of nimodipine in the preparation of drugs for treating acute liver injury by inducing UGT1A1.

Images