Abdominal subcutaneous adipose tissue external vesicles of laying hens with fatty liver syndrome and application thereof

Abstract

The invention discloses an abdominal subcutaneous adipose tissue outer vesicle of a laying hen with fatty liver syndrome and application of the abdominal subcutaneous adipose tissue outer vesicle. The abdominal subcutaneous adipose tissue outer vesicle is separated from abdominal subcutaneous adipose tissue of the laying hen with fatty liver syndrome. The invention finds that the abdominal subcutaneous adipose tissue outer vesicle of the laying hen with the fatty liver syndrome has a liver tissue targeting effect for the first time, and finds that the abdominal subcutaneous adipose tissue outer vesicle of the laying hen with the fatty liver syndrome can transfer gga-let-7a-3p to the liver to regulate and control lipid metabolism disorder of the chicken liver for the first time.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of breeding, in particular to a subcutaneous abdominal adipose tissue-derived extracellular vesicle of fatty liver syndrome laying hen and application thereof. BACKGROUND

[0002] Fatty liver syndrome (FLS) is a common nutritional metabolic disease in laying hens at the peak or later stage of egg production. The liver of a chicken is the main site of fat synthesis. Several studies have reported that excessive energy intake increases liver fat synthesis and leads to insufficient apolipoprotein synthesis, thereby reducing fat transport in the liver. This leads to excessive accumulation of lipids in the liver, which in turn promotes fatty degeneration and further development of FLS. Recent studies have shown that adipose tissue is an active organ with complex endocrine and metabolic functions. In addition to being the largest source of energy in the body, adipose tissue is also the source of various adipokines. Leptin is one of the earliest discovered signal molecules derived from adipocytes and has established the important function of adipose tissue as an endocrine organ. Leptin regulates whole-body metabolism by stimulating energy consumption, suppressing food intake, and restoring blood glucose levels. However, in most cases of obesity, leptin resistance limits its biological effects. Compared with leptin, adiponectin plays an important role in increasing insulin sensitivity, fatty acid oxidation, energy consumption, and reducing liver glucose production. In addition, studies have reported that adipose tissue is involved in the development of obesity-induced inflammation by increasing the levels of pro-inflammatory chemokines and cytokines. For example, tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and IL-8 promote insulin resistance. In addition, the level of macrophages in adipose tissue is positively correlated with the size and weight of adipocytes. In general, adipokines regulate the interaction between adipose tissue and other metabolic organs (such as the liver). Therefore, adipokines are directly connected to the liver through the portal vein, thereby significantly affecting liver diseases. Chicken adipose tissue is mainly distributed subcutaneously in the abdomen and plays an important role in growth, health, and production performance, including energy storage, maintaining stable body temperature, participating in physiological processes, and improving meat quality. An appropriate amount of abdominal fat is crucial for maintaining physiological balance, enhancing meat taste, and reflecting health status.

[0003] Adipose-derived extracellular vesicles (AEVs) carry various biomolecules including miRNAs, proteins, and lipids, and can remotely regulate the function of target organs, participating in inflammation, insulin sensitivity regulation, and lipid metabolism, and other important biological processes Gecys et al. (2023). The study of EVs provides a new perspective for exploring cell-to-cell communication, especially in the context of metabolic diseases, by studying adipose tissue-derived EVs, the molecular mechanisms of metabolic diseases can be better understood Fuchs et al. (2021). However, there is no report on the role of adipose liver syndrome hen abdominal subcutaneous adipose tissue extracellular vesicles. SUMMARY

[0004] Based on the above reasons, the present application provides a kind of adipose liver syndrome hen abdominal subcutaneous adipose tissue extracellular vesicles and its application. Specifically, in order to achieve the purpose of the present application, the present application intends to adopt the following technical solutions: The present application relates to an adipose liver syndrome hen abdominal subcutaneous adipose tissue extracellular vesicle, which is isolated from the abdominal subcutaneous adipose tissue of an adipose liver syndrome hen.

[0005] In a preferred embodiment of the present application, the adipose liver syndrome hen abdominal subcutaneous adipose tissue extracellular vesicles are obtained by the following steps: the collected adipose liver syndrome hen abdominal subcutaneous adipose tissue is cut into small pieces under sterile conditions, and is subjected to enzymatic digestion with collagenase type II; the supernatant containing adipocytes is obtained by centrifugal separation of the enzyme-digested tissue suspension to remove stromal vascular fraction, and further centrifugal separation is performed to remove the remaining cell debris; the supernatant is collected, filtered through a 0.22 μm filter to remove larger particles, and the filtered supernatant is centrifuged at 4°C to precipitate extracellular vesicles, and the precipitate is resuspended in PBS.

[0006] The present application also relates to the use of the above-mentioned adipose liver syndrome hen abdominal subcutaneous adipose tissue extracellular vesicles, which are used for preparing a carrier targeting liver tissue; preferably, the liver tissue of a chick.

[0007] In a preferred embodiment of the present application, the carrier encapsulates gga-let-7a-3p, which has the sequence 5'-CUAUACAAUCUACUGUCUUUCC-3'.

[0008] In a preferred embodiment of the present application, the carrier encapsulates a gga-let-7a-3 inhibitor, which has the sequence 5'-GGAAAGACAGUAGAUUGUAUAG-3'.

[0009] Another aspect of the present application also relates to a complex containing the above-mentioned abdominal subcutaneous adipose tissue extracellular vesicles of fatty liver syndrome laying hens and gga-let-7a-3p.

[0010] Another aspect of the present application also relates to the use of the above-mentioned complex in the preparation of a medicament for treating lipid metabolism disorders of chicken liver.

[0011] The present application has the beneficial effects that the present application first discovers that the abdominal subcutaneous adipose tissue extracellular vesicles of fatty liver syndrome laying hens have the effect of targeting liver tissue, and first discovers that the abdominal subcutaneous adipose tissue extracellular vesicles of fatty liver syndrome laying hens can deliver gga-let-7a-3p to the liver to regulate lipid metabolism disorders of chicken liver. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 : Effects of high-energy low-protein diet on production performance and organ weight of laying hens, wherein (A) egg laying rate; (B) body weight; (C) liver weight; (D) abdominal subcutaneous adipose tissue (ASAT) weight.

[0013] Figure 2 : Morphological changes of chicken liver and abdominal subcutaneous adipose tissue, wherein (A) morphological changes of chicken liver and abdominal subcutaneous adipose tissue; (B) histological changes of chicken liver (magnification 400 times); (C) oil red O staining of frozen sections of chicken liver (magnification 200 times); (D) histological changes of chicken abdominal subcutaneous adipose tissue (magnification 400 times); (E) comparison and analysis of lipid droplet diameters of chicken abdominal subcutaneous adipose tissue.

[0014] Figure 3 : Internalization of AEVs in chicken primary hepatocytes in the model group and the control group of laying hens, wherein (A) observation of the positions of AEVs and chicken hepatocytes by confocal microscopy; (B) comparison of the intensities of PKH26-labeled M-AEVs and C-AEVs entering hepatocytes.

[0015] Figure 4 : AEVs can regulate the proliferation and apoptosis of chicken primary hepatocytes, wherein (A) CCK-8 method for detecting cell viability after M-AEVs and C-AEVs treatment; (B) EdU detection of hepatocytes and Hoechst-stained total cell nuclei that are positive for EdU staining after 24h of M-AEVs and C-AEVs treatment; (C) the results represent the fold change of hepatocyte proliferation rate (percentage of red / blue cell nuclei); (D) flow cytometry for detecting the percentage of hepatocyte apoptosis after M-AEVs and C-AEVs treatment, with PBS as the negative control group; (E) statistical analysis of cell apoptosis.

[0016] Figure 5: Effect of chicken adipose tissue extracellular vesicles on lipid metabolism and inflammation level in primary hepatocytes, (A) Representative images of oil red O staining of chicken hepatocytes treated with M-AEVs and C-AEVs; scale bar = 50 mm (B) Quantification of oil red O staining; (C) mRNA expression of inflammation-related genes in hepatocytes treated with M-AEVs and C-AEVs.

[0017] Figure 6 : In vivo tracing of chicken adipose tissue extracellular vesicles in chicks, (A) Localization of AEVs in chicks by in vivo imaging system; (B) Distribution of DiR-labeled AEVs in major organs (brain, heart, liver, spleen, lung, kidney, gastrointestinal) of chicks; (C) Quantification of DiR-labeled AEVs in major organs of chicks.

[0018] Figure 7 : gga-let-7a-3p in EVs form from ICP1 cells into hepatocytes, (A) Hepatocytes incubated with ICP1 cells transfected with cy3-labeled gga-let-7a-3p mimic for 24 h; scale bar = 100 mm; (B) Expression level of gga-let-7a-3p in hepatocytes co-cultured with ICP1; (C) Effect of EVs secretion inhibitor GW4869 on EVs-dependent gga-let-7a-3p transfer from ICP1 cells to hepatocytes; (D) Expression level of gga-let-7a-3p in hepatocytes treated with ICP1.

[0019] Figure 8 : Quantitative analysis of gga-let-7a-3p mimic and inhibitor in co-culture mode, (A) Number of EVs obtained in equal volume of culture medium after ICP1 was transfected with mimic gga-let-7a-3p or mimic NC; (B) Number of EVs obtained in equal volume of culture medium after ICP1 was transfected with inhibitor gga-let-7a-3p or inhibitor NC; (C) gga-let-7a-3p level in EVs of ICP1 transfected with mimic gga-let-7a-3p or mimic NC; (D) gga-let-7a-3p level in EVs of ICP1 transfected with inhibitor gga-let-7a-3p or inhibitor NC; (E) and (F) gga-let-7a-3p level in hepatocytes co-cultured with ICP1. DETAILED DESCRIPTION

[0020] In order to further understand the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by a person of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0021] Unless otherwise specified, the reagents involved in the embodiments of the present application are all commercially available products, which can be purchased through commercial channels.

[0022] Example 1 1.1 Test animals, grouping and sample collection Ninety-day-old Roman laying hens (average body weight 1.5 kg ± 0.2 kg) were selected as experimental animals and purchased from Sichuan Shengdi Le Village Ecological Food Co., Ltd. During the experiment, the laying hens were free to eat and drink water, and the light was on for 16 hours. Before the start of feeding, the henhouse, trough and water trough were disinfected by potassium permanganate fumigation. After routine immunization, the formal experiment began after several weeks of feeding (egg laying rate ≥ 95% at 150 days). A total of 200 high-yield Roman laying hens were randomly divided into two groups, 100 in each group. The control group (NC) was fed with corn-soybean meal type basic diet; the model group (HELP) was fed with high-energy low-protein diet. The corn-soybean meal type basic diet fed to the control group of laying hens was formulated according to the NRC (1998) nutritional requirements of laying hens; the diet of the pathological model group of laying hens was not formulated according to the NRC (1998) nutritional requirements except for the energy and protein nutritional standards, and the other nutritional elements were formulated according to the NRC (1998). The composition of the basic diet and the high-energy low-protein diet is shown in Table 1. Drinking water was provided freely. Daily egg production was recorded. On the 30th, 60th and 90th day of the experiment, 20 laying hens were randomly selected from each experimental group for sampling. Before sample collection, the birds were fasted for 12 hours and weighed. Blood samples were collected from the wing vein, and serum was collected after centrifugation and stored at -80°C. Subsequently, the birds were anesthetized and euthanized, and then the liver and ASAT samples were collected, weighed and recorded. Part of the tissue samples were temporarily frozen in liquid nitrogen and stored at -80°C for RNA extraction, and the remaining tissue samples were cut into 1 cm3, fixed with 4% paraformaldehyde and 2.5% glutaraldehyde, and then sectioned. All animal experiments in this study were approved by the Sichuan Agricultural University Animal Welfare Committee (Approval No.: SYXK (Chuan) -2019-187).

[0023] 1.2 Production performance and organ weight The production performance results showed that the egg production of the HELP group was significantly lower than that of the NC group from the 10th to the 90th day of the experiment (P < 0.05). Figure 1A). At the 90th day of the experiment, the results showed that the egg laying rate of the NC group was 99%, and the egg laying rate of the HELP group was 73%. In addition, the results showed that the body weight, liver weight and ASAT weight of the HELP group were significantly increased compared with the NC group Figure 1 B-D).

[0024] 1.3 Histomorphological observation of the liver and abdominal subcutaneous adipose tissue (ASAT) of laying hens The histological analysis results showed that the liver tissue structure of the NC group was normal, the liver cells were arranged in order and clearly, the cytoplasm of the liver cells was pink and uniformly distributed Figure 2 A). At the 90th day of the experiment, the results showed that the egg laying rate of the NC group was 99%, and the egg laying rate of the HELP group was 73%. In addition, the results showed that the body weight, liver weight and ASAT weight of the HELP group were significantly increased compared with the NC group Figure 2 B). The results of oil red O staining showed that a large number of lipid droplets were deposited in the liver cells of the HELP group with the extension of high-fat feeding time Figure 2 C), which indicated that the liver of the HELP group had fatty degeneration. In addition, the histological analysis results of ASAT showed that the diameter of adipocytes gradually increased with the extension of high-energy low-protein diet feeding time, and at d90, the diameter of adipocytes in the HELP group was significantly larger than that in the NC group Figure 2 D and E, p < 0.01).

[0025] 1.4 Conclusion The above experimental results showed that under the influence of high-energy low-protein (HELP) diet, the egg laying rate of the experimental chickens decreased significantly, and the body weight, liver weight and ASAT weight increased significantly. Histological analysis showed that the liver of the HELP group had fatty degeneration, and the volume of adipocytes increased, indicating that HELP diet caused significant changes in the structure and function of liver and ASAT tissues.

[0026] 2.1 Isolation of abdominal subcutaneous adipose tissue and plasma-derived extracellular vesicles from fatty liver syndrome laying hens (1) Select 3 Roman laying hens from the HELP group and the NC group in 1.1 at the 90th day of the experiment, respectively, as the FLS model group (Model) and the control group (Control), and take their abdominal subcutaneous adipose tissue and plasma samples for isolation and identification of extracellular vesicles. The isolation of chicken primary hepatocytes was selected from healthy Roman laying hens at the age of 120 days, and the in vivo tracing of adipose tissue extracellular vesicles was selected from 7-day-old Roman chicks (sex: female).

[0027] (2) Isolation of extracellular vesicles from abdominal subcutaneous adipose tissue (ASAT): The collected ASAT sample was cut into small pieces of 0.1 cm3 under sterile conditions and digested with collagenase type II at 37 °C for 1 h with gentle shaking. The digested tissue suspension was centrifuged at 500 x g for 10 min at room temperature to remove stromal vascular fraction. The obtained supernatant containing adipocytes was further centrifuged at 2,000 x g for 15 min at 4 °C to remove any remaining cell debris. The collected supernatant was filtered through a 0.22 μm filter to remove larger particles. The filtered supernatant was ultracentrifuged at 100,000 x g for 2 h at 4 °C to pellet extracellular vesicles, the pellet was resuspended in an appropriate amount of PBS and stored at -80 °C for subsequent experiments and named AEVs, in which the model group is M-AEVs and the control group is C-AEVs.

[0028] (3) Isolation of plasma-derived extracellular vesicles: The thawed plasma sample was centrifuged at 10,000 x g for 30 min at 4 °C to remove any remaining cell debris. The supernatant was then carefully collected and transferred to a new sterile tube. The collected supernatant was subsequently filtered through a 0.22 μm filter to remove larger vesicles and impurities. The filtered supernatant was ultracentrifuged at 100,000 x g for 2 h at 4 °C to pellet extracellular vesicles. The pellet was resuspended in an appropriate amount of PBS and stored at -80 °C for subsequent experiments and named PEVs, in which the model group is M-PEVs and the control group is C-PEVs.

[0029] 2.2 Labeling of adipose tissue-derived extracellular vesicles and investigation of their internalization in chicken primary hepatocytes To observe the internalization of adipose tissue-derived extracellular vesicles in chicken primary hepatocytes, PKH26 fluorescent dye was used to label the extracellular vesicles, and the distribution of the labeled vesicles in the cells was observed under a microscope. First, PKH26 was dissolved in ethanol and diluted according to the instructions. Then, the diluted PKH26 solution was mixed with the extracellular vesicles to allow them to contact and adsorb on the surface of the vesicles. Next, the PKH26-labeled extracellular vesicles were co-incubated with chicken primary hepatocytes for 24 h. Finally, the chicken primary hepatocytes in the culture dish were observed using a fluorescence microscope, the red fluorescence signal of the PKH26 fluorescent dye was observed using a red fluorescence filter, and photographs were taken for record.

[0030] The extracellular vesicles from the abdominal subcutaneous adipose tissue of model and control layers (M-AEVs and C-AEVs) were labeled with the red fluorescent marker PKH26, and then co-incubated with chicken primary hepatocytes. The results showed that both M-AEVs and C-AEVs could be taken up by chicken primary hepatocytes Figure 3A). But the number of internalization of M-AEVs in hepatocytes was significantly higher than that of C-EVs (B), indicating that the EVs released by FLS model group chicken adipose tissue were more targeted to chicken primary hepatocytes. Figure 3

[0031] 2.3 CCK-8 test, EdU test and flow cytometry detection of cell apoptosis rate First, the hepatocytes were evenly distributed in the 96-well plate, and an appropriate amount of extracellular vesicles was added to each well for co-incubation. The untreated group was added with PBS, and CCK-8 reagent was added according to the kit instructions. Next, the 96-well plate was placed in the cell incubator for a period of time to allow the cells to react with the reagent. Then, the absorbance value of each well was measured using a multifunctional enzyme label instrument at a wavelength of 450 nm. Finally, according to the difference in absorbance value, the relative activity of the cells was calculated, taking the absorbance value of the control group as the reference.

[0032] Second, the cells to be tested were cultured in a medium containing EdU for a certain period of time, then washed with PBS, and then fixed with a cell fixation agent. EdU was coupled with a fluorescent dye using click chemistry to label newly synthesized DNA in the cells. Finally, the cells were observed and photographed using a fluorescence microscope, and the number of EdU-positive cells was detected and calculated by fluorescence signal to evaluate cell proliferation.

[0033] In addition, the cell sample to be tested was collected and washed with PBS, and then cell counting was performed. Next, the cells were fixed and the permeability of the cell membrane was increased using a penetration solution. Then, after washing the cells, apoptosis detection dyes (Annexin V-FITC and PI) were added for staining. After incubation for a period of time, flow cytometry was used to detect the apoptosis rate of the cells, and the apoptosis rate was calculated according to the detection results.

[0034] The proliferation and apoptosis of chicken primary hepatocytes treated with different AEVs were detected by CCK-8, EdU and flow cytometry. The results showed that compared with C-AEVs, M-AEVs inhibited the proliferation of chicken hepatocytes (A-D) and promoted the apoptosis of chicken hepatocytes (E). Figure 4 Figure 4 E) The above results showed that FLS chicken-derived adipose tissue extracellular vesicles could reduce the activity of chicken primary hepatocytes.

[0035] 2.4 Oil red O staining of hepatocytes ​​Hepatocytes were fixed in 4% paraformaldehyde for 30 min at room temperature and washed with PBS for 3 times. Oil red O working solution was prepared by diluting stock solution (0.5% oil red O in isopropanol) with distilled water at a ratio of 3:2. The working solution was filtered through a 0.2 micron filter to remove any particulate matter. The fixed cells were then covered with oil red O working solution and incubated at room temperature for 15 min. After staining, the cells were washed with distilled water to remove excess dye. The nuclei were counterstained with hematoxylin for 1 min. After another wash, images were captured using an inverted phase contrast microscope. Lipid droplets were quantitatively analyzed using image analysis software (image J) and identified based on their characteristic red color. The percentage of stained lipid droplets was calculated as the area of staining relative to the total cell area.

[0036] The results showed that the number of lipid droplets in hepatocytes treated with M-AEVs was significantly higher than that in hepatocytes treated with C-AEVs Figure 5 A-B), and the concentration of TNF-α and IL-6 in the supernatant of hepatocyte culture in the M-AEVs group was also significantly higher than that in the C-AEVs group Figure 5 C). indicating that FLS chicken-derived adipose tissue-derived extracellular vesicles can promote the deposition of lipid droplets in hepatocytes and the increase of inflammation level.

[0037] 2.5 In vivo experiment of chicks (1) Exosome marker tracing: In order to observe the distribution of AEVs in vivo in chicks, we mixed the isolated AEVs with lipophilic dye and DiR working solution uniformly and incubated at room temperature for 5 min. In order to remove the unbound dye, the DiR-labeled AEVs were re-collected by ultracentrifugation, washed with PBS and resuspended in PBS by centrifugation for standby. 200 μL of DiR dye-labeled AEVs were injected into the jugular vein of 7-day-old chicks, and 2 h later the distribution of AEVs in vivo in chicks was observed under a live imaging instrument; the main organs of chicks (brain, heart, liver, spleen, lung, kidney, small intestine, stomach) were obtained, and the distribution of exosomes in each organ was observed and photographed.

[0038] (2) Phenotype determination: To evaluate the effects of different AEVs on the liver of chicks, 7-day-old chicks were injected with M-AEVs and C-AEVs (1011 particles / mL) through the jugular vein, and the blank control group was injected with the same volume of PBS. After 14 d, the body weight, liver weight of each group of chicks were determined, and serum and liver tissue were collected to determine TG, T-SOD, MDA, etc. The expression of pro-inflammatory related genes TNF-α and IL-6 in liver tissue was determined by qRT-PCR, and the deposition of lipid droplets in the liver of each group of chicks was observed by oil red O staining.

[0039] The imaging results showed that fluorescence activity was observed in the abdomen of chicks treated with AEVs in each group (see Figure 6A), indicating that EVs were effectively transported and targeted to specific sites within the body. Analysis of anatomical images of chicks revealed that both M-AEVs and C-AEVs were primarily distributed in the liver tissue, but the accumulation of M-AEVs in the liver was significantly higher than in the C-AEVs-treated group (see [reference needed]). Figure 6 (BC) This result indicates that EVs derived from chicken adipose tissue can be effectively targeted and delivered to the liver, especially during FLS, where the targeted regulatory effect on the gallbladder is more pronounced, suggesting that AEVs can serve as a carrier for targeting the liver.

[0040] 2.6 Transfer analysis of gga-let-7a-3p under co-culture mode EVs primarily utilize blood circulation for intercellular transfer; therefore, miRNAs (gga-let-7a-3p, gga-let-7a-5p, and gga-miR-204) highly expressed in both ASAT and plasma were selected as differentially expressed lipid-derived EV miRNAs. To further explore the potential roles of these differentially expressed miRNAs, their expression levels in two types of SEVs were detected by qRT-PCR. The results showed that gga-let-7a-3p exhibited relatively high expression levels in both M-AEVs and M-PEVs. Furthermore, increased gga-let-7a-3p expression was observed in OA-induced ICP1-derived EVs. These findings suggest that gga-let-7a-3p may be a specific regulatory element in chicken adipocyte EVs, playing an important role in hepatic lipid metabolism disorders.

[0041] To further demonstrate whether gga-let-7a-3p can be packaged into ICP1-derived EVs and internalized by primary chicken hepatocytes, 100 nM of gga-let-7a-3p mimicry labeled with cy3 fluorescent dye (red) (sequence: CUAUACAAUCUACUGUCUUUCC) was mixed with 5 μL of Lipofectamine 3000 in Opti-MEM reduced serum medium and incubated at room temperature for 20 min to form a complex. Subsequently, the transfection complex was dropped into each well containing ICP1 cells (a simultaneous EVs secretion inhibition group was set up, which also received 10 mM of the EVs secretion inhibitor GW4869). After transfection, primary chicken hepatocytes were seeded in the lower chamber and co-cultured for 24 h. The localization of cy3-labeled gga-let-7a-3p in primary chicken hepatocytes was observed using laser confocal microscopy, and the expression level of gga-let-7a-3p in hepatocytes in the lower chamber was detected by qRT-PCR.

[0042] The presence of red fluorescent Cy3 dye in hepatocytes indicates that the Cy3-gga-let-7a-3p mimic was delivered from ICP1 in the upper chamber of the Transwell to recipient hepatocytes seeded in the lower chamber. Figure 7 A). Simultaneously with Cy3 staining, the expression abundance of gga-let-7a-3p in ICP1 cells increased 6-fold after co-culture ( Figure 7 B). However, simultaneous addition of the EVs inhibitor GW4869 to ICP1 significantly reduced the abundance of gga-let-7a-3p in hepatocytes (B). Figure 7 C and Figure 7 D). This indicates that gga-let-7a-3p translocates from ICP1 cells to hepatocytes in the form of EVs.

[0043] 2.7 Effects of EVs in ICP1 cell culture supernatant on chicken primary hepatocytes ICP1 cell lines were cultured in high-glucose DMEM medium containing 15% exosome-free fetal bovine serum and 1% penicillin-streptomycin. Treatment with oleic acid (OA; concentration 500 nm) simulated lipid over-accumulation in adipocytes. EVs were collected from the culture supernatant of normal and oleic acid-treated ICP1 cells according to the method described in Chapter 3, 3.2.2.1, and the content of target miRNAs in the EVs was measured. EVs from the OA-treated group were named (OA-EVs), and EVs from the untreated group were named (NC-EVs). These EVs (10¹⁰ particles / mL per well) were added to primary chicken hepatocytes. After 48 h of culture, hepatocytes were collected, and cell viability, lipid droplet deposition, and inflammation levels were measured.

[0044] EVs were collected and isolated from ICP1 cell culture medium. The results showed that the number of EV particles in adipocytes transfected with gga-let-7a-3p mimic or inhibitor (sequence: GGAAAGA CAGUAGAUUGUAUAG) remained unchanged. Figure 8 A and Figure 8 B). However, in the supernatant EVs of ICP1 cells transfected with gga-let-7a-3p mimicry, the level of gga-let-7a-3p was higher than that in the negative control (NC) mimicry group (B). Figure 8 C). In the supernatant EVs of ICP1 cells transfected with a gga-let-7a-3p inhibitor, the level of gga-let-7a-3p was decreased ( Figure 8D). Compared with the control, gga-let-7a-3p levels were higher in ICP1-treated co-cultured hepatocytes overexpressing gga-let-7a-3p. Figure 8 E), but in hepatocytes co-cultured with gga-let-7a-3p knockdown ICP1, gga-let-7a-3p levels were low ( Figure 8 F). The above results indicate that gga-let-7a-3p is involved in the secretion of EVs in ICP1 cells and effectively acts on chicken hepatocytes, regulating the expression level of gga-let-7a-3p in hepatocytes.

[0045] 2.8 Conclusion In vitro and in vivo functional validation experiments showed that extracellular vesicles derived from subcutaneous adipose tissue in the chicken abdomen can be taken up by primary chicken hepatocytes and can be effectively targeted and transported to the liver of chicks via the bloodstream. The differentially expressed miRNA gga-let-7a-3p can be delivered from ICP1 cells to hepatocytes via EVs and affect their function, demonstrating that gga-let-7a-3p is a lipid-selective EVs-miRNA that regulates lipid metabolism disorders in chicken liver.

[0046] The preferred embodiments of the present invention have been described above, but are not intended to limit the invention. Those skilled in the art can make modifications and alterations to the embodiments disclosed herein without departing from the scope and spirit of the invention.

Claims

1. An extracellular vesicle from the subcutaneous adipose tissue in the abdomen of a laying hen with fatty liver syndrome, which was isolated from the subcutaneous adipose tissue in the abdomen of the laying hen with fatty liver syndrome.

2. The extracellular vesicles of subcutaneous adipose tissue in the abdomen of laying hens with fatty liver syndrome according to claim 1, wherein the extracellular vesicles of subcutaneous adipose tissue in the abdomen of laying hens with fatty liver syndrome are obtained by the following steps: the collected subcutaneous adipose tissue in the abdomen of laying hens with fatty liver syndrome is cut into small pieces under sterile conditions and enzymatically hydrolyzed with type II collagenase; the tissue suspension after enzymatic hydrolysis is centrifuged to remove matrix vascular separation material, and a supernatant containing adipocytes is obtained, which is further centrifuged to remove the remaining cell debris; the supernatant is collected and filtered through a 0.22 μm filter to remove larger particles; the filtered supernatant is centrifuged at 4°C to precipitate extracellular vesicles, and the precipitate is resuspended in PBS.

3. The application of the extracellular vesicles in the subcutaneous adipose tissue of the abdomen of laying hens with fatty liver syndrome as described in claim 1 or 2, wherein the extracellular vesicles in the subcutaneous adipose tissue of the abdomen of laying hens with fatty liver syndrome are used to prepare a carrier targeting liver tissue.

4. The application according to claim 3, wherein the liver tissue is chick liver tissue.

5. The application according to claim 3, wherein the carrier encapsulates gga-let-7a-3p, the sequence of which is 5'-CUAUACAAUCUACUGUCUUUCC-3'.

6. The application according to claim 3, wherein the vector encapsulates the gga-let-7a-3 inhibitor, the sequence of which is 5'-GGAAAGA CAGUAGAUUGUAUAG-3'.

7. A complex comprising extracellular vesicles of subcutaneous adipose tissue in the abdomen of laying hens with fatty liver syndrome as described in claim 1 or 2 and gga-let-7a-3p, wherein the sequence of gga-let-7a-3p is: 5'-CUAUACAAUCUACUGUCUUUCC-3'.

8. The use of the complex according to claim 7 in the preparation of a medicament for treating lipid metabolism disorders in chicken liver.

Images