Composition for promoting secretion of extracellular vesicles and application thereof

Abstract

The invention discloses a composition for promoting secretion of extracellular vesicles and application of the composition. The composition for promoting secretion of the extracellular vesicles is prepared from tetramethylpyrazine, salidroside and rapamycin. According to the composition for promoting secretion of the extracellular vesicles, when the mesenchymal stem cells are cultured, the cell state is improved by adjusting components of a culture medium, and on the premise of healthy and normal growth of the cells, serum heterologous exosomes are reduced, the mesenchymal stem cells are promoted to secrete exosomes, and cell replicative aging is prevented.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of extracellular vesicle culture, in particular to a composition for promoting the secretion of extracellular vesicles and application thereof. BACKGROUND

[0002] Extracellular vesicles are membrane structures with a diameter of 10-5000nm secreted by cells, which carry a variety of components as intercellular messengers, including functional molecules such as nucleic acids, proteins, lipids and metabolites reflecting their cell sources. Extracellular vesicles mainly include exosomes (50-200nm), microvesicles (100-1000nm) and apoptotic bodies (500-5000nm).

[0003] Due to the special structure and function of exosomes, it has potential application value. On the one hand, it can be used as a biological indicator for the diagnosis of various diseases, and on the other hand, it can also be used as a treatment method, which may be used as a natural carrier for clinical treatment in the future. For example, studies have shown that exosomes can be used to treat diabetic ulcers, sepsis, etc. In recent years, studies have gradually confirmed that exosomes secreted by mesenchymal stem cells can mimic the biological functions of mesenchymal stem cells.

[0004] The yield of exosomes has always been a concern for researchers, and obtaining a large amount of high-purity exosomes is crucial for subsequent research. Exosomes are derived from cells, and their quality is affected by cell sources, state and culture conditions. Therefore, how to control their quality or improve their function through cell culture is worth studying. SUMMARY

[0005] The purpose of the present application is to provide a new composition for promoting the secretion of extracellular vesicles and application thereof.

[0006] The present application adopts the following technical solutions:

[0007] One aspect of the present application discloses a composition for promoting the secretion of extracellular vesicles, comprising tetramethylpyrazine, rhodioloside and rapamycin.

[0008] Preferably, the composition of the present application is composed of tetramethylpyrazine 10-30 parts by weight, rhodioloside 50-200 parts by weight and rapamycin 5-20 parts by weight.

[0009] Another aspect of the present application discloses the application of the composition of the present application in preparing a reagent for promoting mesenchymal stem cells to secrete extracellular vesicles.

[0010] Another aspect of the present application discloses the application of the composition of the present application in preparing a reagent for preventing cell aging.

[0011] Another aspect of the present application discloses a culture medium containing the composition of the present application.

[0012] Preferably, the culture medium of the present application is a complete medium.

[0013] The complete medium of the present application, i.e. the medium formed by adding some natural substances rich in amino acids, vitamins and bases, etc. into the basic medium, such as adding bovine serum albumin, etc.

[0014] Preferably, the concentration of tetramethylpyrazine in the culture medium is 10-30 μg / mL, the concentration of salidroside is 50-200 μg / mL, and the concentration of rapamycin is 50-20 μg / mL.

[0015] Another aspect of the present application discloses a method for extracting exosomes from mesenchymal stem cells, comprising culturing mesenchymal stem cells in the culture medium of the present application or culturing mesenchymal stem cells in the culture medium of the present application, and then harvesting the supernatant and extracting exosomes from the supernatant.

[0016] Preferably, the mesenchymal stem cells are cells cultured to P3 generation.

[0017] Preferably, the composition of the present application is added to the culture medium of the mesenchymal stem cells after the cells adhere to the wall, or the culture medium of the present application is replaced after the cells adhere to the wall, i.e. the complete culture medium containing the composition of the present application.

[0018] Preferably, the supernatant is collected for exosome extraction when the mesenchymal stem cells are at least 80% confluent.

[0019] Preferably, after centrifugal pretreatment of the supernatant, tangential flow ultrafiltration concentration is performed, and the concentrated solution is filtered and sterilized, i.e. the exosomes are obtained.

[0020] Preferably, the centrifugal pretreatment comprises the following steps:

[0021] The supernatant is collected and filtered through a 40-mesh screen, and the filtrate is subjected to subsequent treatment;

[0022] The filtrate is centrifuged at 300-500g for at least 10 min, the precipitate is removed, and the supernatant is taken;

[0023] The supernatant is centrifuged at 2000-3000g for at least 10 min, the precipitate is removed, and the supernatant is taken;

[0024] The supernatant is centrifuged at 9000-10000g for at least 30 min, the precipitate is removed, and the supernatant is taken, which is used for subsequent tangential flow ultrafiltration concentration.

[0025] Preferably, the tangential flow ultrafiltration device is pre-rinsed with 0.1M NaOH solution and sterile water solution, and a 300KD polyether sulfone membrane bag is selected, and the transmembrane pressure is 12 Psi.

[0026] Preferably, after concentrating to 1 / 10 of the original volume, an equal volume of PBS buffer is added to continue circulating to wash out the supernatant remaining in the membrane bag and pipeline, and then concentrated to 1 / 10 of the original volume again, to obtain the concentrated liquid for subsequent sterile filtration.

[0027] Preferably, the sterile filtration is performed using a 0.22μm filter.

[0028] It should be noted that the exosomes extracted in the present application have a diameter of 50-200nm; therefore, the 0.22μm filter is used, and the exosomes can pass through the filter, while the larger volume bacteria are removed by filtration.

[0029] The present application has the following beneficial effects:

[0030] The composition for promoting the secretion of extracellular vesicles in the present application improves the cell state by adjusting the culture medium composition when culturing mesenchymal stem cells, reduces serum heterologous exosomes under the premise of normal growth of healthy cells, promotes the secretion of exosomes by mesenchymal stem cells, and prevents cell replicative senescence. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 is the morphology of P15 cells normally cultured in the embodiments of the present application (P15-con) and the morphology of P15 cells induced by stimulation culture (P15-stimulated);

[0032] Figure 2 is a statistical diagram of the relative expression amount of senescence-related secretory phenotype IL-6, IL-8, IL-1β mRNA of P3 generation and continuously subcultured P15 cells in the embodiments of the present application;

[0033] Figure 3 is a detection result diagram of exosome CD63, CD9 protein expression in the embodiments of the present application;

[0034] Figure 4 is a statistical result diagram of CD63, CD9 protein relative expression amount in the embodiments of the present application;

[0035] Figure 5 is a result diagram of nanoparticle tracking analysis (NTA) for determining the concentration and particle size distribution of exosomes in the embodiments of the present application;

[0036] Figure 6 is a result diagram of transmission electron microscopy (TEM) for observing the morphology of exosomes in the embodiments of the present application;

[0037] Figure 7 is a mouse bone marrow pathological morphology observation result chart in the embodiment of the application;

[0038] Figure 8 is a mouse peripheral blood blood cell count result chart in the embodiment of the application;

[0039] Figure 9 is a mouse spleen index and thymus index detection result chart in the embodiment of the application. DETAILED DESCRIPTION

[0040] Exosomes are derived from cells, and the quality is affected by the cell source, state and culture conditions. By adjusting the culture medium composition, adding soluble factors and the like to improve the cell state, under the premise of normal growth of healthy cells, as much as possible to reduce the heterologous exosomes in the serum, promote mesenchymal stem cells to secrete exosomes. Therefore, we culture the cells by the combination of tetramethylpyrazine, rhodioloside and rapamycin to promote the secretion of exosomes, and prevent the replicative senescence of cells. Then, the tangential flow ultrafiltration technology is used to filter and separate the cell supernatant, and the obtained exosomes are characterized and identified. Through the bone marrow exhaustion mouse model experiment, it is evaluated that the exosomes secreted by mesenchymal stem cells have the effects of promoting hematopoietic recovery and immune regulation.

[0041] The application will be described in detail below by specific embodiments in conjunction with the drawings. The following examples are only used to illustrate the application, and should not be understood as limiting the application. The materials used in the following experiments are all commonly purchased unless otherwise specified.

[0042] EMBODIMENT

[0043] I. Main materials

[0044] Human umbilical cord mesenchymal stem cells (provided by Shenzhen Qianhai Shekou Pilot Free Trade Zone Hospital), serum-free medium (Tianjin Haoyang), 0.25% trypsin containing EDTA (Gibco), phosphate buffer (PBS) (Gibco), tetramethylpyrazine (McLin), rhodioloside (McLin), rapamycin (McLin).

[0045] II. Methods

[0046] 1. Mesenchymal stem cell culture

[0047] Select the excellent umbilical cord of patients who have no complications during pregnancy and deliver full-term infants by cesarean section (provided by Shenzhen Qianhai Shekou Pilot Free Trade Zone Hospital), and immerse it in a PBS solution containing double antibiotics (penicillin-streptomycin double antibiotic solution, 1% concentration) under sterile conditions. In a sterile clean bench, place the umbilical cord tissue in a culture dish with tweezers, wash it thoroughly with PBS solution to remove excess blood stains, peel off the outer skin of the umbilical cord tissue, remove the arteries and veins, and expose the Wallontian glue for separation. Cut it into 1-2 mm3 The tissue was evenly pasted to a 175 cm 2 culture flask, and a special medium for human mesenchymal stem cells (Tianjin Haoyang serum-free culture medium) was added to the flask. The flask was placed in a 37°C incubator with a saturated humidity and a 5% CO2 volume fraction for about 12 days, and the medium was changed every three days. When the cells around the tissue block grew to 80% confluence, the cells were washed twice with PBS, 0.25% trypsin containing EDTA was added for digestion, and then a stop solution was added. The cell suspension was transferred to a 50 mL centrifuge tube and centrifuged at 500 g for 5 min. After resuspension with complete medium, the cells were passaged at a ratio of 1:5, and the culture was continued to the P3 generation for use.

[0048] 2. Exosome secretion induction

[0049] P3 umbilical cord mesenchymal stem cells in good growth condition were selected for culture. After the cells adhered, 20 μg / mL tetramethylpyrazine, 100 μg / mL rhodioloside, and 10 μg / mL rapamycin were added for continuous culture for 48 h to promote exosome secretion of stem cells and prevent stem cell replicative senescence.

[0050] 3. Purification and testing of exosomes

[0051] The supernatant of the above P3 generation mesenchymal stem cells (at 80% confluence) was harvested, pretreated by primary centrifugation, concentrated by tangential flow ultrafiltration equipment to obtain a sample, and after sterilization by 0.22 μm filtration, the vesicles were obtained for characterization and identification, and the vesicles were preliminarily detected for effectiveness by in vitro cell experiments.

[0052] The specific operation steps are as follows:

[0053] Step one, collect 150 mL of supernatant and filter through a 40-mesh cell screen.

[0054] Step two, centrifuge the supernatant at 300 g for 10 min, remove the precipitate (cells), and take the supernatant.

[0055] Step three, centrifuge the supernatant at 2000 g for 10 min, remove the precipitate (dead cells), and take the supernatant.

[0056] Step four, centrifuge the supernatant at 10,000 g for 30 min, remove the precipitate (cell fragments), and take the supernatant.

[0057] Step five, add the 150 mL of centrifuged supernatant to the tangential flow equipment for filtration (previously rinsed with 0.1 M NaOH solution and sterile water solution), select a 300 KD polyether sulfone membrane package, and the transmembrane pressure is 12 Psi.

[0058] Step six, when the liquid in the sample tank flows to about 15 mL (about 1 hour), add 15 mL of PBS buffer to continue circulating to flush out the residual supernatant in the membrane bag and pipeline. When the liquid in the tank flows to about 15 mL, open the valve to take out the liquid, which is the concentrated liquid after ultrafiltration, containing the exosomes we need.

[0059] Step seven, filter the obtained concentrated liquid through a 0.22 μm filter, label the corresponding information, and store at -80℃.

[0060] The samples were subjected to BCA protein concentration determination (Bi Yun Tian Biotechnology Co., Ltd.), and Western Blot detection of CD63 and CD9 protein expression (antibodies from Abeam); particle size and concentration were analyzed using a nanoparticle size analyzer; and the morphology of the vesicles was detected using a transmission electron microscope.

[0061] P3 MSCs cultured normally (labeled as P3), P15 MSCs cultured continuously (labeled as P15-con), P15 MSCs cultured continuously with the addition of tetramethylpyrazine (TMP) (labeled as P15-TMP), P15 MSCs cultured continuously with the addition of salidroside (Sal) (labeled as P15-Sal), P15 MSCs cultured continuously with the addition of rapamycin (Rapa) (labeled as P15-Rapa), and P15 MSCs cultured continuously with the addition of a composition (tetramethylpyrazine, salidroside, and rapamycin) (labeled as P15-Stimulated) were detected, and the cell senescence-related secretion phenotype of these MSCs was detected, i.e., the mRNA expression levels of inflammatory factors IL-6, IL-8, and IL-1β of these MSCs were detected by qRT-PCR. The PCR amplification kit and reverse transcription kit used in this example were purchased from Nanjing Novozyme Biotech. The specific detection method is as follows:

[0062] Total RNA extraction: remove cell culture medium, wash once with PBS buffer. Then add 500 μL of Lysis Buffer solution, use a pipette to repeatedly blow and suck 10 times or so, then transfer the cell suspension to an EP tube, shake on a vortex for 10 s to fully lyse the cells. Add an equal amount (500 μL) of absolute ethanol to the lysed cells and mix well, use the pipette to repeatedly blow and suck to disperse the precipitate, then transfer to a centrifugal column. Place in a centrifuge at 4000 g for 1 min. Discard the liquid after centrifugation, add 500 μL of Wash Buffer, centrifuge at 12000 g for 1 min. After centrifugation, remove the column and discard the waste, place the column back in the collection tube, and centrifuge the empty tube again to remove residual Wash Buffer. Transfer the column to a clean RNase-free EP tube, open the lid for 2 min to dry. Add 20 μL of Elution Buffer to the center of the RNA column membrane, close the lid and stand for 2 min. Centrifuge at 12000 g for 1 min, and the eluted RNA sample is in the EP tube, which is placed on ice. Measure the RNA concentration of the sample on a spectrophotometer, label and store in a -80°C refrigerator.

[0063] Reverse transcription: prepare the following mixture in an RNase-free PCR tube: 5x All-in-one qRT SuperMix 4 μL, Enzyme Mix 1 μL, template RNA 1 μg, and RNase-free ddH2O to 20 μL.

[0064] Gently blow 8-10 times with a pipette to mix well, and centrifuge briefly to collect at the bottom of the tube. Then perform the reaction according to the program of 50°C for 15 min and 85°C for 5 s. The product after the reaction can be used immediately for qPCR reaction, or stored at -80°C after aliquoting to avoid repeated freeze-thawing.

[0065] qPCR reaction: prepare the following mixture in a qPCR tube: 2x Taq Pro Universal SYBR qPCR Master Mix 10 μL, Primer 1 (10 μM) 0.4 μL, Primer 2 (10 μM) 0.4 μL, template DNA / cDNA 1 μL, and ddH2O to 20.0 μL.

[0066] Centrifuge briefly to collect at the bottom of the tube, then perform qPCR reaction according to the following conditions: 95°C for 30 s, then 40 cycles of 95°C for 10 s, 60°C for 30 s, after the cycle, 1 cycle of melting program: 95°C for 10 s, 65°C for 60 s, 97°C for 1 s, and then 37°C for 30 s.

[0067] The CT values obtained were evaluated for target gene expression using the 2-ΔΔCT method, with GAPDH as the internal control.

[0068] The primer sequences used in the experiment are as follows:

[0069] IL-6 upstream primer: ACTCACCTCTTCAGAACGAATTG (Seq ID No. 1)

[0070] IL-6 downstream primer: CCATCTTTGGAAGGTTCAGGTTG (Seq ID No. 2)

[0071] IL-8 upstream primer: ACTGAGAGTGATTGAGAGTGGAC (Seq ID No. 3)

[0072] IL-8 downstream primer: AACCCTCTGCACCCAGTTTTC (Seq ID No. 4)

[0073] IL-1β upstream primer: ATGATGGCTTATTACAGTGGCAA (Seq ID No. 5)

[0074] IL-1β downstream primer: GTCGGAGATTCGTAGCTGGA (Seq ID No. 6)

[0075] 4. Effect of exosomes on bone marrow failure mouse model

[0076] Establishment of bone marrow failure mouse model: Healthy male ICR mice (8 weeks old, body weight 20±2g) (mice purchased from the Experimental Animal Center of Southern Medical University) were intraperitoneally injected with busulfan (20mg / kg) and cyclophosphamide (80mg / kg) every day for 7 consecutive days. The control group of mice received the same volume of PBS. On the 8th day, the exosomes were dissolved in 100μL of phosphate buffered saline (PBS) (exosome concentration 1μg / μL), and injected into the model mice through the tail vein (injection volume 100μL). The control group of mice were injected with the same amount of PBS.

[0077] The disease model was established by continuous injection of busulfan and cyclophosphamide for 1-7 days, and exosome injection was performed on the 8th day (1 injection). After injection, the mice were raised according to the conventional method until the 15th day.

[0078] The mice were divided into four groups: normal mouse control group (Control group, injected with PBS); bone marrow failure model group (AA model group, injected with PBS); bone marrow failure mouse treatment group 1 (NC-EVs, injected with exosomes from normal cultured MSCs); bone marrow failure mouse treatment group 2 (Stimulated-EVs, injected with exosomes from MSCs stimulated to secrete).

[0079] On day 15, blood was drawn from the orbital venous plexus of mice to observe the occurrence of pancytopenia. Blood cell counts were analyzed using a veterinary blood cell counter (Mindray, China). Mice were euthanized with carbon dioxide, and the spleen and thymus were immediately removed. Adipose tissue was removed, and blood was absorbed from the surface using filter paper. The weight of the thymus and spleen was measured using a precision electronic balance, and the ratio of thymus and spleen weight to body weight was calculated.

[0080] III. Results and Analysis

[0081] 1. Detection results of cell morphology and aging-related secretory phenotypes

[0082] This study examined the morphology of normally cultured P15 cells (P15-con) and stimulated P15 cells (P15-stimulated), and also detected the relative mRNA expression levels of senescence-related secretory phenotypes IL-6, IL-8, and IL-1β in P3 and continuously passaged P15 cells. The results are as follows: Figure 1 and Figure 2 As shown.

[0083] Figure 1 The morphology of P15 cells in normal culture (P15-con) and P15 cells in culture induced by stimulation (P15-stimulated) are shown. Figure 1 The results showed that P15-con were continuously cultured P15 generation MSCs, which had low cell density and shorter, larger cell morphology under the microscope. P15-stimulated were continuously cultured P15 generation MSCs supplemented with a combination of tetramethylpyrazine, rhodioloside, and rapamycin, which had high cell density, maintained a good proliferation rate, and had a long spindle-shaped cell morphology under the microscope.

[0084] Figure 2The mRNA expression levels of cell senescence-related secretory phenotype (inflammatory factors IL-6, IL-8 and IL-1β) were detected by qRT-PCR. Among them, P3: P3 generation MSCs cultured normally; P15-con: P15 generation MSCs cultured continuously; P15-TMP: P15 generation MSCs cultured continuously with the addition of tetramethylpyrazine (TMP); P15-Sal: P15 generation MSCs cultured continuously with the addition of salidroside (Sal); P15-Rapa: P15 generation MSCs cultured continuously with the addition of rapamycin (Rapa); P15-Stimulated: P15 generation MSCs cultured continuously with the addition of the composition (tetramethylpyrazine, salidroside and rapamycin); "*" is compared with P15-con group, P<0.05, with statistical difference.

[0085] Figure 2 It can be seen from the results that the expression level of inflammatory factors of P15 generation (P15-con) cells is higher than that of P3 generation cells, and there is cell senescence. The expression level of inflammatory factors of P15 generation MSCs cultured continuously with the addition of the composition (tetramethylpyrazine, salidroside and rapamycin) is significantly reduced, and the effect is better than that of adding any one of them, and the composition can reduce cell senescence-related secretory phenotype.

[0086] 2. Characterization detection results of exosomes

[0087] The detection results of exosome CD63 and CD9 protein expression are shown in Figure 3 and Figure 4 . Figure 3 The protein expression levels of exosome surface markers were detected by Western Blot; among them, NC-EVs: exosomes secreted by MSCs cultured normally, Stimulated-EVs: exosomes secreted by MSCs cultured with the addition of the composition. Figure 3 It can be seen from the results that the CD63 and CD9 protein expression levels of exosomes secreted by MSCs cultured with the addition of the composition are higher, and the composition can promote MSCs to secrete exosomes.

[0088] Figure 4 The statistical results of the gray values of exosome surface marker proteins detected by Western Blot are shown. NC-EVs: exosomes secreted by MSCs cultured normally, Stimulated-EVs: exosomes secreted by MSCs cultured with the addition of the composition. "*" is compared with NC-EVs group, P<0.05, with statistical difference. Figure 4The results show that the CD63 and CD9 protein expression levels of the exosomes secreted by the MSCs cultured with the composition are higher, and the composition can promote the secretion of exosomes by MSCs.

[0089] The nanoparticle size analyzer detects the particle size distribution of the exosomes as shown in Figure 5 . Figure 5 The results show that the particle size of the exosomes secreted by the MSCs cultured normally and the exosomes secreted by the MSCs stimulated by the composition are 100-200 nm, and the isolated vesicles meet the general characteristics of exosomes.

[0090] The transmission electron microscope analyzes the morphology of the exosomes as shown in Figure 6 . Figure 6 The results show that the exosomes secreted by the MSCs cultured normally and the exosomes secreted by the MSCs stimulated by the composition both present a vesicle structure wrapped by a capsule membrane, meeting the general characteristics of exosomes, and under the microscope, the number of exosomes in the composition stimulation group is relatively more.

[0091] 3. Detection results of the effects of exosomes on the hematopoiesis and immune function of mice

[0092] The HE staining results of the femur pathological tissues of mice are shown in Figure 7 . Figure 7 The results show that, compared with the bone marrow tissue of normal mice (Control group), the bone marrow hematopoietic tissue of the bone marrow failure model mice (AA-model group) decreases, and the non-hematopoietic tissue (fat bubble) increases, meeting the general characteristics of the bone marrow failure disease model. The bone marrow hematopoietic tissue of the mice treated with normal exosomes (NC-EVs group) does not recover obviously, and the non-hematopoietic tissue still exists obviously. The bone marrow hematopoietic tissue of the mice treated with the exosomes secreted by the MSCs stimulated by the composition (Stimulate-EVs group) recovers obviously, and the hematopoietic tissue increases. It can be seen that the exosomes in the composition stimulation group can obviously promote the recovery of bone marrow hematopoiesis.

[0093] The peripheral blood cell count of mice is shown in Figure 8 . Figure 8 In the table, Hb: hemoglobin; PLT: platelet; RBC: red blood cell; WBC: white blood cell. "*" means P<0.05, with statistical difference compared with the AA-model group. Figure 8The results showed that, compared with normal mice (Control group), the peripheral blood cell count of the bone marrow failure model mice (AA-model group) was significantly reduced, consistent with the general characteristics of bone marrow failure disease models. In contrast, the blood cell counts of mice treated with exosomes (NC-EVs group and Stimulate-EVs group) were significantly increased. In particular, the red blood cell and white blood cell counts of mice treated with stimulated exosome secretion (Stimulate-EVs group) were significantly restored, indicating that the exosomes in the combined stimulation group could significantly promote the recovery of hematopoiesis in mice.

[0094] Mouse immune organ indices such as Figure 9 As shown. Figure 9 In the figures, "*" indicates a statistically significant difference compared to the AA-model group (P < 0.05). The results show that, compared to normal mice (Control group), the spleen and thymus indices of the bone marrow failure model mice (AA-model group) were significantly reduced, consistent with the general characteristics of bone marrow failure disease models. Mice treated with exosomes (NC-EVs group and Stimulate-EVs group) showed increased immune organ indices, especially the spleen and thymus indices of mice treated with stimulated exosome secretion (Stimulate-EVs group), indicating that the exosomes in the combined stimulation group significantly promoted the recovery of immune function in mice.

[0095] The above description, in conjunction with specific embodiments, provides a detailed explanation of this application and should not be construed as limiting the implementation of this application to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the basic inventive concept of this application.

Claims

1. A composition for promoting extracellular vesicle secretion, characterized in that: These include tetramethylpyrazine, rhodioloside, and rapamycin.

2. The composition according to claim 1, characterized in that: It consists of 10-30 parts by weight of tetramethylpyrazine, 50-200 parts by weight of rhodioloside and 5-20 parts by weight of rapamycin.

3. The use of the composition according to claim 1 or 2 in the preparation of a reagent that promotes the secretion of extracellular vesicles by mesenchymal stem cells.

4. Use of the composition according to claim 1 or 2 in the preparation of a reagent for preventing cell senescence.

5. A culture medium, characterized in that: Contains the composition according to claim 1 or 2.

6. The culture medium according to claim 5, characterized in that: The culture medium is a complete culture medium.

7. The culture medium according to claim 5 or 6, characterized in that: The concentration of tetramethylpyrazine in the culture medium is 10-30 μg / mL, the concentration of rhodioloside is 50-200 μg / mL, and the concentration of rapamycin is 50-20 μg / mL.

8. A method for extracting exosomes from mesenchymal stem cells, characterized in that: The method includes culturing mesenchymal stem cells in a culture medium containing the composition of claim 1 or 2, or culturing mesenchymal stem cells in a culture medium according to any one of claims 5-7, and then harvesting the supernatant and extracting exosomes from the supernatant.

9. The method according to claim 8, characterized in that: The mesenchymal stem cells are cells passaged to the P3 generation. Preferably, after the mesenchymal stem cells adhere to the culture medium, the composition of claim 1 or 2 is added to their culture medium, or the culture medium of any one of claims 5-7 is used for culturing.

10. The method according to claim 8 or 9, characterized in that: When mesenchymal stem cells reach at least 80% confluence, the supernatant is collected for exosome extraction. Preferably, after centrifugation pretreatment of the supernatant, tangential flow ultrafiltration concentration is performed, and the concentrate is filtered and sterilized to obtain the exosomes; Preferably, the centrifugation pretreatment includes the following steps: Collect the supernatant and filter it through a 40-mesh sieve. The filtrate is then subjected to further treatment. Centrifuge the filtrate at 300-500g for at least 10 minutes to remove the precipitate and collect the supernatant; Centrifuge the supernatant at 2000-3000g for at least 10 minutes to remove the precipitate and collect the supernatant. Centrifuge the supernatant at 9000-10000g for at least 30 minutes to remove the precipitate, and collect the supernatant for subsequent tangential flow ultrafiltration concentration; Preferably, the tangential flow ultrafiltration equipment is pre-washed with 0.1M NaOH solution and sterile aqueous solution, and a 300KD polyethersulfone membrane is selected, with a transmembrane pressure of 12Psi; Preferably, after concentrating to 1 / 10 of the original solution volume, an equal volume of PBS buffer is added to continue circulating to flush out the supernatant remaining in the membrane and tubing, and then concentrated again to 1 / 10 of the original solution volume to obtain the concentrated solution for subsequent filtration and sterilization. Preferably, the filtration and sterilization is performed using a 0.22μm filter.

Images