Arabidopsis thaliana circadian rhythm expression system, construction method and application

Abstract

The invention relates to the technical field of molecular biology, in particular to an arabidopsis thaliana circadian rhythm expression system, a construction method and application, and the system comprises a carrier I and a carrier II; the first vector is composed of a pCPE-Dest vector skeleton, an AtCAT3 promoter of an arabidopsis thaliana endogenesis and a target gene and can drive high expression of the gene at night. And the vector II is composed of a pCPE-Dest vector skeleton, an AtCAB2 promoter of an endogenous arabidopsis thaliana and a target gene, and can drive the daytime high expression of the gene. The system allows the to-be-detected gene to be expressed in arabidopsis thaliana in different day and night expression time phases under the driving of different promoters, and can directly explore the influence on plant physiological activities when the gene expression rhythm is changed; a to-be-detected gene is allowed to be replaced at multiple cloning sites through an enzyme digestion ligation reaction, and promoters with different expression time phases are replaced by using a Gateway technology to drive gene expression. The experiment is simple and the cost is low.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, in particular to a diurnal rhythm expression system of Arabidopsis thaliana, a construction method and application. BACKGROUND

[0002] Diurnal rhythm expression of plant genes is crucial for plant adaptation to environmental changes and response to stress, and in-depth study of its regulation mechanism helps to balance plant growth and stress response, thereby achieving crop yield maximization and providing solutions to global food crisis.

[0003] Arabidopsis thaliana is the most common model plant, and heterologous expression of genes from different crops or plants in Arabidopsis thaliana is a classic method for verifying gene function. Diurnal rhythm expression of genes is of great significance for plant physiological activities and environmental adaptation. In order to reveal the physiological function of genes with diurnal expression rhythm, they can be heterologously expressed in Arabidopsis thaliana, and the growth of transgenic plants in different environments can be detected.

[0004] Nowadays, gene heterologous Arabidopsis transformation and expression often use constant expression promoters (such as 35S and 2X35S) or use the gene itself promoter to drive expression. p35S , pUBQ 35S and 2X35S are the most commonly used constant expression promoters. p35S and pUBQ 35S is a strong expression promoter that can drive genes to be highly expressed in almost all plant tissues, and is less affected by environmental factors (such as light, hormones, etc.), so it is more commonly used in research on overexpression of target genes to observe phenotypes, but it is not suitable for research that requires fine regulation, such as gene expression level research at different times or under different light conditions. p35S The UBIQUITIN promoter is the promoter of the endogenous ubiquitin gene in plants, and the expression intensity is slightly lower than 35S, close to the expression level of endogenous genes. The gene expression driven by this promoter is more stable and uniform, and is more suitable for long-term phenotype observation research, but it also has the disadvantage of insufficient expression, so neither of the two is suitable for plant gene rhythm expression research. On the other hand, using the gene itself promoter, on the one hand, since it is heterologous Arabidopsis expression, the promoter may not work normally or as in the original plant, on the other hand, the most ideal case of this promoter can only replicate the diurnal rhythm expression of the original plant gene in Arabidopsis thaliana. In order to effectively and directly study the influence of gene rhythm expression on plants, drive the gene to express in phase and anti-phase relative to the original rhythm, more information can be obtained. pUBQ Therefore, there is an urgent need to develop a new promoter to construct a diurnal rhythm expression system of Arabidopsis thaliana.

[0005] SUMMARY

[0006] To solve the above problems, the present application provides a diurnal rhythm expression system of Arabidopsis thaliana, a construction method and application.​

[0007] The present application is realized by the following technical scheme: A set of Arabidopsis thaliana circadian rhythm expression system, which comprises a carrier one and a carrier two; The carrier one is composed of a pCPE-Dest carrier, an endogenous Arabidopsis thaliana AtCAT3 Promoter and a target gene, which can drive high expression of the gene at night.

[0008] The carrier two is composed of a pCPE-Dest carrier, an endogenous Arabidopsis thaliana AtCAB2 Promoter and a target gene, which can drive high expression of the gene during the day.

[0009] Preferably, the AtCAT3 Promoter has a base sequence as shown in SEQ ID NO. 2; and the AtCAB2 Promoter has a base sequence as shown in SEQ ID NO. 3.

[0010] Preferably, the pCPE-Dest carrier has a base sequence as shown in SEQ ID NO. 4.

[0011] Preferably, the construction method of the Arabidopsis thaliana circadian rhythm expression system comprises the following steps: The target gene is inserted into the multiple cloning site of the pCPE-Dest carrier by enzyme digestion and ligation to obtain a target gene expression vector.

[0012] The AtCAT3 Promoter and the AtCAB2 Promoter are respectively cloned into the pDONR207 carrier by Gateway BP reaction to obtain two entry clones pDONR207-pAtCAT3 and pDONR207-pAtCAB2.

[0013] The pDONR207-pAtCAT3 and the pDONR207-pAtCAB2 are respectively recombined with the target gene expression vector by Gateway LR reaction to obtain a final expression clone.

[0014] Preferably, the target gene is inserted into the carrier through a restriction endonuclease HindIII site, and the target gene is a SiVAMP721 Gene from Setaria italica or a homologous gene thereof.

[0015] A method for regulating the expression of plant genes in circadian rhythm, the method is that the vector one in claim 1 is transformed into Arabidopsis thaliana by Agrobacterium transformation method to obtain transgenic Arabidopsis thaliana one; the vector two in claim 1 is transformed into Arabidopsis thaliana by Agrobacterium transformation method to obtain transgenic Arabidopsis thaliana two; the transgenic Arabidopsis thaliana one and the transgenic Arabidopsis thaliana two are alternately cultured under 8h~16h light and 8h~16h darkness for 13 days~15 days; the leaves of Arabidopsis thaliana are taken at 8:00 and 20:00 respectively, and the expression level of the target gene in the transgenic Arabidopsis thaliana one and the transgenic Arabidopsis thaliana two is detected by qRT-PCR to determine the diurnal expression rhythm.

[0016] Preferably, the Arabidopsis thaliana is alternately cultured under 16h light and 8h darkness, 12h light and 12h darkness or 8h light and 16h darkness.

[0017] Preferably, the Agrobacterium is GV3101.

[0018] The application of the Arabidopsis thaliana circadian rhythm expression system in the research of plant gene function, the application includes: Research on the influence of the change of gene expression circadian rhythm on plant physiological activities.

[0019] Comparison of the differences of plant phenotypes caused by the in-phase and anti-phase circadian rhythm expression of genes.

[0020] Evaluation of the role of gene circadian rhythm regulation expression in plant environmental adaptation.

[0021] Preferably, the plant is Arabidopsis thaliana (Arabidopsis thaliana). Arabidopsis thaliana ).

[0022] Preferably, the gene includes but is not limited to SiVAMP721 Genes and their homologous genes.

[0023] Compared with the prior art, the present application has the following beneficial effects: The present application provides an Arabidopsis thaliana circadian rhythm expression system, the system includes a vector one and a vector two; The vector one is composed of a pCPE-Dest vector, an endogenous AtCAT3 Promoter of Arabidopsis thaliana and a target gene, which can drive high expression of genes at night; the vector two is composed of a pCPE-Dest vector, an endogenous AtCAB2The promoter and the target gene constitute a structure capable of driving high expression of the gene during the day. The system of the present application allows the target gene to be expressed in Arabidopsis thaliana under the driving of different promoters with different diurnal expression phases, and the influence of changing the expression rhythm phase of the gene on the physiological activity of the plant can be directly explored. Moreover, the system of the present application allows the target gene to be replaced by enzyme digestion and ligation reaction at the multiple cloning site and the Gateway technology to be used to replace the promoter driving gene expression with different expression phases. The experiment is simple and low in cost. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0025] Figure 1 The basic structure diagram of the pCPE-Dest expression vector of the present application.

[0026] Figure 2 The application example of the expression cloning of the present application.

[0027] Figure 3 The expression level of the gene in the transgenic Arabidopsis thaliana of the present application. SiVAMP721 The expression level of the gene in the transgenic Arabidopsis thaliana of the present application. SiVAMP721 The complemented plant of pCPE-pAtCAT3 promoter. SiVAMP721 The complemented plant of pCPE-pAtCAB2 promoter. DETAILED DESCRIPTION

[0028] In order to facilitate the understanding of the present application, the present application will be described more fully below, and the preferred embodiments of the present application are given. However, the present application can be realized in many different forms, and is not limited to the embodiments described in the present application. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0029] Unless otherwise defined, all technical and scientific terms used in the present application have the same meanings as commonly understood by those skilled in the art to which the present application belongs. The terms used in the present application are only for the purpose of describing the specific embodiments of the present application, and are not intended to limit the present application.

[0030] The expression cloning of the pCPE-pAtCAT3 promoter and the pCPE-pAtCAB2 promoter is taken as an example to illustrate the technical solutions of the present application. SiVAMP721 The pDONR207-AtCAT3p promoter and the pDONR207-AtCAB2p promoter are constructed, respectively. AtCAT3 The pDONR207-AtCAT3p promoter and the pDONR207-AtCAB2p promoter are constructed, respectively. AtCAB2 The technical solutions of the present application are illustrated by taking the expression cloning of the pCPE-pAtCAT3 promoter and the pCPE-pAtCAB2 promoter as an example. The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments are commercially available.

[0031] pDONR207-AtCAT3p in the following examples AtCAT3 (promoter) and pDONR207-AtCAB2p ( AtCAB2 The introductory clone of the promoter can be obtained from Professor Zhang Ben's research group at the School of Life Sciences, Shanxi University. This biomaterial is only for repeating the relevant experiments of this invention and cannot be used for other purposes.

[0032] Example 1 1. Carrier Construction (with cartoon diagram and sequence) Through gene synthesis, such as Figure 1 The pCPE-Dest vector plasmid is shown. This vector contains a Gateway frame (attR1-attR2 sites) containing the CCDB gene and the chloramphenicol resistance gene (CmR), used for inserting the promoter sequence via the Gateway reaction; a Multiple Cloning Site (containing HindIII, BamHI, PstI, KpnI, and SacI restriction endonuclease recognition sites), used for inserting the target gene sequence via restriction enzyme digestion and ligation reactions; a nos terminator; and a hygromycin resistance gene for screening transforming positive plants. The vector backbone also includes a kanamycin resistance gene for amplification and screening in *E. coli*, a pBR322 origin of replication, and a replicon of the *Pseudomonas* plasmid pVS1 (used to stabilize the plasmid in *Agrobacterium* for easy plant transformation).

[0033] Millet SiVAMP721 The gene is used as an application example. This gene is expressed in all tissues of millet, and its expression level does not exhibit a diurnal rhythm characteristic; see reference: Wang et al. Plant Growth Regulation (2021) 95:355–369 (expressed in all tissues). Zhang Ben et al., Chinese Journal of Biochemistry and Molecular Biology.

[0034] (2023) 39(1):96 ~ 107 (no diurnal rhythm characteristics were observed). Millet was obtained by accessing the Phytozome database (https: / / phytozome-next.jgi.doe.gov).SiVAMP721 The CDS sequence of the gene was obtained, and based on the sequence, forward and reverse primers were designed, a restriction enzyme HindIII enzyme site was introduced into the primers, and the gene was inserted into the pCPE-Dest vector through enzyme digestion and ligation. AtCAT3 and AtCAB2 The promoter sequence of the gene was obtained by accessing the Phytozome database (https: / / phytozome-next.jgi.doe.gov), and based on the sequence, forward and reverse primers were designed. After PCR, the PCR product was subjected to agarose gel electrophoresis, and the target band was cut and recovered. The recovered product was subjected to a BP reaction with the vector pDONR207, and two gateway entry clones pDONR207-pAtCAT3 and pDONR207-pAtCAB2 were obtained. The two gateway entry clones and the pCPE-Dest vector containing the gene were subjected to a LR reaction to obtain the final vector, which was pCPE-pAtCAT3 and pCPE-pAtCAB2, respectively. SiVAMP721 The pCPE-Dest vector containing the gene was subjected to a LR reaction to obtain the final vector, which was pCPE-pAtCAT3 and pCPE-pAtCAB2, respectively. pAtCAT3 - SiVAMP721 and pCPE- pAtCAB2 - SiVAMP721 These two are called expression clones, as Figure 2 indicated.

[0035] 2. Transformation The two expression clones were transformed into Agrobacterium (GV3101), and the Agrobacterium was inoculated into a resistant medium (the resistance is R+G+X, where R and G are Agrobacterium resistance, and X is clone resistance). The medium was incubated at 28°C on a shaker until OD600≈0.8. An infection solution (50 g / L sucrose, 500 µL / L Arabidopsis helper solution) was prepared, and the volume of the infection solution added to each clone bacterial solution was calculated using the following formula: V_infection solution = (OD measurement x V_Agrobacterium bacterial solution) / 0.8. Wild-type Arabidopsis Col-0 was grown for 4-6 weeks and used for flower dipping. The flowerpot was inverted on a beaker, and the entire inflorescence was immersed in the infection solution as much as possible. Each pot was infected for 1 min, and the inflorescence was gently shaken to ensure full contact with the infection solution (the fruit pods that had grown were removed in advance). After the infection was completed, the Arabidopsis plants were placed in the dark for 24 h, and then cultured under normal conditions. The bacterial solution was stored in the dark at 4°C, and the infection was repeated after one week to improve the infection efficiency. The T1 generation seeds were collected after the fruit pods matured. Positive plants were then selected for subsequent experiments.

[0036] 3. Verification of expression time rhythm in transformed Arabidopsis The pCPE- pAtCAT3 - SiVAMP721 expression plants and pCPE- pAtCAB2 - SiVAMP721Expression plants were cultured in an incubator with lights turned on at 8:00 AM and off at 8:00 PM (12 hours light / 12 hours dark). After 14 days of seedling growth, Arabidopsis leaves were collected at 8:00 AM and 8:00 PM and placed in 2 mL EP tubes for 48 hours. Each tube was treated with a steel ball, flash-frozen in liquid nitrogen, and then stored at -80°C. At least three biological replicates were performed for each sample to ensure data reliability and statistical significance. The expression of these two transgenic Arabidopsis species was detected by qRT-PCR. SiVAMP721 The level of expression, such as Figure 3 As shown.

[0037] exist pAtCAT3 Under the startup sub-driver, SiVAMP721 The gene exhibits a circadian rhythm characteristic of high expression at night, such as... Figure 2 As shown in A; and pAtCAB2 Under the startup sub-driver, SiVAMP721 Genes exhibit opposite rhythmic expression patterns, such as Figure 2 As shown in B in the diagram.

[0038] It should be noted that the expression level of the target gene can be detected by alternating 16h light and 8h dark, 12h light and 12h dark, or 8h light and 16h dark for 13 to 15 days.

[0039] SiVAMP721 The gene's gene number is Seita.6G010600 Its base sequence is shown in SEQ ID NO.1, and is as follows: ATGAATTCGCGCCGGTCGAGATCAGTGAAGCTCGTGTCGGCGCGCGCCAGCAAGGCCCTGGAGGTGGATATCGCCGAGTCGGACCCCCGGATGAGCTCCTCGGCCGACAACACCGTCTACTGCTGCATCGCGAAGGGCCGCAGGGTCATCTACTGCTACAACAGCAAGGACGGCGACCCGGAGACGGAGGCCGCCGCCGCGCTCTGCCTCGAGCACTCGCCGCCGCACCACCGGCATTACGTCCACACCTCGGGGTCACGGAGCTACGGGTACCTCATGGCCGACGGGCACACCTTCTTCGCCATCATCGACCCCAGCGTCGGGAACGCCGGCGCCCTGCAGTTCCTGGAGCGCGTGCGCGACGTGTTCAGGAATAGTGTGAACCGGAATGGGTTCCATGACTCGCTGGTGCCGGCGGTGCAGAGGCTGGTGGCGTCGCTGGAGAAGATGCCCCATGCCGCGTTGGTGCTCGAGGAGAGCGCGGAGAGGGGAGGGACGAACGAGGGCTCCGGCTGCACGTCGTCGAAGGTGCCTCTGCTGGGGAAGAGTGGCAGCAGGAAGGAGAAGAAGAAGAAGTCCAAGGATAAGTTGGCGTCGACAGGGGATGGCGAGGATGAACGCCATGGGACTAGGGGGGTGAGGATAGATGTGCCGGCGGAGGAGGTCGGAGGAATGTCGCTGGAGCGGAGCTTGAGCCAGTCCAGGCTCCGACGGCAGCAGCCGTCGCGGTCGCTGTGGATGCGCCATGTGAAGATCATCATCGTTGTCGACGCCGTCATCTGCCTGTTGTTATTCGCTGCTTGGCTGGCCGTGTGCAAGGGGTTCCGGTGTGTTTCTTCATGA.

[0040] pAtCAT3 The base sequence of the promoter is shown in SEQ ID NO. 2, which is: ACAACTTGGAAAGTGAATGGAAGTTTTAAGAGAAAAATCATTTCTAGAATTATTTTTTAGATCATTTCTTTTTTTGGAGCATCCATTAGAGTTTTGTTTTTAGACTTTATGATTTATTTTTCTTTTGTTATCAGCACAATAATTGATTTTCAAAAGATATTGTATCTTTTTTTTATCTCTTGAGAAGCACAGCACAACAACGAGCAATGCTGACTTGTCGGGGTCAGCGATTATTATTAGTCACCGAACGAATTTTTCTTGGGTTGGAGCCAAAACCTAGCAAAAAAATATCTAAGTGGGGGCACTACATTATTGTTTTAACACCAAGGAAAAGTAAACAACAATGGCCCATTTTTACTGTATCGAGAAATTGATCTCGAAAGGACAAATGTACCCTTCCACTTCGGGAATCCATTATTGTGCATAACACACGCTGTTTCACTATATATACTTTCACATAGGATCTCAACACTCTCACTAAACCAAAATCCTCAAAAGCCTATTTGGGGGATCATCAACCTTCTATCATCACC.

[0041] pAtCAB2 The base sequence of the promoter sequence is shown in SEQ ID NO. 3, which is: ATGTTTCGATCATCAGAATCTATATTTTCAAAATGTTATACTTTAAGTTTTAGTTATTGGGTTGTAGCAAAAATCATTCTTGTCACGAGGGTGTAAGTAAGTGTAACCGTTGAAGTATTCAGTGGCTCATAACTTGTGGTCACAAAACGCTTGGCTGCAATGAAAAAATCAAAACAAATGCTGGTGGACTAGAGATTGCCACGTAAGACTACTAAACGATAAAACAAAAATCTTAAAATCCAATGAATGAACAGATAAAGATTACTTCAGATATAACAAACGTTACAATATCCCTATATAATCCAACACTATCGAACCAGTTTTAATCACTCTCACTCACAAGTTAGTCATAAAAAAAAAAAAAACACAAAAAAGTTTCA.

[0042] The base sequence of the pCPE-Dest vector is shown in SEQ ID NO. 4, which is:

[0043] Each technical feature of the above-described embodiments can be combined with any other technical feature, and for the sake of brevity, not all possible combinations are described, but it is understood that the scope of the present disclosure encompasses all such possible combinations.

[0044] The above-described embodiments are merely illustrative of several embodiments of the present disclosure, and the description is relatively specific and detailed, but should not be construed as limiting the scope of the patent. For those skilled in the art, without departing from the concept of the present disclosure, a number of modifications and improvements can be made, which are all within the scope of the present disclosure. Therefore, the scope of the patent of the present disclosure should be subject to the appended claims.

Claims

1. A system for expressing the diurnal rhythm of Arabidopsis thaliana, characterized in that, The system includes carrier one and carrier two; The vector consists of pCPE-Dest vector and Arabidopsis thaliana endogenous... AtCAT3 The promoter and target gene together can drive high gene expression at night; The second carrier consists of the pCPE-Dest carrier and endogenous Arabidopsis thaliana. AtCAB2 The promoter and target gene together can drive high expression of the gene during the day.

2. The Arabidopsis thaliana diurnal rhythm expression system according to claim 1, characterized in that, The AtCAT3 The promoter base sequence is shown in SEQ ID NO.2; AtCAB2 The bases of the promoter are shown in SEQ ID NO.

3.

3. The Arabidopsis thaliana diurnal rhythm expression system according to claim 1, characterized in that, The base sequence of the pCPE-Dest vector is shown in SEQ ID NO.

4.

4. The method for constructing the Arabidopsis thaliana diurnal rhythm expression system according to claim 1, characterized in that, Includes the following steps: The target gene expression vector is obtained by inserting the target gene into the multiple cloning site of the pCPE-Dest vector through enzyme digestion and ligation. The Gateway BP reaction will respectively AtCAT3 promoters and AtCAB2 The promoter was cloned into the pDONR207 vector, resulting in two introductory clones, pDONR207-pAtCAT3 and pDONR207-pAtCAB2. pDONR207-pAtCAT3 and pDONR207-pAtCAB2 were recombined with the target gene expression vectors via Gateway LR reaction to obtain vector one and vector two, thus successfully constructing the Arabidopsis diurnal rhythm expression system.

5. The construction method according to claim 4, characterized in that, The target gene is inserted into the vector via the HindIII restriction enzyme site; the target gene is derived from millet. SiVAMP721 Gene or its homologous gene.

6. A method for regulating the diurnal rhythm expression of plant genes, characterized in that, The method involves transferring the vector one described in claim 1 into Arabidopsis thaliana using Agrobacterium-mediated transformation to obtain transgenic Arabidopsis thaliana one; transferring the vector two described in claim 1 into Arabidopsis thaliana using Agrobacterium-mediated transformation to obtain transgenic Arabidopsis thaliana two; culturing transgenic Arabidopsis thaliana one and transgenic Arabidopsis thaliana two under alternating light and dark conditions (8h-16h light and 8h-16h darkness) for 13-15 days; and collecting Arabidopsis thaliana leaves at 8:00 and 20:00 respectively, and detecting the expression level of the target gene in transgenic Arabidopsis thaliana one and transgenic Arabidopsis thaliana two by qRT-PCR to determine their diurnal expression rhythm.

7. The method according to claim 6, characterized in that, The Agrobacterium species in question is GV3101.

8. The application of the Arabidopsis thaliana diurnal rhythm expression system according to claim 1 in plant gene function research, characterized in that, The applications include: Investigating the effects of altered diurnal rhythms of gene expression on plant physiological activities; Comparing the effects of homophase and antiphase diurnal rhythm expression on plant phenotypes; To assess the role of gene expression regulation based on diurnal rhythms in plant environmental adaptation.

9. The application according to claim 8, characterized in that, The plant in question is Arabidopsis thaliana ( ). Arabidopsis thaliana ).

10. The application according to claim 8, characterized in that, The genes include, but are not limited to, those containing, SiVAMP721 Genes and their homologs.

Images