A method for high-efficiency expression of exogenous proteins based on NC_048604-1 site in CHO cell genome

By performing site-specific integration at the NC_048604.1 site in the CHO cell genome and inserting exogenous protein genes using CRISPR/Cas9 technology, the problem of unstable exogenous protein expression in CHO cells was solved, achieving stable and efficient exogenous protein production and reducing research and development costs and time.

CN121022941BActive Publication Date: 2026-03-24TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511582511.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-31
Publication Date
2026-03-24
Estimated Expiration
2045-10-31

AI Technical Summary

Technical Problem

Exogenous protein expression in existing CHO cells is unstable, and random integration leads to positional effects and time-consuming and labor-intensive screening processes, making it difficult to efficiently construct high-productivity cell lines.

Method used

Site-directed integration was performed at the NC_048604.1 site in the CHO cell genome. The foreign protein gene was inserted using CRISPR/Cas9 technology and stable expression was achieved through homologous recombination. The preferred target sequence was a specific nucleotide sequence within the range of 94142000-94148000 bases in NC_048604.1.

Benefits of technology

This approach achieves stable and high expression of exogenous proteins, shortens the screening cycle of engineered cell lines, reduces R&D costs, and improves production efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121022941B_ABST
    Figure CN121022941B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genes, and discloses a method for efficiently expressing exogenous proteins based on a NC_048604-1 site in a CHO cell genome. The site for stably expressing proteins in the CHO cell genome is located in a 94142000-94148000 base range of the NC_048604-1 in the CHO cell genome, and the nucleotide sequence is shown as SEQ ID NO:1. In the fixed position in the CHO cell genome, different protein genes are introduced and stably expressed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene technology, specifically relating to a method for efficient expression of exogenous proteins based on the NC_048604-1 site in the CHO cell genome. Background Technology

[0002] The Chinese hamster ovary (CHO) cell line was first isolated by Dr. Puck in 1957 and was initially used in molecular biology research. It is one of the most widely used mammalian cell lines in the biopharmaceutical field. Currently, nearly 84% of therapeutic recombinant protein drugs in the biopharmaceutical industry are produced by CHO cells, mainly because the recombinant proteins they express possess many advantages, such as post-translational modification capabilities similar to human proteins.

[0003] Currently, the construction of recombinant CHO cell lines for expression production in industrial applications mainly relies on random integration: the target gene and the selection gene are simultaneously integrated into the host cell genome. Based on stress amplification, cells with relatively high target gene expression levels are selected for subsequent large-scale culture. Although CHO cell lines based on random integration produce high yields of monoclonal antibody proteins (g / L), the uncontrollable nature of random integration sites and the significant heterogeneity of target protein expression necessitate multiple rounds of large-scale stress screening to determine suitable clones. This method is time-consuming, labor-intensive, and costly, and its inefficiency severely hinders the progress of industrial projects.

[0004] Meanwhile, because random integration cannot control the insertion site of the target gene, the screened cell lines are often affected by the "position effect," meaning that the expression of the foreign gene is affected by the spatial location of the inserted chromosomal region. With increasing passage numbers, copy number loss and gene rearrangement of the target gene can lead to expression instability in the cell lines. The instability of recombinant CHO cell lines constructed using this method can reach 8%-63%, and yield decreases over time, which is detrimental to quality control in the production process. Furthermore, developing high-yield cell lines using existing integration methods remains challenging for proteins that are difficult to express, such as artificial fusion proteins and non-natural bispecific antibodies. These problems ultimately lead to longer R&D cycles and increased R&D costs for enterprises. Therefore, a controllable and predictable cell line development process is needed. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an application of a site for stable expression of exogenous proteins within the genome of CHO cells. This site has clearly defined and fixed information, allowing for the insertion of different exogenous protein genes and stable expression. Furthermore, achieving site-specific integration of exogenous protein genes at this site can significantly shorten the screening cycle of engineered cell lines and reduce research and development costs.

[0006] This invention provides an application of a site for stable expression of a target protein in CHO cells. The site is located on chromosome X of CHO cells, specifically within the range of bases 94142000-94148000 of NC_048604.1. The application involves inserting a foreign target protein gene within this range. The nucleotide sequence within the range of bases 94142000-94148000 of NC_048604.1 is shown in SEQ ID NO: 1. Preferably, the range is within the range of bases 94143000-94147000, specifically within the range of bases 94144000-94145000.

[0007] Preferably, the gene encoding the target protein that is stably expressed is located in the region between the 5' and 3' homologous arms on the expression vector, wherein the 5' and 3' homologous arms are the upstream and downstream homologous arms of the target sequence that can be recognized by CRISPR / Cas9 technology within the range of 94142000-94148000 of the NC_048604.1 gene locus on chromosome X.

[0008] More preferably, the target sequence is 5'-NNNNNNNNNNNNNNNNNNNNNGG-3', which is recognizable by CRISPR / Cas9 technology within the range of bases 94142000-94148000 near the site. More preferably, the target sequence is 5'-AGTACCTGCCTAGCAAGCACAGG-3'.

[0009] The target protein is one of a polypeptide, a functional protein, an antibody, or a fusion protein, preferably a protein with a molecular weight of less than 160 kDa.

[0010] The present invention also provides an expression vector for expressing a target protein in CHO cells, which is used to insert the coding gene of the target protein into a stable expression site of the target protein in CHO cells; for example, a site-specific integration vector based on recombinase, a site-directed insertion vector for gene editing, or an integration vector based on homology-directed repair.

[0011] Preferably, the gene encoding the target protein is located in the region between the 5' and 3' homologous arms on the expression vector, wherein the 5' and 3' homologous arms are 750 bp homologous sequences upstream and downstream of the site for stable expression of the target protein.

[0012] The site where the target protein is stably expressed is the 94144581st base of the NC_048604.1 gene locus on chromosome X in CHO cells.

[0013] Specifically, the expression vector is suitable for expression in CHO cells; the upstream and downstream homologous sequences are 600-900 bp in length, for example 700-800 bp, such as 750 bp.

[0014] More specifically, the target sequence is designed within 3000 bp upstream and downstream of the 94144581st base of the CHO cell gene NC_048604.1, specifically within the range of 94142000-94148000 bases near the 94144581st base of NC_048604.1.

[0015] The target sequence is further described as 5'-AGTACCTGCCTAGCAAGCACAGG-3'.

[0016] The target sequence is 5'-TATTAGGTGTGTACCACAGAAGG-3'.

[0017] The target sequence is 5'-GGTGTGTACCACAGAAGGTGTGG-3'.

[0018] The target sequence is 5'-AACACCATTCACCAACAGTGTGG-3'.

[0019] The target sequence is 5'-CATGGCAACAGTGGTAATAGTGG-3'.

[0020] The target sequence is 5'-AGGGTCAATGCAAACAAGCACGG-3'.

[0021] The target sequence is 5'-GGGTTGGCAAAATGGCTCAGTGG-3'.

[0022] The target sequence is 5'-GTGATGTGGAGGCAGGAGGAAGG-3'.

[0023] The target sequence is 5'-TCACCACAGTTCAAATACGGAGG-3'.

[0024] The target sequence is 5'-AGGCATATGCGAGCATGCCCGGG-3'.

[0025] The target sequence is 5'-GTGCAAACATGACCCTAAGGAGG-3'.

[0026] The target sequence is 5'-AAGAAGTGAGCCAGGCATGGTGG-3'.

[0027] The target sequence is 5'-TGGTTCTCAGTAGAAGAGGAAGG-3'.

[0028] The target sequence is 5'-CCTAGCATGCATGAAGCCCTGGG-3'.

[0029] The target sequence is 5'-CACACACACACACACTGGGGGGG-3'.

[0030] In a specific embodiment, the target protein is one of a polypeptide, a functional protein, an antibody, or a fusion protein, preferably a protein with a molecular weight of less than 160 kDa.

[0031] Furthermore, the expression vector also includes a promoter sequence located upstream of the coding gene of the target protein, wherein the promoter controls the expression of the protein.

[0032] Furthermore, the promoters include, but are not limited to: CMV (a strong mammalian expression promoter derived from cytomegalovirus), EF-1a (a strong mammalian expression promoter derived from elongation factor 1α), SV40 (a strong mammalian expression promoter derived from simian vacuolating virus 40), and the artificially constructed combined promoter CAG (composed of cytomegalovirus CMV, an early enhancer element, and a chicken beta-actin promoter).

[0033] The present invention also provides a CHO recombinant cell line, which includes inserting an exogenous target protein gene at a site that stably expresses the target protein, wherein the site that stably expresses the target protein is at base 94144581 of the NC_048604.1 gene site on chromosome X in CHO cells.

[0034] Preferably, the expression vector, the sgRNA plasmid corresponding to the target sequence, and the Cas9 plasmid are transfected into CHO cells; more preferably, the pressure selection tag has been knocked out in the CHO cells, for example, the glutamine synthase gene has been knocked out.

[0035] The present invention further provides a method for constructing a CHO recombinant cell line for stably expressing a target protein, comprising the following steps:

[0036] (1) The plasmid vector was transfected into CHO cells with the glutamine synthase gene knocked out by electrotransfection to obtain a recombinant CHO-S-KOGS cell pool.

[0037] The plasmids are, respectively, the expression vector, the sgRNA plasmid corresponding to the target sequence, and the Cas9 plasmid; preferably, the molar ratio of the three plasmids is 1:1:2; the transfection is performed using an electroporator.

[0038] (2) The recombinant CHO-S-KOGS cell pool was cultured in well plates or shake flasks;

[0039] (3) Screening to obtain CHO recombinant cells that stably express the target protein.

[0040] When the glutamine synthase gene has been knocked out in CHO cells, the culture in step (2) is carried out using a culture medium without glutamine, and the collected cell culture supernatant is used for dot blot hybridization detection for screening.

[0041] The present invention further provides a method for stably expressing a target protein, comprising the step of fermenting and culturing CHO recombinant cells stably expressing the target protein obtained by the construction method to produce the target protein, preferably including the step of isolating the produced target protein.

[0042] Preferably, the fermentation culture is a fed-batch fermentation culture, and the glucose is maintained at 3.5-4.5 g / L (specifically 4.0 g / L). Fermentation is stopped when the cell viability reaches 80%.

[0043] The beneficial technical effects of this invention are as follows:

[0044] This invention employs site-directed integration technology to integrate the target gene into a stable, high-expression exogenous protein region. This not only overcomes the problem of unstable exogenous protein expression caused by the "position effect" in random integration, but also avoids the time-consuming and laborious process of repeated screening of single clones of high-expression exogenous proteins. This shortens the cycle of constructing biopharmaceutical high-expression engineered cell lines to 1-2 months, reducing research and development time and costs.

[0045] This invention inserts exogenous protein genes at specific sites in the CHO cell genome to achieve stable and high expression. Attached Figure Description

[0046] Figure 1 Fluorescence intensity analysis of lentivirus integrated libraries by flow cytometry screening.

[0047] Figure 2 Cas9 expression plasmid.

[0048] Figure 3 : sgRNA plasmid.

[0049] Figure 4 Donor plasmid.

[0050] Figure 5 :mcherry-ccdb plasmid.

[0051] Figure 6 :ccdb-antiPD1-GS-GFP plasmid.

[0052] Figure 7 Screening and identification of monoclonal cell lines expressing anti-PD1 antibody protein.

[0053] Figure 8 Results of 5' and 3' junction PCR amplification of site-specific integration of the anti-PD1 antibody gene and Sanger sequencing analysis.

[0054] Figure 9 Copy number analysis of anti-PD1 antibody genes integrated at specific sites.

[0055] Figure 10 Analysis of anti-PD1 antibody protein yield in the supernatant of well plate fermentation culture.

[0056] Figure 11 Stability analysis of anti-PD1 antibody protein expression.

[0057] Figure 12 Analysis of anti-PD1 antibody protein yield in the supernatant of shake-flask fed-batch fermentation culture. Detailed Implementation

[0058] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0059] Example 1: Construction of a high-expression, stable integration lentiviral library:

[0060] A lentiviral vector containing a green fluorescent tag (GFP) and a glutamine synthase gene (GS) was constructed and packaged to obtain a titer of approximately 1 × 8⁸. 10 Lentiviral.

[0061] CHO-S-KOGS cells were infected with a green fluorescent lentivirus with an MOI value less than 0.3 × (number of viruses per cell). 96 hours after infection, 1 × 10⁶ cells were sorted by flow cytometry. 6 Cells containing green fluorescence were selected. Lentivirally infected cells were screened using a medium without glutamine under pressure, with selection occurring when the cell count reached 8 × 10⁶ cells / day. 6 Cells were passaged at a concentration of 1 × 10⁹ / ml, with the initial concentration controlled at 1 × 10⁹ / ml. 6 / ml, after 60 passages, the dominant cell lines were enriched to obtain a stable cell bank that highly expresses green fluorescent protein. The top 1% of cells by fluorescence intensity were enriched by flow cytometry to obtain a dominant integrated cell pool that stably and highly expresses exogenous protein. After cell expansion and flow cytometry analysis, the fluorescence intensity was significantly increased. Figure 1 ).

[0062] Example 2, Lentiviral Integration Site Analysis:

[0063] Information on stable integration sites of highly expressed exogenous proteins was obtained by combining nested PCR with next-generation sequencing and bioinformatics techniques.

[0064] First, the DNA of the top 1% of cells enriched above was extracted, and specific primers LTRI were designed for the 3'LTR region of the lentiviral vector. Linear PCR was then performed using single-end DPO primers.

[0065] The PCR products were purified using AMPure XP magnetic beads; adapters were added to the 3' end of the purified single-stranded DNA using the VAHTS® ssDNA Library Prep Kit for Illumina.

[0066] Double-stranded DNA was synthesized using Extension Primer and Extension Enzyme Mix, and the double-stranded DNA was purified using AMPureXP magnetic beads. The purified DNA was then used as a template for index PCR using primer LTRII.

[0067] Sequencing libraries were purified using AMPure XP magnetic beads and then sequenced.

[0068] Data Analysis: First, a Python script was used to filter reads containing specific exogenous sequences (LTRs), allowing a maximum of 6 base mismatches, and output a filtered FastQ file. The cutadapt (version 2.8) tool was used to truncate the filtered FastQ file, removing 66 bases (including primers and exogenous sequences) from the 5' end using the -u 66 parameter, resulting in a clean sequence containing only the target insert fragment. The bwa mem (Version: 0.7.17-r1188) algorithm was used, with a specified complex genome (complexgenome.fna) as a template, and 4 threads (-t 4) were set up to align the processed sequences to the genome. Successfully aligned genome data was output as a SAM format alignment result file. The awk command was used to extract the chromosome sequence and the aligned position sequence from the SAM file; this position is the insertion site. The number of identical chromosomes and positions was then counted, and relative gene position annotations were performed. At nucleotide 94,144,581 of the CHO genome X chromosome reference sequence NC_048604.1, a total of 45,632 reads were detected, indicating an intergenic location. Based on this specific location, the relevant reference sequence was downloaded, and an expression vector was designed and constructed to validate the site for stable high expression of exogenous proteins.

[0069] Example 3: Target sequence selection:

[0070] Based on the high-expression exogenous protein stable sites obtained from the above analysis, anti-PD1 antibody proteins were selected for site-specific integration using CRISPR / Cas9 technology. The first step was to design the target sequence for the site. The selected site was a sequence 3000 bp upstream and downstream of chromosome 94144581 on chromosome X (its nucleotide sequence is shown in SEQ ID NO: 1). The DeepHF |SpCas9 & Base Editor Efficiency Prediction online prediction system was used to design the sgRNA sequence and select the most efficient target sequences.

[0071] The online prediction system scores the editing efficiency of the identified 5'-NNNNNNNNNNNNNNNNNNNNNGG-3' target sequence: LOW efficacy (score < 0.56); MEDIUM efficasy (0.56 <= score <= 0.74); HIGH efficacy (score > 0.74).

[0072] The target sequences were selected as follows:

[0073] Target sequence 5'-ATGACCTGCCTAGCAAGCACAGG-3' (SEQ ID No:2), score = 0.71.

[0074] Target sequence 5'- TATTAGGTGTGTACCACAGAAGG -3' (SEQ ID No:3), score=0.70.

[0075] Target sequence 5'- GGTGTGTACCACAGAAGGTGTGG-3' (SEQ ID No:4), score=0.68.

[0076] Target sequence 5'-AACACCATTCACCAACAGTGTGG-3' (SEQ ID No:5), score=0.681;

[0077] Target sequence 5'-CATGGCAACAGTGGTAATAGTGG-3' (SEQ ID No: 6), score=0.649;

[0078] Target sequence 5'-AGGGTCAATGCAAACAAGCACGG-3' (SEQ ID No:7), score=0.644;

[0079] Target sequence 5'-GGGTTGGCAAAATGGCTCAGTGG-3' (SEQ ID No:8), score=0.675;

[0080] Target sequence 5'-GTGATGTGGAGGCAGGAGGAAGG-3' (SEQ ID No: 9), score=0.654;

[0081] Target sequence 5'-TCACCACAGTTCAAATACGGAGG-3' (SEQ ID No:10), score=0.683;

[0082] Target sequence 5'-AGGCATATGCGAGCATGCCCGGG-3' (SEQ ID No: 11), score=0.635;

[0083] Target sequence 5'-GTGCAAACATGACCCTAAGGAGG-3' (SEQ ID No:12), score=0.673;

[0084] Target sequence 5'-AAGAAGTGAGCCAGGCATGGTGG-3' (SEQ ID No:13), score=0.672;

[0085] Target sequence 5'-TGGTTCTCAGTAGAAGAGGAAGG-3' (SEQ ID No:14), score=0.682;

[0086] Target sequence 5'-CCTAGCATGCATGAAGCCCTGGG-3' (SEQ ID No:15), score=0.64;

[0087] Target sequence 5'-CACACACACACACACTGGGGGGG-3' (SEQ ID No:16), score=0.642;

[0088] Furthermore, the three sequences with the highest predicted editing efficiency were selected as target sequences. Using an in vitro Cas9 enzyme digestion kit, the optimal target sequence 5'-TATTAGGTGTGTACCACAGAAGG-3' (SEQ ID No:17) was selected based on the digestion efficiency.

[0089] Example 4: Site-specific integration of an anti-PD-1 protein gene carrying the green fluorescent gene (GFP) and the glutamine synthase gene (GS)

[0090] CRISPR / Cas9-mediated site-specific genome editing and homologous recombination were used to integrate the green fluorescent protein gene, GS gene, and anti-PD1 antibody protein gene into target sites. CRISPR / Cas9-mediated homologous recombination requires the construction of sgRNA plasmids and Donor Plasmids, the construction process of which is as follows:

[0091] 1. Construction of sgRNA plasmid

[0092] 1) Synthesize oligonucleotide chains according to the target sequence selected in Example 3:

[0093] SgRNA-F: 5'-CACCGTATTAGGTGTGTACCACAGA -3' (SEQ ID No:18)

[0094] SgRNA-R: 5'-AAACTCTGTGGTACACACCTAATAC-3' (SEQ ID No: 19).

[0095] 2) Anneal and link the synthesized fragments.

[0096]

[0097] PCR instrument: 95℃ for 5 min, then store at 4℃.

[0098] 3) Ligate the annealed oligonucleotide chain to the sgRNA-ccdB plasmid (the sgRNA backbone plasmid already available in the laboratory is ligated to the annealed oligonucleotide chain via the Golden Gate).

[0099]

[0100] The reaction procedure is as follows:

[0101] 37℃ for 3 min, then 16℃ for 3 min, repeat 25 times, then 50℃ for 3 min, 80℃ for 3 min, and finally 4℃ for 3 min.

[0102] 4) Transformation to DH5α competent state;

[0103] 5) Select positive single clones and sequence them using the universal primer sgRNA-CX-F: 5'-GCCTATTTCCCATGATTCCTTC-3' (SEQ ID No: 20);

[0104] 6) Expand positive monoclonal strains and extract plasmids.

[0105] 2. Donor plasmid construction

[0106] Specific information about the Donor plasmid is as follows: Figure 4 As shown, this plasmid mainly includes the anti-PD1 antibody protein expression gene, GS selection gene, GFP and mCherry positive and negative selection genes, two homologous recombination arm genes (5'arm and 3'arm), and the N20+PAM gene sequence containing the target gene, among other key genes. The specific construction method is as follows:

[0107] 1) The 5' homologous arm fragment and the 3' homologous arm fragment were derived from the genomic DNA template, and the mCherry fragment was derived from the mCherry-ccdb plasmid constructed in the laboratory in the previous stage. Figure 5 PCR was performed using primer design, and the relevant fragments were obtained by gel extraction using a kit.

[0108] 2) The recovered fragment was combined with the ccdb plasmid vector containing genes such as anti-PD1, GFP, and GS, which had been previously constructed in the laboratory. Figure 6 The ligation and reaction procedure are the same as the sgRNA plasmid construction procedure described above, except that the restriction endonuclease is replaced by Esp3I instead of Bsa1.

[0109] 3) Select positive single clones, sequence them, and extract plasmids after amplification.

[0110] 3. Screening and identification of single-copy, site-directed integration monoclonal cell lines at base 94144581 of NC_048604.1

[0111] The constructed sgRNA plasmid ( Figure 3 ) and Donor plasmid ( Figure 4 ) and Cas9 plasmids containing the Cas9 protein ( Figure 2 Three plasmids were co-transfected into CHO-S-KOGS cells cultured at 37°C and 5% CO2, with a molar ratio of 1:1:2. Transfection was performed using an electroporator, and selection was conducted on glutamine-free medium. The Donor donor plasmid contains the N20+PAM sequence of the target gene outside its 5' and 3' arm homologous recombination arms. Therefore, after co-transfection, the Donor plasmid was simultaneously recognized and cleaved into linear fragments, improving integration efficiency. Through homologous recombination, the target gene was integrated at the target site under the selection pressure of glutamine-free medium. Simultaneously, the mCherry in the Donor plasmid served as a negative selection tag, excluding randomly integrated monoclonal cells during selection, reducing the workload of later targeted integration monoclonal cell line selection. Once cell viability stabilized and the proportion of green fluorescence increased, monoclonal cells were sorted using BD flow cytometry, selecting cells expressing green fluorescence but not red fluorescence, and then seeded into 96-well plates.

[0112] After monoclonal cell culture reached 14 days, cell culture supernatant expressing green fluorescence but not red fluorescence was collected. 3 μL of this supernatant was spotted onto an NC membrane and labeled. The membrane was then dried at 37°C, blocked with 5% skim milk powder for 30 min, washed three times with TBST, incubated with goat anti-rabbit secondary antibody (1 μg / mL) for 1 h, washed three times with TBST, and then developed using ECL. Cell lines expressing and secreting anti-PD1 antibody protein were detected. Based on the dot blot hybridization results of the monoclonal supernatant, a total of 38 positive monoclonal cells were initially screened. Figure 7 );

[0113] Positive monoclonal cells were expanded and cultured. A portion was taken for genomic analysis, and PCR identification was performed using 5' junction PCR, 3' junction PCR, and Sanger sequencing. Figure 8 ) and copy number identification identified 12 monoclonal cell lines with single-copy integration of the anti-PD1 gene ( Figure 9 ).

[0114] Expand the monoclonal cell lines obtained above.

[0115] Test example:

[0116] The expression of anti-PD1 antibody protein in the monoclonal cell lines obtained in Example 4 was detected using the Octet molecular interaction instrument.

[0117] The 12 monoclonal cell lines obtained in Example 4 were subjected to plate fermentation at a rate of 2 × 10⁻⁶. 5 Cells were initially seeded at an initial concentration of 1.91 μg / ml and fermented for 6 days. The supernatant was collected, and the expression level of anti-PD1 antibody protein in the fermentation broth was detected using an Octet molecular interaction analyzer and a Protein A sensor. The results showed that the expression level of single-copy integrin ranged from 1.91 to 16.53 μg / ml. Figure 10 The average value was 9.82 μg / ml.

[0118] Four monoclonal cell lines (M57-2, M57-3, M57-7, and M57-28) were selected for 20 consecutive weeks of plate fermentation. Protein expression stability was assessed at weeks 4, 8, 12, 16, and 20. The results showed that all monoclonal cell lines stably expressed anti-PD1 antibody protein, indicating good expression stability at this site. Figure 11 As shown.

[0119] Three monoclonal strains were selected for fed-batch shake-flask fermentation culture every other day, with an initial cell concentration of 6 × 10⁶ cells on day 0. 5 / ml inoculation, fed culture began on the fourth day. EmCDCHO101 was fed culture medium A at 4% volume, and EmCDCHO101 was fed culture medium B at 0.4% volume. Glucose was maintained at 4g / L. When cell viability reached 80%, cell supernatant was collected. The expression level of anti-PD1 antibody protein in the fermentation broth was detected using a Protein A sensor. The results showed that the expression level of the single-copy integrated anti-PD1 gene at this site in fed shake flask culture ranged from 109.10-211.73 μg / ml, with an average of 150.87 μg / ml. Figure 12 As shown.

[0120] In this invention, the CRISPR / Cas9-mediated genome editing technology is mainly used for site-specific integration. Therefore, target sequences are designed mainly for upstream and downstream sequences within 6000 bp. The 15 target sequences screened in Example 3 of this invention cover most of the upstream and downstream sequences within 6000 bp of this invention. The range of bases 94142000-94148000 in the CHO cell gene NC_048604.1 of this invention can successfully construct stable expression cell lines with site-specific integration and can stably express the target protein.

[0121] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.

Claims

1. The application of a site for stable expression of a target protein in CHO cells in the stable expression of the target protein, characterized in that, The site for stable expression of the target protein is on chromosome X in CHO cells, in the range of bases 94143000-94147000 according to the reference sequence NC_048604.

1. The application involves inserting an exogenous target protein gene within this range.

2. The application as described in claim 1, characterized in that, The site for stable expression of the target protein is at base 94144581, within the range of bases 94143000-94147000 on chromosome X in CHO cells.

3. The application as described in claim 1, characterized in that, The sequence within the 94143000-94147000 base range that can be recognized by CRISPR / Cas9 technology is the 5'-AGTACCTGCCTAGCAAGCACAGG-3' target sequence.

4. The application as described in claim 1, characterized in that, The target protein is a polypeptide, and the target protein is a protein with a molecular weight of less than 160 kDa.

5. The application as described in claim 4, characterized in that, The target protein is a functional protein.

6. The application as described in claim 4, characterized in that, The target protein is a fusion protein.

7. An expression vector for expressing a target protein in CHO cells, characterized in that, It is an expression vector used to insert the gene encoding the target protein into a stable expression site of the target protein in CHO cells; The site where the target protein is stably expressed is on chromosome X in CHO cells, in the range of bases 94143000-94147000 according to the reference sequence NC_048604.

1.

8. The expression vector as described in claim 7, characterized in that, These include site-specific integration vectors based on recombinases, site-directed insertion vectors for gene editing, or integration vectors based on homology-directed repair.

9. The expression vector as described in claim 7, characterized in that, The gene encoding the target protein that is stably expressed is located in the region between the 5' and 3' homologous arms on the expression vector. The 5' homologous arm and 3' homologous arm are the upstream and downstream homologous arms of 5'-AGTACCTGCCTAGCAAGCACAGG-3' on chromosome X according to the reference sequence NC_048604.1, which can be recognized by CRISPR / Cas9 technology.

10. The expression vector as described in claim 7, characterized in that, The expression vector further includes a promoter sequence located upstream of the coding gene of the target protein, wherein the promoter controls the expression of the protein; The promoters are selected from: CMV, EF-1a, SV40, and the combined promoter CAG.

11. A CHO recombinant cell line, characterized in that, It includes inserting an exogenous target protein gene at a site where the target protein is stably expressed, said site being chromosome X in CHO cells, at base 94144581 according to the reference sequence NC_048604.

1.

12. The CHO recombinant cell line as described in claim 11, characterized in that, It is obtained by integrating the target protein gene into the 94144581st base of chromosome X of CHO cells using the expression vector as described in any one of claims 7 to 10.

Citation Information

Patent Citations

  • DNA construct, and process for production of recombinant CHO cell using same

    CN102639699A

  • Site for stably expressing protein in CHO cell gene NW-003614889.1 and application of site

    CN113969284A