Application of Os09g0416200 gene in identifying salt tolerance of rice in bud stage

Abstract

The invention discloses an application of an Os09g0416200 gene in identifying the salt tolerance of rice in a bud stage, and relates to the technical field of biology. According to the invention, SNP (Single Nucleotide Polymorphism) and genes which cause generation of the rice bud-stage salt-tolerant mutant are screened based on a Meta-QTL (Quantitative Trait Locus) method, the Os09g0416200 gene related to the rice bud-stage salt-tolerant mutant is obtained through screening, and a KASP marker verification experiment proves that the mutation type of the Os09g0416200 gene can indeed influence the rice bud-stage salt tolerance. It is proved that the Os09g0416200 gene is related to rice bud stage salt tolerance and can be applied to identification of rice bud stage salt tolerance mutants, and therefore technical support is provided for salt-tolerant rice seed production and crop improvement.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to... Os09g0416200 Application of genes in identifying salt tolerance in rice bud stage. Background Technology

[0002] Salt stress is a key abiotic stress faced by rice during its growth. Its core problem stems from the excessive accumulation of soluble salts in the soil, such as sodium chloride and sodium carbonate. Under such soil conditions, rice growth and development are comprehensively restricted. From the seedling stage, seed germination rate decreases significantly, and seedlings are prone to yellowing leaves and stunted growth after emergence. During the tillering stage, the number of effective tillers decreases, resulting in weak plants. In the grain-filling stage, grains are not fully filled, and the proportion of empty grains increases. Ultimately, this makes it difficult to expand the rice planting area and achieve normal yields, severely impacting stable rice production. To overcome this limitation and enable rice to grow and bear fruit normally in high-salt environments, cultivating salt-tolerant rice varieties has become a core research direction. The key to achieving this goal lies in identifying and developing the salt-tolerant genes within rice itself. Applying these genes to rice breeding processes and using scientific breeding techniques to cultivate rice varieties with strong salt tolerance will fundamentally solve the problem of rice cultivation in saline soils and open up new possibilities for rice production. Summary of the Invention

[0003] The purpose of this invention is to provide Os09g0416200 The application of genes in identifying salt tolerance during rice budding stage aims to address the problems existing in the prior art. This invention has discovered... Os09g0416200 The gene is related to the salt tolerance of rice during the budding stage and can be used to identify the salt tolerance of rice during the budding stage, thus providing technical support for the breeding of salt-tolerant rice varieties.

[0004] To achieve the above objectives, the present invention provides the following solution: This invention provides a rice salt tolerance-related gene, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0005] The present invention also provides the application of the above-mentioned rice salt tolerance-related genes in improving the salt tolerance of organisms, wherein the organisms are rice or yeast.

[0006] This invention also provides Os09g0416200 The application of genes in identifying salt tolerance during rice budding stage, the aforementioned Os09g0416200The nucleotide sequence of the gene is shown in SEQ ID NO.1; there are two SNP sites, SNP1 and SNP2, in the nucleotide sequence shown in SEQ ID NO.1, which are located at bases 4487 and 6185 respectively; when the haplotype of SNP1 is T, it indicates that the rice has high salt tolerance during the germination stage.

[0007] The present invention also provides a method for utilizing Os09g0416200 The method for identifying rice germination salt tolerance by gene, the method described Os09g0416200 The nucleotide sequence of the gene is shown in SEQ ID NO.1; there are two SNP sites, SNP1 and SNP2, in the nucleotide sequence shown in SEQ ID NO.1, which are located at bases 4487 and 6185, respectively. The method includes the following steps: Total RNA was extracted from the rice samples to be tested, and cDNA was obtained by reverse transcription. Using the cDNA as a template, PCR amplification was performed to obtain a sample containing the cDNA. Os09g0416200 A segment of a gene's DNA; Sequencing the DNA fragment revealed that when the SNP1 haplotype was T, it indicated that the rice sample under test had high salt tolerance during the germination stage.

[0008] The present invention also provides an application of the KASP molecular marker in identifying salt tolerance in rice bud stage, wherein the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.6; The nucleotide sequence shown in SEQ ID NO.6 contains an SNP site, which is a T / C mutation; When the genotype of the SNP locus is TT, it indicates that the rice has high salt tolerance during the germination stage.

[0009] The present invention also provides a KASP primer combination for identifying salt tolerance in rice bud stage, comprising an upstream primer F1 with the nucleotide sequence shown in SEQ ID NO.7, an upstream primer F2 with the nucleotide sequence shown in SEQ ID NO.8, and a universal downstream primer R with the nucleotide sequence shown in SEQ ID NO.9.

[0010] This invention also provides the application of the above-mentioned KASP primer combination in identifying salt tolerance in rice bud stage.

[0011] This invention also provides the application of the above-mentioned KASP primer combination in the preparation of a kit for identifying salt tolerance in rice bud stage.

[0012] The present invention also provides a kit for identifying salt tolerance in rice bud stage, comprising the above-mentioned KASP primer combination.

[0013] This invention also provides a method for identifying rice germination salt tolerance using KASP molecular markers, comprising the following steps: Total RNA was extracted from the rice samples to be tested, and cDNA was obtained by reverse transcription. Using the cDNA as a template, KASP amplification was performed using the above-mentioned KASP primer combination; When the genotype of the SNP site of the KASP molecular marker is TT, it indicates that the rice sample under test has high salt tolerance during the budding stage.

[0014] The present invention discloses the following technical effects: This invention uses a meta-QTL-based method to screen SNPs and genes that lead to rice sprouting salt tolerance mutants, and identifies genes related to rice sprouting salt tolerance mutants. Os09g0416200 The gene was confirmed by KASP marker validation experiments. Os09g0416200 The type of gene mutation can indeed affect the salt tolerance of rice during the germination stage.

[0015] This invention proves Os09g0416200 The gene is related to salt tolerance during rice germination and can be used to identify salt-tolerant mutants during rice germination, thus providing technical support for the production of salt-tolerant rice seeds and crop improvement. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 for Os09g0416200 The results of haplotype analysis of the genes; among them, Hap1 is a salt-tolerant haplotype, and Hap2 represents a sensitive haplotype; Figure 2 for Os09g0416200 Results of transgenic yeast gene validation experiments; where CK is normal culture medium; S is 100 mmol / L sodium chloride stress culture medium; Figure 3 Genotyping results of salt-tolerant plants at the SNP1 mutation site; blue represents the negative control, green represents the heterozygous genotype CT, red represents the unmutated genotype CC, and yellow represents the mutant genotype TT. Figure 4 The results show the genotyping of susceptible plants at the SNP1 mutation site; blue represents the negative control, green represents the heterozygous genotype CT, red represents the unmutated genotype CC, and yellow represents the mutant genotype TT. Figure 5 Genotyping results of salt-tolerant plants at the SNP2 mutation site; blue represents negative control, green represents heterozygous genotype AG, yellow represents mutant genotype AA, and black represents unknown genotype; Figure 6 The results show the genotyping of susceptible plants at the SNP2 mutation site; blue represents the negative control, green represents the heterozygous genotype AG, red represents the unmutated genotype GG, yellow represents the mutant genotype AA, and black represents the unknown genotype. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] Example 1: Screening of salt tolerance-related segments and genes in rice bud stage (1) Meta-QTL analysis to identify salt tolerance-related segments and genes in rice bud stage Relevant information on QTLs data related to rice germination salt tolerance in the past 5 years was retrieved from the websites https: / / webofscience.clarivate.cn / and https: / / pubmed.ncbi.nlm.nih.gov / , and a series of key information was extracted. This information covers the mapping population, population type, population size, mapping method, number of QTLs, chromosomes involved, logarithm of the odds (LOD) value, percentage of phenotypic variation (PVE), and flanking markers of QTLs. The location and contribution rate of QTLs are two core parameters for evaluating their characteristics. For QTLs lacking detailed confidence interval (CI) information, this invention applies the method proposed in the literature "Darvasi A, Soller M.1997. A simple method to calculate resolving power and confidence interval of QTL map location[J]. Behavior Genetics, 27(2): 125-132." to calculate their 95% confidence interval. Specifically as follows: (1) CI = 530 / (N × R) 2 ); (2) CI = 163 / (N×R) 2 ); (3) CI = 287 / (N×R) 2 ); In the formula, N represents the size of the plotting group, and R... 2 The contribution rate of QTL is represented. Formula (1) applies to the BIL, DH and F2 populations, formula (2) applies to the RIL population, and formula (3) applies to the DH population.

[0024] To determine the exact location of the original QTL flanking markers on the physical map, BioMercator 4.2.3 software was used to perform QTL mapping. Meta-QTLs were identified by finding the minimum AIC value. Then, MapChart software was used to generate and export vector graphics of the map to depict the "consistent" distribution of QTLs. In this invention, a Meta-QTL is considered to be of high confidence only if there are at least two initial QTLs in the Meta-QTL mapping, and such Meta-QTLs are included in further analysis. This method ensures that the selected Meta-QTLs have high statistical support, thus providing reliable candidate regions for the genetic structure analysis of salt tolerance traits. Using genomic information provided by the phytozome database and referring to the rice genome information database, rice genes within the universal QTL interval were predicted. Gene annotation databases were used to perform corresponding gene annotations. Homologous genes of genes within the interval were retrieved using the annotation information and possible functions were predicted (Table 1), and haplotype analysis was performed. Figure 1 Candidate genes associated with salt tolerance were identified as follows: Os09g0416200 Gene.

[0025] Table 1. Screening results of salt tolerance-related genes in rice seedling stage , Example 2 Os09g0416200 Gene cloning and SNP site analysis 1. Os09g0416200 Molecular cloning of genes Synthesis of the first strand of cDNA: The volume was calculated based on the RNA sample concentration. 1 µg of total rice RNA was used as a template, and RT-PCR was performed to reverse transcribe it into cDNA according to the instructions of the reverse transcription kit.

[0026] 2. Os09g0416200 Gene cloning and PCR product recovery and purification Primer design: First, the CDS sequence was identified using Phytozome, and primers were designed using Snapgene and sent to Shanghai Sangon Biotech for synthesis. The primer sequences are shown in Table 2.

[0027] Table 2 Primer Sequences , 3. Os09g0416200 Gene fragment amplification and PCR product recovery and purification Using cDNA as a template, PCR amplification was performed using the primers shown in Table 2. The PCR amplification system is shown in Table 3. Table 3 PCR amplification system , The PCR reaction program was as follows: 94℃ pre-deformation for 2 min; 98℃ deformation for 10 s, 55℃ annealing for 45 s; 68℃ extension for 2 min, 35 cycles; 68℃ extension for 5 min.

[0028] Verify the length of the PCR product using 1.0% agarose gel electrophoresis. Under UV light, use a newly opened blade to remove as much of the single target DNA band as possible. Transfer the excised gel containing the DNA fragment into a pre-weighed 1.5 mL centrifuge tube, weigh the gel, and recover the product using a recovery kit. Follow the instructions for experimental procedures and store the collected DNA solution at -20°C.

[0029] Os09g0416200 The nucleotide sequence of the gene is shown in SEQ ID NO.1, which contains two SNP sites, SNP1 and SNP2, located at bases 4487 and 6185 respectively, representing T / C and A / G mutations. SNP1 is located in the CDS sequence of the genome, while SNP2 is located in the UTR sequence of the genome. The SNP2 mutation does not affect the function of the gene.

[0030] When the SNP1 site mutates to T Os09g0416200 The nucleotide sequence of the gene is shown in SEQ ID NO.2 and is named as follows. Os09g0416200J Hap1 When the SNP1 site mutates to C, Os09g0416200 The nucleotide sequence of the gene is shown in SEQ ID NO.3, and it is named... Os09g0416200J Hap2 .

[0031] Example 3: Construction of Recombinant Microbial Cells 1. Obtaining the pYES2 plasmid The yeast expression vector used in this invention is pYES2. A small amount of purchased pYES2 plasmid was inoculated onto LB solid medium (100 mg / mL ampicillin) and cultured overnight. Then, single colonies were picked and cultured overnight in liquid medium. The pYES2 plasmid was extracted according to the instructions of the plasmid extraction kit.

[0032] To amplify the target fragment obtained in Example 2 ( Os09g0416200J Hap1 or Os09g0416200J Hap2 The pYES2 plasmid and gene fragment, each with the same sticky ends, are ligated into a vector. First, the pYES2 plasmid is digested with EcoRI and HindIII, and the fragment is purified and recovered after agarose gel electrophoresis.

[0033] The enzyme digestion system is shown in Table 4: Table 4 Enzyme digestion system , Add the system components to a 200 μL centrifuge tube, gently mix, centrifuge briefly for 5 s, and then inactivate by heat at 37℃ for 30 min and 65℃ for 20 min.

[0034] 2. Ligation and transformation of the target fragment into a yeast expression vector The concentration of the purified fragment was measured, and the target fragment was ligated to the vector fragment using a homologous recombinase to construct the recombinant plasmid vector. The ligation system is shown in Table 5. Table 5 Connection System , Add the system components to a 200 μL centrifuge tube, gently mix, centrifuge briefly for 5 seconds, and then place at 50℃ for 30 minutes.

[0035] The two recombinant plasmid vectors were transformed into DH5α competent cells, and the culture medium was inoculated with 100 mg / mL ampicillin. After overnight incubation, the colonies growing on the plates were transformed bacteria resistant to ampicillin. Single colonies were picked and inoculated into liquid medium containing ampicillin and incubated overnight at 200 rpm and 37°C. Using the overnight culture as a template, PCR was performed. Recombinant plasmid vectors were extracted from the PCR-positive colonies using a plasmid extraction kit.

[0036] 3. Yeast Conversion Freshly prepared competent yeast cells were used for transformation at room temperature, following the instructions in the transformation section. Finally, 50 μL of the transformation mixture was evenly spread onto SD-Ura (glucose) solid medium and incubated at 30°C for 3 days until white colonies appeared.

[0037] White single colonies were picked and cultured overnight at 30°C and 200 rpm in SD-Ura liquid medium. The bacterial culture was then subjected to cell lysis at 100°C for 5 min. 5 μL of the lysed bacterial culture was used as a template for PCR detection to determine whether the target gene was accurately integrated into the yeast expression vector.

[0038] 4. Phenotypic identification of recombinant yeast Transform Os09g0416200J Hap1 The recombinant yeast gene was named INVSCⅠ(pYES2- Os09g0416200J Hap1 ); will transform Os09g0416200J Hap2 The recombinant yeast gene was named INVSCⅠ(pYES2- Os09g0416200Hap2 To verify the effects of salt stress on transgenic yeast, the growth status was observed using the salt stress method, and the experiment was repeated three times. The specific detection methods are as follows: (1) In a clean bench, select the successfully verified recombinant yeast and place it in YPDA liquid medium (glucose) and culture overnight at 30°C and 200 rpm with shaking. (2) Determination of OD of overnight bacterial culture 600 Calculate the required bacterial culture volume so that the OD value of 5 mL of induction medium supplemented with galactose (SD-Ura) is 0.4; (3) Take the required volume of bacterial culture and centrifuge at 8000 rpm for 1 min; (4) First, resuspend the bacterial cells in 1 mL of SD-Ura, then add to a final volume of 5 mL; (5) Incubate overnight at 30℃ and 200 rpm with shaking; (6) Determine the OD of overnight bacterial culture 600 After calculation, OD is adjusted uniformly. 600 It is 2.0; (7) Dilute the bacterial solution by 10 μL each time. -1 times, 10 -2 times, 10 -3 times, 10 -4 times, 10 -5 times; (8) Take 5 μL of undiluted bacterial solution and 5 μL of diluted bacterial solution and inoculate them onto normal YPDA solid medium and YPDA solid medium under 100 mmol / L sodium chloride stress, respectively. (9) Incubate at 30℃ for 5 days; (10) Observe and record the growth of the plate, and analyze and compare the differences in yeast growth.

[0039] Salt stress treatment process: 5 μL of diluted bacterial suspension was inoculated onto normal YPDA solid medium and YPDA solid medium under 100 mmol / L sodium chloride stress, respectively. The cultures were incubated at 30℃ for 5 days. The growth of the transgenic yeast was observed and compared.

[0040] Positive results were confirmed by applying the primers shown in Table 3 to transgenic yeast samples. The samples were pre-deformed at 95℃ for 3 min; deformed at 95℃ for 15 s, annealed at 55℃ for 15 s; extended at 72℃ for 15 s, for 30 cycles; and then extended at 72℃ for 5 min. Colony PCR was then performed. The PCR product length was verified by 1.0% agarose gel electrophoresis.

[0041] This embodiment conducts a transgenic verification experiment in yeast. Os09g0416200The function was verified, and the results showed that in YPDA medium under 100 mmol / L sodium chloride stress, the transgenic yeast INVSCⅠ (pYES2- Os09g0416200J Hap1 ) and INVSCⅠ(pYES2- Os09g0416200 Hap2 In contrast, significant differences in growth were observed in the transformed pYES2- medium. However, no difference in yeast growth was observed in normal YPDA medium. This indicates that the transformation gene pYES2- Os09g0416200 Hap1 The yeast developed salt tolerance ( Figure 2 ).

[0042] Example 4: Development and Utilization of KASP Tags 1. Materials 1.1 Rice plant DNA Salt-tolerant and sensitive rice plants at the bud stage were extracted using the CTAB method. The salt-tolerant and sensitive materials used were provided by the Crop Germplasm Resource Innovation Laboratory of Heilongjiang Bayi Agricultural Reclamation University (see Table 6).

[0043] Table 6 Salt-tolerant and sensitive rice materials , Note: The lower the salt tolerance rating, the higher the salt tolerance.

[0044] 1.2 Main Reagents The 2× Master Mix for ASPCR reagent was purchased from Chengdu Hanchen Guangyi Biotechnology Co., Ltd.

[0045] 1.3 Main Equipment and Instruments High-speed low-temperature centrifuges, vortex mixers, water baths, nucleic acid and protein detectors, quantitative PCR amplification instruments, pipettes, pipette tips, and EP tubes, etc.

[0046] 2. Extraction and detection of total plant DNA Rice plants were categorized into salt-tolerant and sensitive plants based on their stress level after reaching the budding stage. The newly emerged rice shoots were used as samples. Samples were immediately frozen in liquid nitrogen after collection. The samples were stored in an ultra-low temperature freezer at -80°C. DNA was extracted using the CTAB method. Finally, the samples were dissolved in RNase-free water, and the quality of the prepared samples was determined.

[0047] 3. KASP tag 3.1 Obtaining SNP Information Primers were designed based on SNP sites on candidate genes screened from BSA data. The base sequences of the two parents at the SNP site were required to be different, and there should be no other SNPs 20 bp upstream and 40 bp downstream of the SNP.

[0048] 3.2 Primer Design First, the CDS sequence was identified using Phytozome, and primers were designed using Snapgene and sent to Shanghai Sangon Biotech for synthesis. The left primer f was started 20 bp upstream from the base of the SNP, and the SNP base was used as the 20th base of the left primer, resulting in left primers f1 and f2. The left primer f was fixed using primer design software (Primer 3 Plus) or the primer design website (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The right primer R was obtained via blast, and the product size needed to be less than 60 bp. Adapters A1 and A2 were added to the left primers f1 and f2, respectively, resulting in sequences F1 and F2, i.e., F1=A1f1 and F2=A2f2. The synthesized sequences F1, F2, and R were purified using ULTRPAGE. KASP primers are shown in Table 7.

[0049] Gene Os09g0416200 The nucleotide sequence of the KASP marker at the SNP1 site is shown in SEQ ID NO.6.

[0050] SEQ ID NO.6: CGCCACGCTCAACGCCGCCGCCGTYAACCTCGTCATGCTCATCCTCGGCCGCATCCTGCT; where Y is T or C.

[0051] Table 7 Primer Sequences , 3.3 KASP Amplification System The KASP amplification system is shown in Table 8: Table 8 KASP amplification system , 3.3 Amplification Procedure The amplification procedure is shown in Table 9: Table 9 KASP Amplification Procedure , 3.4 Gene Analysis Results Gene Os09g0416200 KASP marker genotyping results are as follows Figures 3-6As shown in the figure. The results showed that the SNP1 mutation site was clearly differentiated in the DNA of salt-tolerant and sensitive plants; in salt-tolerant plants, there were 5 unmutated genotypes C, 4 heterozygous genotypes, and 31 mutant genotypes T; in sensitive plants, there were 4 mutant genotypes T, 3 heterozygous genotypes, and 33 unmutated genotypes C; genotype T was more common in salt-tolerant plants, while genotype C was more common in sensitive plants.

[0052] The SNP2 mutation site did not show obvious genotyping in the DNA of salt-tolerant and susceptible plants. In salt-tolerant plants, there were 0 unmutated genotypes (G), 18 heterozygous genotypes, 9 mutant genotypes (A), and 13 unknown genotypes. In susceptible plants, there were 6 mutant genotypes (A), 12 heterozygous genotypes, 5 unmutated genotypes (G), and 17 unknown genotypes. The results indicate that the SNP2 mutation site is not significantly associated with plant salt tolerance.

[0053] 4. Results In this embodiment, during the screening of salt-tolerant genes in rice bud stage, the genes were... Os09g0416200 The SNP1 mutation site was verified, and the results showed that the genotype of this site was C in sensitive plants and T in salt-tolerant plants.

[0054] In conclusion, the above experimental results fully demonstrate that Os09g0416200 The type of gene mutation may affect the salt tolerance of rice during the bud stage, leading to the emergence of salt-tolerant mutant plants during the bud stage.

[0055] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A rice salt tolerance-related gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

2.

2. The application of the rice salt tolerance-related gene as described in claim 1 in improving the salt tolerance of organisms, characterized in that, The organism is rice or yeast.

3. Os09g0416200 The application of genes in identifying salt tolerance during rice budding stage is characterized by, The Os09g0416200 The nucleotide sequence of the gene is shown in SEQ ID NO.1; there are two SNP sites, SNP1 and SNP2, in the nucleotide sequence shown in SEQ ID NO.1, which are located at bases 4487 and 6185 respectively; when the haplotype of SNP1 is T, it indicates that the rice has high salt tolerance during the germination stage.

4. A method of utilizing Os09g0416200 A method for identifying rice germination salt tolerance using genetic methods, characterized in that... The Os09g0416200 The nucleotide sequence of the gene is shown in SEQ ID NO.1; there are two SNP sites, SNP1 and SNP2, in the nucleotide sequence shown in SEQ ID NO.1, which are located at bases 4487 and 6185, respectively. The method includes the following steps: Total RNA was extracted from the rice samples to be tested, and cDNA was obtained by reverse transcription. Using the cDNA as a template, PCR amplification was performed to obtain a sample containing the cDNA. Os09g0416200 A segment of a gene's DNA; Sequencing the DNA fragment revealed that when the SNP1 haplotype was T, it indicated that the rice sample under test had high salt tolerance during the germination stage.

5. The application of a KASP molecular marker in identifying salt tolerance during rice budding stage, characterized in that, The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO. 6; The nucleotide sequence shown in SEQ ID NO.6 contains an SNP site, which is a T / C mutation; When the genotype of the SNP locus is TT, it indicates that the rice has high salt tolerance during the germination stage.

6. A KASP primer combination for identifying salt tolerance in rice bud stage, characterized in that, It includes upstream primer F1 with nucleotide sequence as shown in SEQ ID NO.7, upstream primer F2 with nucleotide sequence as shown in SEQ ID NO.8, and universal downstream primer R with nucleotide sequence as shown in SEQ ID NO.

9.

7. The application of the KASP primer combination as described in claim 6 in identifying salt tolerance in rice bud stage.

8. The application of the KASP primer combination as described in claim 6 in the preparation of a kit for identifying salt tolerance in rice bud stage.

9. A kit for identifying salt tolerance in rice buds, characterized in that, Includes the KASP primer combination as described in claim 6.

10. A method for identifying salt tolerance in rice bud stage using KASP molecular markers, characterized in that, Includes the following steps: Total RNA was extracted from the rice samples to be tested, and cDNA was obtained by reverse transcription. Using the cDNA as a template, KASP amplification was performed using the KASP primer combination described in claim 6; When the genotype of the SNP site of the KASP molecular marker is TT, it indicates that the rice sample under test has high salt tolerance during the budding stage.

Images