RPA (recombinase polymerase amplification) primer group for detecting bovine brucella, bovine babesia and pasteurella as well as detection method and application of RPA primer group

Abstract

The invention discloses an RPA (recombinase polymerase amplification) primer group for detecting bovine brucella, bovine babesia and pasteurella as well as a detection method and application thereof, the RPA primer group comprises three pairs of specific primers F1-R1, F2-R2 and F3-R3, whether a sample to be detected is bovine brucella, bovine babesia and pasteurella or not can be judged at one time, no false positive appears, and the RPA primer group can be used for detecting the bovine brucella, bovine babesia and pasteurella. Therefore, the method is simpler and more convenient, and the result is accurate; according to the method, the RPA technology is adopted, target DNA can be amplified at normal temperature within a short time, a theoretical basis and a scientific basis are provided for a molecular epidemic disease basis of bovine brucella, bovine babesia and pasteurella, sensitive, specific, simple and rapid bacterial detection is achieved, and the method has a profound application value in the fields of public health and the like.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to an RPA primer set for detecting Brucella bovis, Babesia bovis, and Pasteurella multocida, as well as its detection method and application. Specifically, it relates to a primer set for rapid detection of Brucella bovis, Babesia babesia, and Pasteurella multocida using recombinase polymerase amplification (RPA) technology and its application. Background Technology

[0002] Brucella, Pasteurella, and Babesia bovis are the three major pathogens threatening the health of cattle, especially in slaughterhouse environments. However, traditional detection methods have significant shortcomings in meeting the need for rapid screening of these pathogens in slaughterhouses. Pathogen isolation and culture are time-consuming; for example, Brucella culture and identification often takes weeks. This is not only inefficient, but also requires operators to have direct contact with high-risk pathogens, and its sensitivity is inherently insufficient, easily missing Babesia under microscopic examination. Serological detection methods, such as the commonly used Brucella rose benzene plate agglutination test, face a core challenge: they struggle to effectively distinguish whether antibodies in animals originate from natural infection or vaccine immunity, and are prone to cross-reactions with other pathogens such as Yersinia, resulting in specificity typically hovering around 70-80%, and limited detection capability in the early stages of infection. Furthermore, although conventional molecular techniques such as PCR (polymerase chain reaction) and real-time quantitative PCR have a high specificity of over 97%, they heavily rely on sophisticated laboratory thermal cycling equipment, a stable power supply, and professional technicians. It often takes more than six hours from sample collection to obtaining results.

[0003] Recombinase polymerase amplification (RPA) is a nucleic acid amplification technique developed in recent years. Compared with classical PCR, RPA offers advantages such as isothermal activity, shorter detection time, higher sensitivity, ease of operation, and diverse readouts. However, its application in the detection of Brucella bovis, Pasteurella multocida, and Babesia bovis remains limited and requires further development. Summary of the Invention

[0004] The purpose of this invention is to address the shortcomings of existing technologies by designing primers to provide an RPA primer capable of simultaneously detecting Brucella bovis, Babesia bovis, and Pasteurella multocida, and its applications. Each specific primer has the advantages of high intraspecific conservation and interspecific specificity.

[0005] The technical solution adopted by this invention to solve its technical problem is as follows:

[0006] In a first aspect, the present invention provides an RPA primer set for detecting Brucella bovis, Babesia bovis, and Pasteurella multocida, comprising three pairs of specific primers F1-R1, F2-R2, and F3-R3, the primer sequences of which are as follows:

[0007] F1: TGATGTTTGCATCCTTACGCGCAACGATATGGAT (SEQ ID NO.1)

[0008] R1: TCCGGCTTTACGCAGTCAGACGTTGCCTATTGGG (SEQ ID NO.2)

[0009] F2:ACAACTCGCCTGTTCGGTTTCGGTATCCA (SEQ ID NO.3)

[0010] R2: TCCTGTACCACCTCTTGTACGCGGGCAAA (SEQ ID NO.4)

[0011] F3: GGACTGACACGATCAAACCGTTGAACACGA (SEQ ID NO.5)

[0012] R3: ATGAACCGATTGCCGCGAAATTGAGTTTTA (SEQ ID NO. 6).

[0013] A second objective of this invention is to provide the application of the above-described RPA primer set in the preparation of detection products for Brucella bovis, Babesia bovis, and / or Pasteurella multocida.

[0014] A third objective of this invention is to provide a product for detecting Brucella bovis, Babesia bovis, and / or Pasteurella multocida, said product comprising the aforementioned RPA primer set.

[0015] Preferably, the product is a kit or a probe.

[0016] The fourth objective of this invention is to provide a method for detecting Brucella bovis, Babesia bovis, and Pasteurella multocida, comprising the following steps: using the above-mentioned primer set, performing RPA amplification on the sample to be tested to obtain RPA amplification products; detecting the RPA amplification products by agarose gel electrophoresis; wherein the size of the Brucella bovis amplification product is 148 bp, the size of the Babesia bovis amplification product is 253 bp, and the size of the Pasteurella multocida amplification product is 393 bp.

[0017] Preferably, the concentration ratio of the three pairs of specific primers in the primer set is 1:1:1:1:1:1.

[0018] Specifically, the results are determined based on the electrophoretic bands obtained from the gel imaging system. If a specific band is present only at 148 bp, it indicates the presence of *Brucella bovis* in the sample, but the absence of *Babesia bovis* and *Pasteurella multocida*. If a specific band is present only at 253 bp, it indicates the presence of *Babesia bovis* in the sample, but the absence of *Brucella bovis* and *Pasteurella multocida*. If a specific band is present only at 393 bp, it indicates the presence of *Pasteurella multocida* in the sample, but the absence of *Brucella bovis* and *Babesia bovis*. If specific bands are present at both 148 bp and 253 bp, it indicates the presence of both *Brucella bovis* and *Babesia bovis* in the sample. If specific bands are present at both 148 bp and 393 bp, it indicates the presence of both *Brucella bovis* and *Pasteurella multocida* in the sample. If specific bands are present at 148 bp, 253 bp, and 393 bp, it indicates the presence of both *Brucella bovis* and *Pasteurella multocida*. Specific bands at the bp position indicate the simultaneous presence of Brucella bovis, Babesia bovis, and Pasteurella multocida in the sample; no band indicates a negative result, meaning that Brucella bovis, Babesia bovis, and Pasteurella multocida are not present in the sample.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] The RPA primer set provided by this invention possesses advantages such as high intraspecific conservation and interspecific specificity, enabling rapid detection, simple operation, and no reliance on complex equipment. This significantly shortens detection time and improves sensitivity, eliminating false positives and making it suitable for environments requiring rapid screening, such as slaughterhouses. Furthermore, this invention uses agarose gel electrophoresis to detect amplification products; different pathogens produce products of varying sizes, providing intuitive results. Operators can quickly and accurately determine the presence of pathogens in samples and whether it is a single or mixed infection, demonstrating profound application value in public health and other fields. Attached Figure Description

[0021] Figure 1 This is the detection spectrum of the RPA primer set of this invention, where M: Marker; Lane 1: Brucella bovis amplification band; Lane 2: Babesia bovis amplification band; Lane 3: Pasteurella amplification band; Lane 4: amplification band of both Brucella bovis and Babesia bovis; Lane 5: amplification band of both Brucella bovis and Pasteurella bovis; Lane 6: amplification band of all three bacteria (Brucella bovis, Babesia bovis, and Pasteurella bovis); Lane 7: Negative control.

[0022] Figure 2 This is a sensitivity detection map of RPA primers for the Brucella bovis bcsp31 gene, where M: Marker; lane 1: bcsp31 gene copy number (10). 3 Lane 2: bcsp31 gene copy number (10 copies / μL); Lane 2: bcsp31 gene copy number (10 copies / μL); 2Lane 3: bcsp31 gene copy number (10 copies / μL); Lane 3: bcsp31 gene copy number (10 copies / μL); 1 Lane 4: bcsp31 gene copy number (5 copies / μL); Lane 5: blank control.

[0023] Figure 3 Sensitivity detection map of RPA primers for the Rap-1a gene of Bovine Babesia, where M: Marker; Lane 1: Rap-1a gene copy number (10^6). 3 Lane 2: Rap-1a gene copy number (10 copies / μL); Lane 2: Rap-1a gene copy number (10 copies / μL); 2 Lane 3: Rap-1a gene copy number (10 copies / μL); Lane 3: Rap-1a gene copy number (10 copies / μL); 1 Lane 4: Rap-1a gene copy number (5 copies / μL); Lane 5: blank control.

[0024] Figure 4 This is a sensitivity detection map of RPA primers for the Kmt1 gene of Pasteurella multocida, where M: Marker; Lane 1: Kmt1 gene copy number (10). 3 Lane 2: Kmt1 gene copy number (10 copies / μL); Lane 2: Kmt1 gene copy number (10 2 Lane 3: Kmt1 gene copy number (10 copies / μL); Lane 3: Kmt1 gene copy number (10 1 Lane 4: Kmt1 gene copy number (5 copies / μL); Lane 5: Blank control.

[0025] Figure 5 This is a specific detection spectrum of the RPA primer set of this invention, where M: Marker; Lane 1: Amplification band of Brucella bovis, Babesia bovis, and Pasteurella multocida simultaneously; Lane 2: Brucella bovis amplification band; Lane 3: Babesia bovis amplification band; Lane 4: Pasteurella multocida amplification band; Lane 5: Escherichia coli amplification band; Lane 6: Salmonella enterica amplification band; Lane 7: Staphylococcus aureus amplification band; Lane 8: Enterococcus faecalis amplification band; Lane 9: Klebsiella pneumoniae amplification band. Detailed Implementation

[0026] The present invention will be further analyzed below with reference to specific embodiments.

[0027] In this embodiment of the invention, the bcsp31 gene of *Brucella bovis*, the Rap-1a gene of *Babesia bovis*, and the Kmt1 gene of *Pasteurella multocida* were selected from the GenBank database. For conserved regions of each gene sequence, primer dimers (ΔG value > −10 kcal / mol) and hairpin structures were evaluated using Primer Express 5.0 software. Primers were designed and synthesized by Zhejiang Youkang Biotechnology Co., Ltd., resulting in the following three pairs of specific primers: F1 / R1, F2 / R2, and F3 / R3.

[0028] F1: 5'-TGATGTTTGCATCCTTACGCGCAACGATATGGAT -3', as shown in SEQ ID NO.1.

[0029] R1: 5'-TCCGGCTTTACGCAGTCAGACGTTGCCTATTGGG-3', as shown in SEQ ID NO.2.

[0030] F2: 5'- ACAACTCGCCTGTTCGGTTTCGGTATCCA -3', as shown in SEQ ID NO.3.

[0031] R2: 5'- TCCTGTACCACCTCTTGTACGCGGGCAAA -3', as shown in SEQ ID NO.4.

[0032] F3: 5'- GGACTGACACGATCAAACCGTTGAACACGA -3', as shown in SEQ ID NO.5.

[0033] R3: 5'- ATGAACCGATTGCCGCGAAATTGAGTTTTA -3', as shown in SEQ ID NO.6.

[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.

[0035] Example 1: Detection of Brucella bovis

[0036] Step (1). Sample DNA extraction

[0037] Add 1 mL of the cultured bacterial solution to a 1.5 mL centrifuge tube, centrifuge at 12000 g for 1 min, discard the supernatant, add 400 µL of lysis buffer to the centrifuge tube, mix well, add 600 µL of phenol-chloroform-isoamyl alcohol mixed solvent, shake vigorously, centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform-isoamyl alcohol mixed solvent, shake vigorously, centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform, shake vigorously, centrifuge at 12000 g for 10 min; take the supernatant, add 0.8 times the volume of isopropanol, centrifuge at 12000 g for 10 min; take the precipitate, wash once with 70% ethanol, air dry at room temperature for 20 min, then add 80 µL of ethanol. The DNA was dissolved in a TE buffer solution with a pH of 8.0 to obtain the DNA extract; this DNA extract is the template DNA; the concentration and purity of the template DNA were determined using a nucleic acid protein detector.

[0038] The phenol-chloroform-isoamyl alcohol mixed solvent is prepared by mixing phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1.

[0039] The chloroform-isoamyl alcohol mixed solvent is prepared by mixing chloroform and isoamyl alcohol in a volume ratio of 24:1;

[0040] The TE buffer solution consists of 1 mL of 1 M Tris-Cl at pH 8.0 and 0.2 mL of 0.5 M EDTA at pH 8.0, diluted to a final volume of 100 mL.

[0041] The lysis buffer is a mixture of Tris-HCl, EDTA, NaCl, proteinase K, and sodium dodecyl sulfate (SDS), wherein the concentration of Tris-HCl is 50 mM and the pH is 8.0, the concentration of EDTA is 25 mM, the concentration of NaCl is 100 mM, the concentration of proteinase K is 20 µg / µL, and the mass fraction of sodium dodecyl sulfate (SDS) is 10%.

[0042] Step (2). RPA amplification

[0043] After shaking and mixing the RPA amplification reaction system, RPA amplification was performed to obtain the amplification product.

[0044] The RPA amplification reaction system, i.e. the RPA gel detection system, consists of 50 µL of a 0.2 mL TwistAmp Basic reaction tube containing lyophilized enzyme powder, plus 29.5 µL of rehydration buffer, 8 µL of deionized water, 9 µL of mixed primers (10 µmol / L), 1 µL of extracted sample genomic DNA, and 2.5 µL of magnesium acetate solution (280 mmol / L).

[0045] After shaking and mixing the RPA amplification reaction system, place it in a 37℃ constant temperature metal bath for 20 min to obtain the amplification product.

[0046] The added mixed primers are a mixture of 3 pairs of specific primers, wherein the concentration ratio of the 3 pairs of specific primers is F1:R1:F2:R2:F3:R3=1:1:1:1:1:1.

[0047] Step (3). Electrophoretic detection of amplification products

[0048] After the reaction, take 2–3 μL of the amplification product and perform electrophoresis on a 2.0% agarose gel. The results are determined based on the corresponding electrophoretic bands obtained using a gel imaging system. Figure 1 As shown in lane 1. The results show a specific band at 148 bp, indicating the presence of Brucella bovis in the sample.

[0049] Example 2: Detection of Bovine Babesia

[0050] Step (1). Sample DNA extraction

[0051] Add 1 mL of the cultured bacterial solution to a 1.5 mL centrifuge tube, centrifuge at 12000 g for 1 min, discard the supernatant, add 400 µL of lysis buffer to the centrifuge tube, mix well, add 600 µL of phenol-chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add 0.8 times the volume of isopropanol, and centrifuge at 12000 g for 10 min; take the precipitate, wash once with 70% ethanol, then air dry at room temperature or 50℃ for 20 min, and then add 80 µL of ethanol. The DNA was dissolved in a TE buffer solution with a pH of 8.0 to obtain the DNA extract; this DNA extract is the template DNA; the concentration and purity of the template DNA were determined using a nucleic acid protein detector.

[0052] The phenol-chloroform-isoamyl alcohol mixed solvent is prepared by mixing phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1.

[0053] The chloroform-isoamyl alcohol mixed solvent is prepared by mixing chloroform and isoamyl alcohol in a volume ratio of 24:1;

[0054] The TE buffer solution consists of 1 mL of 1 M Tris-Cl at pH 8.0 and 0.2 mL of 0.5 M EDTA at pH 8.0, diluted to a final volume of 100 mL.

[0055] The lysis buffer is a mixture of Tris-HCl, EDTA, NaCl, proteinase K, and sodium dodecyl sulfate (SDS), wherein the concentration of Tris-HCl is 50 mM and the pH is 8.0, the concentration of EDTA is 25 mM, the concentration of NaCl is 100 mM, the concentration of proteinase K is 20 µg / µL, and the mass fraction of sodium dodecyl sulfate (SDS) is 10%.

[0056] Step (2). RPA amplification

[0057] After shaking and mixing the RPA amplification reaction system, RPA amplification was performed to obtain the amplification product.

[0058] The RPA amplification reaction system, i.e. the RPA gel detection system, consists of 50 µL of a 0.2 mL TwistAmp Basic reaction tube containing lyophilized enzyme powder, plus 29.5 µL of rehydration buffer, 8 µL of deionized water, 9 µL of mixed primers (10 µmol / L), 1 µL of extracted sample genomic DNA, and 2.5 µL of magnesium acetate solution (280 mmol / L).

[0059] After shaking and mixing the RPA amplification reaction system, place it in a 37℃ constant temperature metal bath for 20 min to obtain the amplification product.

[0060] The added mixed primers are a mixture of 3 pairs of specific primers, wherein the concentration ratio of the 3 pairs of specific primers is F1:R1:F2:R2:F3:R3=1:1:1:1:1:1.

[0061] Step (3). Electrophoretic detection of amplification products

[0062] After the reaction, take 2–3 μL of the amplification product and perform electrophoresis on a 2.0% agarose gel. The results are determined based on the corresponding electrophoretic bands obtained using a gel imaging system. Figure 1As shown in lane 2. The results show a specific band at 253 bp, indicating the presence of Bovine Babesia in the sample.

[0063] Example 3: Detection of Pasteurella multocida

[0064] Step (1). Sample DNA extraction

[0065] Add 1 mL of the cultured bacterial solution to a 1.5 mL centrifuge tube, centrifuge at 12000 g for 1 min, discard the supernatant, add 400 µL of lysis buffer to the centrifuge tube, mix well, add 600 µL of phenol-chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add 0.8 times the volume of isopropanol, and centrifuge at 12000 g for 10 min; take the precipitate, wash once with 70% ethanol, then air dry at room temperature or 50℃ for 20 min, and then add 80 µL of ethanol. The DNA was dissolved in a TE buffer solution with a pH of 8.0 to obtain the DNA extract; this DNA extract is the template DNA; the concentration and purity of the template DNA were determined using a nucleic acid protein detector.

[0066] The phenol-chloroform-isoamyl alcohol mixed solvent is prepared by mixing phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1.

[0067] The chloroform-isoamyl alcohol mixed solvent is prepared by mixing chloroform and isoamyl alcohol in a volume ratio of 24:1;

[0068] The TE buffer solution consists of 1 mL of 1 M Tris-Cl at pH 8.0 and 0.2 mL of 0.5 M EDTA at pH 8.0, diluted to a final volume of 100 mL.

[0069] The lysis buffer is a mixture of Tris-HCl, EDTA, NaCl, proteinase K, and sodium dodecyl sulfate (SDS), wherein the concentration of Tris-HCl is 50 mM and the pH is 8.0, the concentration of EDTA is 25 mM, the concentration of NaCl is 100 mM, the concentration of proteinase K is 20 µg / µL, and the mass fraction of sodium dodecyl sulfate (SDS) is 10%.

[0070] Step (2). RPA amplification

[0071] After shaking and mixing the RPA amplification reaction system, RPA amplification was performed to obtain the amplification product.

[0072] The RPA amplification reaction system, i.e. the RPA gel detection system, consists of 50 µL of a 0.2 mL TwistAmp Basic reaction tube containing lyophilized enzyme powder, plus 29.5 µL of rehydration buffer, 8 µL of deionized water, 9 µL of mixed primers (10 µmol / L), 1 µL of extracted sample genomic DNA, and 2.5 µL of magnesium acetate solution (280 mmol / L).

[0073] After shaking and mixing the RPA amplification reaction system, place it in a 37℃ constant temperature metal bath for 20 min to obtain the amplification product.

[0074] The added mixed primers are a mixture of 3 pairs of specific primers, wherein the concentration ratio of the 3 pairs of specific primers is F1:R1:F2:R2:F3:R3=1:1:1:1:1:1.

[0075] Step (3). Electrophoretic detection of amplification products

[0076] After the reaction, take 2–3 μL of the amplification product and perform electrophoresis on a 2.0% agarose gel. The results are determined based on the corresponding electrophoretic bands obtained using a gel imaging system. Figure 1 As shown in lane 3. The results show a specific band at 393 bp, indicating the presence of Pasteurella in the sample.

[0077] Example 4: Simultaneous detection of Brucella bovis and Babesia bovis

[0078] Step (1). Sample DNA extraction

[0079] Add 1 mL of the cultured bacterial solution to a 1.5 mL centrifuge tube, centrifuge at 12000 g for 1 min, discard the supernatant, add 400 µL of lysis buffer to the centrifuge tube, mix well, add 600 µL of phenol-chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add 0.8 times the volume of isopropanol, and centrifuge at 12000 g for 10 min; take the precipitate, wash once with 70% ethanol, then air dry at room temperature or 50℃ for 20 min, and then add 80 µL of ethanol. The DNA was dissolved in a TE buffer solution with a pH of 8.0 to obtain the DNA extract; this DNA extract is the template DNA; the concentration and purity of the template DNA were determined using a nucleic acid protein detector.

[0080] The phenol-chloroform-isoamyl alcohol mixed solvent is prepared by mixing phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1.

[0081] The chloroform-isoamyl alcohol mixed solvent is prepared by mixing chloroform and isoamyl alcohol in a volume ratio of 24:1;

[0082] The TE buffer solution consists of 1 mL of 1 M Tris-Cl at pH 8.0 and 0.2 mL of 0.5 M EDTA at pH 8.0, diluted to a final volume of 100 mL.

[0083] The lysis buffer is a mixture of Tris-HCl, EDTA, NaCl, proteinase K, and sodium dodecyl sulfate (SDS), wherein the concentration of Tris-HCl is 50 mM and the pH is 8.0, the concentration of EDTA is 25 mM, the concentration of NaCl is 100 mM, the concentration of proteinase K is 20 µg / µL, and the mass fraction of sodium dodecyl sulfate (SDS) is 10%.

[0084] Step (2). RPA amplification

[0085] After shaking and mixing the RPA amplification reaction system, RPA amplification was performed to obtain the amplification product.

[0086] The RPA amplification reaction system, i.e. the RPA gel detection system, consists of 50 µL of a 0.2 mL TwistAmp Basic reaction tube containing lyophilized enzyme powder, plus 29.5 µL of rehydration buffer, 8 µL of deionized water, 9 µL of mixed primers (10 µmol / L), 1 µL of extracted sample genomic DNA, and 2.5 µL of magnesium acetate solution (280 mmol / L).

[0087] After shaking and mixing the RPA amplification reaction system, place it in a 37℃ constant temperature metal bath for 20 min to obtain the amplification product.

[0088] The added mixed primers are a mixture of 3 pairs of specific primers, wherein the concentration ratio of the 3 pairs of specific primers is F1:R1:F2:R2:F3:R3=1:1:1:1:1:1.

[0089] Step (3). Electrophoretic detection of amplification products

[0090] After the reaction, take 2–3 μL of the amplification product and perform electrophoresis on a 2.0% agarose gel. The results are determined based on the corresponding electrophoretic bands obtained using a gel imaging system. Figure 1Lane 4 is shown. The results show that there are specific bands at 148 bp and 253 bp, indicating that the sample contains both Brucella bovis and Babesia bovis.

[0091] Example 5: Simultaneous detection of Brucella bovis and Pasteurella multocida

[0092] Step (1). Sample DNA extraction

[0093] Add 1 mL of the cultured bacterial solution to a 1.5 mL centrifuge tube, centrifuge at 12000 g for 1 min, discard the supernatant, add 400 µL of lysis buffer to the centrifuge tube, mix well, add 600 µL of a phenol-chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add 0.8 times the volume of isopropanol, and centrifuge at 12000 g for 10 min; take the precipitate, wash once with 70% ethanol, then air dry at room temperature or 50℃ for 20 min, and then add 80 µL of a solution with a pH of 8.0. The DNA was dissolved in TE buffer to obtain the DNA extract; this DNA extract is the template DNA; the concentration and purity of the template DNA were determined using a nucleic acid protein detector.

[0094] The phenol-chloroform-isoamyl alcohol mixed solvent is prepared by mixing phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1.

[0095] The chloroform-isoamyl alcohol mixed solvent is prepared by mixing chloroform and isoamyl alcohol in a volume ratio of 24:1;

[0096] The TE buffer solution consists of 1 mL of 1 M Tris-Cl at pH 8.0 and 0.2 mL of 0.5 M EDTA at pH 8.0, diluted to a final volume of 100 mL.

[0097] The lysis buffer is a mixture of Tris-HCl, EDTA, NaCl, proteinase K, and sodium dodecyl sulfate (SDS), wherein the concentration of Tris-HCl is 50 mM and the pH is 8.0, the concentration of EDTA is 25 mM, the concentration of NaCl is 100 mM, the concentration of proteinase K is 20 µg / µL, and the mass fraction of sodium dodecyl sulfate (SDS) is 10%.

[0098] Step (2). RPA amplification

[0099] After shaking and mixing the RPA amplification reaction system, RPA amplification was performed to obtain the amplification product.

[0100] The RPA amplification reaction system, i.e. the RPA gel detection system, consists of 50 µL of a 0.2 mL TwistAmp Basic reaction tube containing lyophilized enzyme powder, plus 29.5 µL of rehydration buffer, 8 µL of deionized water, 9 µL of mixed primers (10 µmol / L), 1 µL of extracted sample genomic DNA, and 2.5 µL of magnesium acetate solution (280 mmol / L).

[0101] After shaking and mixing the RPA amplification reaction system, place it in a 37℃ constant temperature metal bath for 20 min to obtain the amplification product.

[0102] The added mixed primers are a mixture of 3 pairs of specific primers, wherein the concentration ratio of the 3 pairs of specific primers is F1:R1:F2:R2:F3:R3=1:1:1:1:1:1.

[0103] Step (3). Electrophoretic detection of amplification products

[0104] After the reaction, take 2–3 μL of the amplification product and perform electrophoresis on a 2.0% agarose gel. The results are determined based on the corresponding electrophoretic bands obtained using a gel imaging system. Figure 1 Lane 5 is shown. The results show that there are specific bands at 148 bp and 393 bp, indicating that both Brucella bovis and Pasteurella multocida are present in the sample.

[0105] Example 6: Simultaneous detection of Brucella bovis, Babesia bovis and Pasteurella multocida

[0106] Step (1). Sample DNA extraction

[0107] Add 1 mL of the cultured bacterial solution to a 1.5 mL centrifuge tube, centrifuge at 12000 g for 1 min, discard the supernatant, add 400 µL of lysis buffer to the centrifuge tube, mix well, add 600 µL of a phenol-chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add 0.8 times the volume of isopropanol, and centrifuge at 12000 g for 10 min; take the precipitate, wash once with 70% ethanol, then air dry at room temperature or 50℃ for 20 min, and then add 80 µL of a solution with a pH of 8.0. The DNA was dissolved in TE buffer to obtain the DNA extract; this DNA extract is the template DNA; the concentration and purity of the template DNA were determined using a nucleic acid protein detector.

[0108] The phenol-chloroform-isoamyl alcohol mixed solvent is prepared by mixing phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1.

[0109] The chloroform-isoamyl alcohol mixed solvent is prepared by mixing chloroform and isoamyl alcohol in a volume ratio of 24:1;

[0110] The TE buffer solution consists of 1 mL of 1 M Tris-Cl at pH 8.0 and 0.2 mL of 0.5 M EDTA at pH 8.0, diluted to a final volume of 100 mL.

[0111] The lysis buffer is a mixture of Tris-HCl, EDTA, NaCl, proteinase K, and sodium dodecyl sulfate (SDS), wherein the concentration of Tris-HCl is 50 mM and the pH is 8.0, the concentration of EDTA is 25 mM, the concentration of NaCl is 100 mM, the concentration of proteinase K is 20 µg / µL, and the mass fraction of sodium dodecyl sulfate (SDS) is 10%.

[0112] Step (2). RPA amplification

[0113] After shaking and mixing the RPA amplification reaction system, RPA amplification was performed to obtain the amplification product.

[0114] The RPA amplification reaction system, i.e. the RPA gel detection system, consists of 50 µL of a 0.2 mL TwistAmp Basic reaction tube containing lyophilized enzyme powder, plus 29.5 µL of rehydration buffer, 8 µL of deionized water, 9 µL of mixed primers (10 µmol / L), 1 µL of extracted sample genomic DNA, and 2.5 µL of magnesium acetate solution (280 mmol / L).

[0115] After shaking and mixing the RPA amplification reaction system, place it in a 37℃ constant temperature metal bath for 20 min to obtain the amplification product.

[0116] The added mixed primers are a mixture of 3 pairs of specific primers, wherein the concentration ratio of the 3 pairs of specific primers is F1:R1:F2:R2:F3:R3=1:1:1:1:1:1.

[0117] Step (3). Electrophoretic detection of amplification products

[0118] After the reaction, take 2–3 μL of the amplification product and perform electrophoresis on a 2.0% agarose gel. The results are determined based on the corresponding electrophoretic bands obtained using a gel imaging system. Figure 1 Lane 6 is shown. The results show that there are specific bands at 148 bp, 253 bp and 393 bp, indicating that the sample contains Brucella bovis, Babesia bovis and Pasteurella multocida.

[0119] Example 7: Negative Control

[0120] Step (1). Sample DNA extraction

[0121] Add 1 mL of the cultured bacterial solution to a 1.5 mL centrifuge tube, centrifuge at 12000 g for 1 min, discard the supernatant, add 400 µL of lysis buffer to the centrifuge tube, mix well, add 600 µL of a phenol-chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform-isoamyl alcohol mixed solvent, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add an equal volume of chloroform, shake vigorously, and centrifuge at 12000 g for 10 min; take the supernatant, add 0.8 times the volume of isopropanol, and centrifuge at 12000 g for 10 min; take the precipitate, wash once with 70% ethanol, then air dry at room temperature or 50℃ for 20 min, and then add 80 µL of a solution with a pH of 8.0. The DNA was dissolved in TE buffer to obtain the DNA extract; this DNA extract is the template DNA; the concentration and purity of the template DNA were determined using a nucleic acid protein detector.

[0122] The phenol-chloroform-isoamyl alcohol mixed solvent is prepared by mixing phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1.

[0123] The chloroform-isoamyl alcohol mixed solvent is prepared by mixing chloroform and isoamyl alcohol in a volume ratio of 24:1;

[0124] The TE buffer solution consists of 1 mL of 1 M Tris-Cl at pH 8.0 and 0.2 mL of 0.5 M EDTA at pH 8.0, diluted to a final volume of 100 mL.

[0125] The lysis buffer is a mixture of Tris-HCl, EDTA, NaCl, proteinase K, and sodium dodecyl sulfate (SDS), wherein the concentration of Tris-HCl is 50 mM and the pH is 8.0, the concentration of EDTA is 25 mM, the concentration of NaCl is 100 mM, the concentration of proteinase K is 20 µg / µL, and the mass fraction of sodium dodecyl sulfate (SDS) is 10%.

[0126] Step (2). RPA amplification

[0127] After shaking and mixing the RPA amplification reaction system, RPA amplification was performed to obtain the amplification product.

[0128] The RPA amplification reaction system, i.e. the RPA gel detection system, consists of 50 µL of a 0.2 mL TwistAmp Basic reaction tube containing lyophilized enzyme powder, plus 29.5 µL of rehydration buffer, 8 µL of deionized water, 9 µL of mixed primers (10 µmol / L), 1 µL of extracted sample genomic DNA, and 2.5 µL of magnesium acetate solution (280 mmol / L).

[0129] After shaking and mixing the RPA amplification reaction system, place it in a 37℃ constant temperature metal bath for 20 min to obtain the amplification product.

[0130] The added mixed primers are a mixture of 3 pairs of specific primers, wherein the concentration ratio of the 3 pairs of specific primers is F1:R1:F2:R2:F3:R3=1:1:1:1:1:1.

[0131] Step (3). Electrophoretic detection of amplification products

[0132] After the reaction, take 2–3 μL of the amplification product and perform electrophoresis on a 2.0% agarose gel. The results are determined based on the corresponding electrophoretic bands obtained using a gel imaging system. Figure 1As shown in lane 7. The results showed no specific bands, indicating that Brucella bovis, Babesia bovis, and Pasteurella multocida were not present in the sample.

[0133] Test Example 1: Verifying the sensitivity, repeatability, and specificity of the primers of this invention.

[0134] The DNA standard was diluted with enzyme-free water to a concentration of 10. 3 10 2 10 1 The sensitivity of the established reaction system was verified by using 5 copies / μL of the diluted solution as a template and enzyme-free water as a negative control.

[0135] The DNA standard was diluted with enzyme-free water to a concentration of 10. 3 10 2 10 1 5 copies / μL were used as the template for the dilution, and enzyme-free water was used as the negative control. The experiment was repeated 6 times to verify the reproducibility of the established reaction system.

[0136] Common pathogens found in bovine samples and their environment, including Escherichia coli, Salmonella enterica, Staphylococcus aureus, Enterococcus faecalis, and Klebsiella pneumoniae, were selected and detected using optimized detection methods to verify the specificity of the established reaction system.

[0137] The sensitivity results are as follows: Figure 2-4 As shown, the experimental results indicate that the detection sensitivity for Brucella bovis, Babesia bovis, and Pasteurella multocida reaches 5-10. 1 The sensitivity is high, with a concentration of copies / μL. The repeatability of the reaction system was examined by repeatedly testing six parallel samples, and the results showed that the signal detected in six repeated tests had good stability. Specificity results are as follows: Figure 5 As shown, RPA was used to detect Brucella bovis, Babesia bovis, Pasteurella multocida, and five other strains. The results showed that RPA detected clear bands in Brucella bovis, Babesia bovis, and Pasteurella multocida, while no bands were found in the other five strains. This indicates that RPA detection has high specificity and the detection results are reliable.

[0138] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of this invention should be considered within the scope of protection of this invention.

Claims

1. An RPA primer set for detecting Brucella bovis, Babesia bovis, and Pasteurella multocida, characterized in that, The RPA primer set includes three pairs of specific primers F1-R1, F2-R2, and F3-R3, with the primer sequences as follows: F1: TGATGTTTGCATCCTTACGCGCAACGATATGGAT R1:TCCGGCTTTACGCAGTCAGACGTTGCCTATTGGG F2:ACAACTCGCCTGTTCGGTTTCGGTATCCA R2: TCCTGTACCACCTCTTGTACGCGGGCAAA F3: GGACTGACACGATCAAACCGTTGAACACGA R3: ATGAACCGATTGCCGCGAAATTGAGTTTTA.

2. The application of the RPA primer set as described in claim 1 in the preparation of detection products for Brucella bovis, Babesia bovis, and / or Pasteurella multocida.

3. The application according to claim 2, characterized in that, The product is a kit or probe.

4. A product for detecting Brucella bovis, Babesia bovis, and / or Pasteurella multocida, characterized in that, The product comprises the RPA primer set as described in claim 1.

5. The product according to claim 4, characterized in that, The product is a kit or probe.

6. A method for detecting Brucella bovis, Babesia bovis, and Pasteurella multocida, characterized in that, The method includes the following steps: The RPA primer set described in claim 1 was used to perform RPA amplification on the test sample to obtain RPA amplification products; the amplification products were detected by agarose gel electrophoresis; the amplified product size of Brucella bovis was 148 bp, the amplified product size of Babesia bovis was 253 bp, and the amplified product size of Pasteurella multocida was 393 bp.

7. The method according to claim 6, characterized in that, The type of sample to be tested is determined based on the electrophoresis results: If a specific band is only present at 148 bp, it indicates the presence of *Brucella bovis*, but the absence of *Babesia bovis* and *Pasteurella multocida*; if a specific band is only present at 253 bp, it indicates the presence of *Babesia bovis*, but the absence of *Brucella bovis* and *Pasteurella multocida*; if a specific band is only present at 393 bp, it indicates the presence of *Pasteurella multocida*, but the absence of *Brucella bovis* and *Babesia bovis*; if specific bands are present at both 148 bp and 253 bp, it indicates the presence of both *Brucella bovis* and *Babesia bovis*; if specific bands are present at both 148 bp and 393 bp, it indicates the presence of both *Brucella bovis* and *Pasteurella multocida*; if specific bands are present at 148 bp, 253 bp, ... Specific bands at the bp position indicate the simultaneous presence of Brucella bovis, Babesia bovis, and Pasteurella multocida in the sample; no band indicates a negative result, meaning that Brucella bovis, Babesia bovis, and Pasteurella multocida are not present in the sample.

8. The method according to claim 6, characterized in that, When performing RPA amplification, the concentration ratio of F1, R1, F2, R2, F3, and R3 in the RPA primer set is 1:1:1:1:1:1.

Images